Prosecution Insights
Last updated: May 29, 2026
Application No. 17/612,465

COMPOSITIONS AND METHODS FOR THE TREATMENT OF DBA USING GATA1 GENE THERAPY

Final Rejection §103§112
Filed
Nov 18, 2021
Priority
Jun 10, 2019 — provisional 62/859,369 +1 more
Examiner
HILL, KEVIN KAI
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Children's Hospital of Philadelphia
OA Round
4 (Final)
36%
Grant Probability
At Risk
5-6
OA Rounds
0m
Est. Remaining
70%
With Interview

Examiner Intelligence

Grants only 36% of cases
36%
Career Allowance Rate
309 granted / 854 resolved
-23.8% vs TC avg
Strong +33% interview lift
Without
With
+33.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
50 currently pending
Career history
923
Total Applications
across all art units

Statute-Specific Performance

§101
0.6%
-39.4% vs TC avg
§103
73.0%
+33.0% vs TC avg
§102
7.3%
-32.7% vs TC avg
§112
5.4%
-34.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 854 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Detailed Action This action is in response to the papers filed April 2, 2026. Amendments Applicant's response and amendments, filed April 2, 2026, to the prior Office Action is acknowledged. Applicant has cancelled Claims 1-35, 37, and 52, and amended Claims 36 and 53. Claims 36, 38-51, and 53 are pending and under examination. Priority This application is a 371 of PCT/US2020/036600 filed on June 8, 2020. Applicant’s claim for the benefit of a prior-filed application provisional application 62/859,369 filed on June 10, 2019 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged. Information Disclosure Statement Applicant has filed an Information Disclosure Statement on April 2, 2026 that has been considered. The information disclosure statement filed April 2, 2026 fails to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because 37 CFR 1.98(b) requires that each item of information in an IDS be identified properly. Each publication must be identified by publisher, author (if any), title, relevant pages of the publication, and date and place of publication. The date of publication supplied must include at least the month and year of publication, except that the year of publication (without the month) will be accepted if the applicant points out in the information disclosure statement that the year of publication is sufficiently earlier than the effective U.S. filing date and any foreign priority date so that the particular month of publication is not in issue. See also MPEP 707.05(e) for electronic documents, including, but not limited to: (D) reference to the unique Digital Object Identifier (DOI) number, or other unique identification number, if known. Bibliographic information provided must be at least enough to identify the publication. author, title and date. For books, minimal information includes the author, title, and date. For periodicals, at least the title of the periodical, the volume number, date, and pages should be given. NPL citation 2-3 have been lined through for being defective of one or more requirements. The signed and initialed PTO Forms 1449 are mailed with this action. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Allowable Subject Matter 1. Claim 53 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. The following is a statement of reasons for the indication of allowable subject matter: Claim 53 has been amended to recite a nucleic acid sequence comprising: a) a sequence encoding a GATA1 polypeptide; and b) a sequence comprising the concatenation of: i) a first human sequence that is nucleotides 2708-3043 of SEQ ID NO:62; ii) a second human sequence that is nucleotides 3052-3430 of SEQ ID NO:62; and iii) a third human sequence that is nucleotides 3437-4251 of SEQ ID NO:62. The prior art does not appear to teach or fairly suggest the concatenation of: i) a first human sequence that is nucleotides 2708-3043 of SEQ ID NO:62; ii) a second human sequence that is nucleotides 3052-3430 of SEQ ID NO:62; and iii) a third human sequence that is nucleotides 3437-4251 of SEQ ID NO:62. To put it another way, the prior art does not appear to teach or fairly suggest a nucleic acid molecule encoding: i) a first human sequence that is nucleotides 2708-3043 of SEQ ID NO:62 adjacent to ii) a second human sequence that is nucleotides 3052-3430 of SEQ ID NO:62 adjacent to iii) a third human sequence that is nucleotides 3437-4251 of SEQ ID NO:62. Trinklein et al (US 2007/0161031) is considered relevant prior art for having disclosed a nucleic acid molecule (SEQ ID NO:45096) comprising a nucleotide sequence that is 99.7% (2 mismatches) to nucleotides 3435-4223 of instant SEQ ID NO:62. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 2. The prior rejection of Claim 52 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, is withdrawn in light of Applicant’s cancellation of the claim. 3. The prior rejections of Claim 53 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, are withdrawn in light of Applicant’s amendment to the claim to recite wherein: i) the first human sequence is nucleotides 2708-3043 of SEQ ID NO:62; ii) the second human sequence is nucleotides 3052-3430 of SEQ ID NO:62; and iii) the third human sequence is nucleotides 3437-4251 of SEQ ID NO:62. 4. Claims 36 and 38-51 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Applicant has amended Claim 36 to recite a nucleotide sequence comprising a concatenation of: i) a first DNA sequence which i) has open chromatin structure in differentiating human erythroid cells, and ii) is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame; ii) a second DNA sequence which i) has open chromatin structure in differentiating human erythroid cells, and ii) is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame; and iii) a third DNA sequence which i) has open chromatin structure in differentiating human erythroid cells, and ii) is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame. The term “a… DNA sequence” is a relative term which renders the claim indefinite. The term “a… DNA sequence” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. English has two articles: ‘the’, and ‘a/an’. ‘the’ is a definite article, referring to a specific or particular noun; whereas, ‘a/an’ is an indefinite article, modifying non-specific or non-particular nouns. While the Figures 8A and 28A illustrate a cartoon of where a “3 peak” enhancer(s) exists upstream of the GATA1 gene, neither the Figure nor the specification actually disclose the exact location(s) nor the nucleotide sequence(s) of said “3 peak” enhancer(s). It would seem that the first, second, and third regions may each contain 1000 nucleotides or more. Figure 8A clearly illustrates, for example, a DNA region that is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame, yet comprises both more than one distinct open (peaks) DNA regions and more than one distinct closed (troughs) DNA regions, as shown below: PNG media_image1.png 112 72 media_image1.png Greyscale Thus it is unclear which “open” domain(s) or subdomain(s) is/are to be present in the claimed “first DNA sequence”, “second DNA sequence”, and “third DNA sequence”, respectively, that is then to be concatenated. Figure 8A clearly discloses a multitude of different peaks (syn. “open”) positioned upstream of and within 7kb of the boundary of the endogenous human GATA1 open reading frame, for example, including, but not limited to, the arrows shown below: PNG media_image2.png 106 766 media_image2.png Greyscale Figure 8A evidences that different DNA sequences are “open” (peaks vs troughs) in different types and/or stages of differentiating human erythroid cells, for example, as shown below: PNG media_image3.png 204 116 media_image3.png Greyscale The recitation implies a genus of different reference “differentiating human erythroid cells” by which “open chromatin structure” is to be determined and/or identified, thereby rendering the claim indefinite. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)). If there are multiple ways to measure “open chromatin structure”, to wit, different types and/or stages of “differentiating human erythroid cells”, yet each yields a different result, then the claimed “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence”, respectively, may be indefinite because it is unclear which type(s) and/or stage(s) of “differentiating human erythroid cells” is to be referenced, and the corresponding “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence” is to be present in the claimed concatenation to determine infringement. The claims do not recite, and the specification fails to disclose, the metes and bounds of the DNA sequence to which “a first DNA sequence”, “a second DNA sequence”, and “a third DNA sequence” refers. The claimed DNA region positioned upstream of the boundary of the human GATA1 open reading frame is at least 7000 nucleotides in length, and thus is composed of a multitude of subsequences. The recited limitations each encompass nucleic acids of at least 7000 nucleotides in length, or something as small as just 2 nucleotides. In light of Figure 8A, the recited “DNA sequence” would each appear to encompass a range of nucleotide lengths, e.g. about 500 to about 1500 nucleotides (SEQ ID NO:11 is 501 nucleotides, SEQ ID NO:38 is 1179 nucleotides); however, instant Claim 36 is broader in scope than the disclosed SEQ ID NO’s. The specification discloses a hematopoietic enhancer minigene construct comprising a concatenation of four distinct regulatory elements, to wit, a -3kb hematopoietic enhancer, a GATA motif, a CACCC box, and the first intron of GATA1 (e.g. pg 45, lines 2-3). However, the specification fails to disclose the nucleotide sequence of the -3kb hematopoietic enhancer, and thus is uninformative of how this sequence relates to the “first DNA sequence”, the “second DNA sequence”, and/or the “third DNA sequence”. For example, is this the entirety of the “DNA sequence”, or is it only a fragment of the “DNA sequence”? Further, those of ordinary skill in the art would immediately recognize that the GATA motif and CACCC box, individually and respectively, are mere fragments of (4/500; 4/1500) the claimed “DNA sequence”. The claim is considered indefinite because it is unclear is Applicant is requiring concatenation of the entire first, second, and third regions, respectively, or if the concatenation only requires some fragment(s) of the first, second, and third regions, respectively, e.g. just the GATA motif and CACCC box, for example. The claim is considered indefinite because it is unclear which one or more fragment(s) of the first, second, and third regions, respectively, are to be concatenated, for example. SEQ ID NO:62 is 7503 nucleotides in length. To what first, second, and/or third sequences in SEQ ID NO:62, per “the….sequence in SEQ ID NO:62”, is Applicant referring?? The claim fails to recite, and the specification fails to disclose, what is “the first sequence”, “the second sequence”, and/or “the third sequence” in SEQ ID NO:62. The functional language of Claim 53 suffers the same deficiencies as the functional language of Claim 36. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Response to Arguments The Examiner acknowledges and has considered the Voit Declaration filed under 37 CFR §1.132 on April 2, 2026. Voit declares (para 5-6) that the ordinary artisan does not peak-call chromatin accessibility data using the human eye, but must instead utilize standardized thresholds, e.g. using Genrich or ROCCO algorithms. Voit’s argument(s) has been fully considered, but is not persuasive. As a first matter, Applicant’s statement is not on point. Independent Claim 36 recites “a… DNA sequence” at a high level of generality and is a relative term which renders the claim indefinite. The term “a… DNA sequence” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The recitation implies a genus of different reference “differentiating human erythroid cells” by which “open chromatin structure” is to be determined and/or identified, thereby rendering the claim indefinite. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)). As shown in the rejection, Figure 8A clearly illustrates, for example, a DNA region that is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame, yet comprises both more than one distinct open (peaks) DNA regions and more than one distinct closed (troughs) DNA regions. Thus, it is unclear which peak(s) shown in Figure 8 is/are to be present in the construct of independent Claim 36 and/or which peak(s) shown in Figure 8 may be absent from the construct of independent Claim 36. Figure 8A evidences that different DNA sequences are “open” (peaks vs troughs) in different types and/or stages of differentiating human erythroid cells. If there are multiple ways to measure “open chromatin structure”, to wit, different types and/or stages of “differentiating human erythroid cells”, yet each yields a different result, then the claimed “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence”, respectively, may be indefinite because it is unclear which type(s) and/or stage(s) of “differentiating human erythroid cells” is to be referenced, and the corresponding “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence” is to be present in the claimed concatenation to determine infringement. As a second matter, instant claims do not require the use of Genrich or ROCCO algorithms to peak-call chromatin accessibility data. Applicant argues that the ordinary artisan would have been able to realize the boundaries of the 3 peaks described in the instant specification using readily available, standardized tools for peak-calling. Applicant’s argument(s) has been fully considered, but is not persuasive. As a first matter, Applicant’s statement is not on point. Independent Claim 36 recites “a… DNA sequence” at a high level of generality and is a relative term which renders the claim indefinite. The term “a… DNA sequence” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The recitation implies a genus of different reference “differentiating human erythroid cells” by which “open chromatin structure” is to be determined and/or identified, thereby rendering the claim indefinite. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)). As shown in the rejection, Figure 8A clearly illustrates, for example, a DNA region that is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame, yet comprises both more than one distinct open (peaks) DNA regions and more than one distinct closed (troughs) DNA regions. Thus, it is unclear which peak(s) shown in Figure 8 is/are to be present in the construct of independent Claim 36 and/or which peak(s) shown in Figure 8 may be absent from the construct of independent Claim 36. Figure 8A evidences that different DNA sequences are “open” (peaks vs troughs) in different types and/or stages of differentiating human erythroid cells. If there are multiple ways to measure “open chromatin structure”, to wit, different types and/or stages of “differentiating human erythroid cells”, yet each yields a different result, then the claimed “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence”, respectively, may be indefinite because it is unclear which type(s) and/or stage(s) of “differentiating human erythroid cells” is to be referenced, and the corresponding “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence” is to be present in the claimed concatenation to determine infringement. As a second matter, per the argued “the 3 peaks described in the instant specification”, the court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). Instant independent Claim 36 fails to recite the boundary(ies) of the first, second, and/or third sequences having open chromatin structure, and is broader in scope than the argued “the 3 peaks described in the instant specification”. Absent objective evidence to the contrary, it would be remedial for Applicant to amend the independent Claim 36 to recite the nucleotide(s) of SEQ ID NO:62 that are to be present in: i) the first human sequence is nucleotides ### of SEQ ID NO:62; ii) the second human sequence is nucleotides ### of SEQ ID NO:62; and iii) the third human sequence is nucleotides ### of SEQ ID NO:62. See, for example, Applicant’s amendment to Claim 53. Applicant argues that the specification provides Figure 8A, and thus the ordinary artisan would understand the location of GATA1 open reading frame, and the three sequences with open chromatin structure. Applicant’s argument(s) has been fully considered, but is not persuasive. Figure 8A is merely an illustration. The instant specification and Figure 8A fail to disclose the nucleotide sequences of the claimed first, second, and third DNA sequences. Applicant argues that Buenrostro et al (2013; of record in IDS) depicts open or active chromatin in Figure 1 (ATAC-seq peak intensities). Applicant’s argument(s) has been fully considered, but is not persuasive. Buenrostro et al (Figure 1) and instant Figure 8A are merely illustrations. Neither Buenrostro et al, the instant specification, nor instant Figure 8A teach/disclose the nucleotide sequences of the claimed first, second, and third DNA sequences. Applicant argues that it is incorrect in stating “each region seems to have subdomains that are “closed”, while other subdomains are “open”. Applicant’s argument(s) has been fully considered, but is not persuasive. Figure 8A clearly illustrates, for example, a DNA region that is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame, yet comprises both more than one distinct open (peaks) DNA regions and more than one distinct closed (troughs) DNA regions, as shown below: PNG media_image1.png 112 72 media_image1.png Greyscale Thus it is unclear which “open” domain(s) or subdomain(s) is/are to be present in the claimed “first DNA sequence”, “second DNA sequence”, and “third DNA sequence”, respectively, that is then to be concatenated. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). 5. Claim(s) 36 and 38-51 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Applicant has amended Claim 36 to recite a nucleotide sequence comprising a concatenation of: i) a first DNA sequence which i) has open chromatin structure in differentiating human erythroid cells, and ii) is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame; ii) a second DNA sequence which i) has open chromatin structure in differentiating human erythroid cells, and ii) is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame; and iii) a third DNA sequence which i) has open chromatin structure in differentiating human erythroid cells, and ii) is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame. Applicant has amended Claim 53 to recite: “the first sequence is the first sequence in SEQ ID NO:62”; “the second sequence is the second sequence in SEQ ID NO:62”; and “the third sequence is the third sequence in SEQ ID NO:62”. SEQ ID NO:62 is 7503 nucleotides in length. To what first, second, and/or third sequences in SEQ ID NO:62, per “the….sequence in SEQ ID NO:62”, is Applicant referring?? The claim fails to recite, and the specification fails to disclose, what is “the first sequence”, “the second sequence”, and/or “the third sequence” in SEQ ID NO:62. The Examiner incorporates herein the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection. Substituting a first limitation(s) described only using functional language, to wit: human GATA1 enhancer (hG1E) element (prior Claim 36), and the 3 regions of DNA with open chromatin that are positioned upstream of and within at least 7 kb of the boundary of the human GATA1 open reading frame (prior Claim 37), for a second limitation described only using functional language, to wit: a first, second, and third region of DNA which has open chromatin structure in differentiating human erythroid cells, and b) which is positioned upstream of and within at least 7 kb of the boundary of the endogenous human GATA1 open reading frame (newly amended Claim 36), does not overcome the issue of lack of adequate written description. Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’). In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000). The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). While the Figure 28A illustrates a cartoon of where a “3 peak” enhancer exists upstream of the GATA1 gene, neither the Figure nor the specification actually disclose the exact location(s) nor the nucleotide sequences of the first, second, and third DNA sequences of said “3 peak” enhancer. PNG media_image2.png 106 766 media_image2.png Greyscale The claims would seem to encompass a “hG1E” enhancer having a nucleotide sequence of about 500 nucleotides, for example. However, as evidenced by Figure 8A, there are multitude of structurally different DNA sequences positioned upstream of and within 7kb of the boundary of the endogenous human GATA1 open reading frame having “open chromatin structure”, depending upon the referenced differentiating human erythroid cell from which one assays, that when concatenated may yield a synthetic enhancer element of about 500 nucleotides in length. While the specification discloses heterologous hematopoietic enhancers such as SEQ ID NO’s 10, 11, 12, 38, and 39 [00105-110], the specification discloses the claimed synthetic element need only be at least 60% identical to any one referenced SEQ ID NO. 4^500 is an enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids. (https://www.calculator.net/exponent-calculator; last visited March 10, 2025). The specification discloses the hG1E element has the functional property of being responsible for erythroid-specific expression of GATA1 (e.g. [00298]). While the specification discloses heterologous hematopoietic enhancers such as SEQ ID NO’s 10, 11, 12, 38, and 39 [00105-110], such are not disclosed to be the hG1E enhancer element. Further, the specification fails to disclose a common core structure of SEQ ID NO’s 10, 11, 12, 38, and 39 that are necessary and sufficient to achieve the functional property of being a hematopoietic enhancer, let alone something that is shared with the structurally undisclosed hG1E enhancer element. The term “region of DNA” is a relative term which renders the claim indefinite. The term “region of DNA” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. While the Figures 8A and 28A illustrate a cartoon of where a “3 peak” enhancer exists upstream of the GATA1 gene, neither the Figure nor the specification actually disclose the exact location(s) nor the nucleotide sequence of said “3 peak” enhancer. It would seem that the first, second, and third regions may each contain 1000 nucleotides or more. Further, each region seems to have subdomains that are “closed”, while other subdomains are “open”, respectively, and thus it is unclear which “open” subdomain is to be present in the claimed concatamer. The claims do not recite, and the specification fails to disclose, the metes and bounds of the ‘region’ of DNA. The recited “region of DNA” would appear to encompass a range of nucleotide lengths, e.g. about 500 to about 1500 nucleotides (SEQ ID NO:11 is 501 nucleotides, SEQ ID NO:38 is 1179 nucleotides). The specification discloses a hematopoietic enhancer minigene construct comprising a concatenation of four distinct regulatory elements, to wit, a -3kb hematopoietic enhancer, a GATA motif, a CACCC box, and the first intron of GATA1 (e.g. pg 45, lines 2-3). However, the specification fails to disclose the nucleotide sequence of the -3kb hematopoietic enhancer, and thus is uninformative of how this sequence relates to the “first region of DNA”, the “second region of DNA”, and/or the “third region of DNA”. For example, is this the entirety of the “region of DNA”, or is it only a fragment of the “region of DNA”? Further, those of ordinary skill in the art would immediately recognize that the GATA motif and CACCC box, individually and respectively, are mere fragments of (4/500; 4/1500) the claimed “region of DNA”. The claim is considered indefinite because it is unclear is Applicant is requiring concatenation of the entire first, second, and third regions, respectively, or if the concatenation only requires some fragment(s) of the first, second, and third regions, respectively, e.g. just the GATA motif and CACCC box, for example. Moriguchi et al (The Human GATA1 Gene Retains a 5′ Insulator That Maintains Chromosomal Architecture and GATA1 Expression Levels in Splenic Erythroblasts, Molecular and Cellular Biology 25(10):1825-1837, 2015) is considered relevant prior art for having taught a nucleic acid sequence comprising: a) a sequence encoding a human GATA-binding factor 1 (GATA1) polypeptide; and b) a human GATA1 enhancer element. The BAC clones comprise the entire GATA1 locus, plus additional sequences upstream and downstream of the GATA1 locus (e.g. pg 1826, col. 1, “a 183-kb hGATA1 BAC (hG1B) DNA clone that harbors the hGATA1 genomic locus plus extensive flanking sequences”; Figure 1A, 80kb upstream and 116kb downstream of hGATA1 locus). Moriguchi et al differ from the instant claims in that they teach an insulator element located about 29 kb upstream of the GATA1 open reading frame (e.g. Abstract). With respect to Claim 53, SEQ ID NO:62 is 7503 nucleotides in length, and is disclosed to comprise an IRES sequence operably linked to a nucleotide sequence encoding GFP and three hematopoietic enhancer elements (e.g. pg 66). However, the specification fails to identify which nucleotides of SEQ ID NO:62 encode: i) the IRES; ii) the GFP; iii) the first hematopoietic enhancer element; iv) the second hematopoietic enhancer element; and v) the third hematopoietic enhancer element, respectively. Reference SEQ ID NO:62 is uninformative as it pertains to the nucleotide sequence(s) [structure(s)] of the claimed first, second, and third hematopoietic enhancer elements, respectively, let alone concatenations thereof. The claims do not recite, and the specification fails to disclose, a first nucleic acid sequence of the enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that does not have the functional property of being a hG1E enhancer element, as opposed to a second nucleic acid sequence of the enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that necessarily and predictably has the functional property of being a hG1E enhancer element, for example. The claims do not recite, and the specification fails to disclose, a first nucleic acid sequence of the enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that does not have the functional property of being responsible for erythroid-specific expression of GATA1, as opposed to a second nucleic acid sequence of the enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that necessarily and predictably has the functional property of being responsible for erythroid-specific expression of GATA1, for example. The claims do not recite, and the specification fails to disclose, how to transform or otherwise modify a first nucleic acid sequence of the enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that does not have the functional property of being responsible for erythroid-specific expression of GATA1, into a second nucleic acid sequence of the enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that now necessarily and predictably has the functional property of being responsible for erythroid-specific expression of GATA1, for example. The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005). For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014) Since the genetic code is widely known, a disclosure of an amino acid sequence would provide sufficient information such that one would accept that an inventor was in possession of the full genus of nucleic acids encoding a given amino acid sequence, but not necessarily any particular species. Cf. In re Bell, 991 F.2d 781, 785, 26 USPQ2d 1529, 1532 (Fed. Cir. 1993) and In re Baird, 16 F.3d 380, 382, 29 USPQ2d 1550, 1552 (Fed. Cir. 1994). Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’). Recently, the U.S. Court of Appeals for the Federal Circuit (Federal Circuit) decided Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017), which concerned adequate written description for claims drawn to antibodies. These claims are usually handled in Technology Center 1600. The Federal Circuit explained in Amgen that when an antibody is claimed, 35 U.S.C. § 112(a) requires adequate written description of the antibody itself. Amgen, 872 F.3d at 1378-79. The Amgen court expressly stated that the so-called "newly characterized antigen" test, which had been based on an example in USPTO-issued training materials and was noted in dicta in several earlier Federal Circuit decisions, should not be used in determining whether there is adequate written description under 35 U.S.C. § 112(a) for a claim drawn to an antibody. Citing its decision in Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., the court also stressed that the "newly characterized antigen" test could not stand because it contradicted the quid pro quo of the patent system whereby one must describe an invention in order to obtain a patent. Amgen, 872 F.3d at 1378-79, quoting Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1345 (Fed. Cir. 2010). In view of the Amgen decision, adequate written description of a newly characterized antigen alone should not be considered adequate written description of a claimed antibody to that newly characterized antigen, even when preparation of such an antibody is routine and conventional. Id. The Amgen decision will be added to the MPEP in due course. In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017) At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper. In the instant case, the specification fails to disclose the structural identity of hG1E enhancer element, let alone a hG1E element that necessarily and predictably has the functional property of being responsible for erythroid-specific expression of GATA1. At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352. An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5- 16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted). In the instant case, knowing that the hG1E enhancer is a nucleotide sequence composed of a combination of four different nucleotide bases, A, G, C, and T, let alone may be located somewhere as much as 10,000 nucleotides upstream of the hGATA1 open reading frame, does not tell you anything about the actual nucleotide sequences [structures] that objectively satisfy “hG1E”, as opposed to those nucleotide sequences that do not objectively satisfy “hG1E”, nor the actual nucleotide sequences [structures] that necessarily and predictably have the functional properties of being an enhancer, let alone being responsible for erythroid-specific expression of GATA1. In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)) “Amgen seeks to monopolize an entire class of things defined by their function”. “The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.” “It freely admits that it seeks to claim for itself an entire universe of antibodies.” In the instant case, the claims would appear to reasonably encompass an enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that are to necessarily and predictably have the functional property of being an enhancer, let alone an enhancer responsible for erythroid-specific expression of GATA1. “They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475. This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966). “Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”. While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”. “Amgen offers persons skilled in the art little more than advice to engage in “trial and error”. “The more a party claims for itself the more it must enable.” “Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same. Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Response to Arguments Applicant argues that the Examiner’s conclusion that that "there are a multiple of structurally different DNA sequences positioned upstream of and within 7kb of the boundary of the endogenous human GATAl open reading frame having 'open chromatin structure” is without factual basis and is contingent on ignoring the standardized methodology for peak-calling. Applicant’s argument(s) has been fully considered, but is not persuasive. As a first matter, Applicant’s statement is not on point. Independent Claim 36 recites “a… DNA sequence” at a high level of generality and is a relative term which renders the claim indefinite. The term “a… DNA sequence” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The recitation implies a genus of different reference “differentiating human erythroid cells” by which “open chromatin structure” is to be determined and/or identified, thereby rendering the claim indefinite. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)). As shown in the rejection, Figure 8A clearly illustrates, for example, a DNA region that is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame, yet comprises both more than one distinct open (peaks) DNA regions and more than one distinct closed (troughs) DNA regions. Thus, it is unclear which peak(s) shown in Figure 8 is/are to be present in the construct of independent Claim 36 and/or which peak(s) shown in Figure 8 may be absent from the construct of independent Claim 36. Figure 8A evidences that different DNA sequences are “open” (peaks vs troughs) in different types and/or stages of differentiating human erythroid cells. If there are multiple ways to measure “open chromatin structure”, to wit, different types and/or stages of “differentiating human erythroid cells”, yet each yields a different result, then the claimed “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence”, respectively, may be indefinite because it is unclear which type(s) and/or stage(s) of “differentiating human erythroid cells” is to be referenced, and the corresponding “first DNA sequence”, “second DNA sequence”, and/or “third DNA sequence” is to be present in the claimed concatenation to determine infringement. As a second matter, per the argued “the 3 peaks described in the instant specification”, the court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). Instant independent Claim 36 fails to recite the boundary(ies) of the first, second, and/or third sequences having open chromatin structure, and is broader in scope than the argued “the 3 peaks described in the instant specification”. Absent objective evidence to the contrary, it would be remedial for Applicant to amend the independent Claim 36 to recite the nucleotide(s) of SEQ ID NO:62 that are to be present in: i) the first human sequence is nucleotides ### of SEQ ID NO:62; ii) the second human sequence is nucleotides ### of SEQ ID NO:62; and iii) the third human sequence is nucleotides ### of SEQ ID NO:62. See, for example, Applicant’s amendment to Claim 53. Applicant argues that the independent claim does not recite the presence of “heterologous hematopoietic enhancers”. Applicant’s argument(s) has been fully considered, but is not persuasive. As a first matter, Figure 8A clearly illustrates, for example, a DNA region that is positioned upstream of and within 7 kb of the boundary of the endogenous human GATA1 open reading frame. The claims would seem to encompass a “hG1E” enhancer having a nucleotide sequence of about 500 nucleotides, for example. However, as evidenced by Figure 8A, there are multitude of structurally different DNA sequences positioned upstream of and within 7kb of the boundary of the endogenous human GATA1 open reading frame having “open chromatin structure”, depending upon the referenced differentiating human erythroid cell from which one assays, that when concatenated may yield a synthetic enhancer element of about 500 nucleotides in length. While the specification discloses heterologous hematopoietic enhancers such as SEQ ID NO’s 10, 11, 12, 38, and 39 [00105-110], the specification discloses the claimed synthetic element need only be at least 60% identical to any one referenced SEQ ID NO. 4^500 is an enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids. As a second matter, because the breadth of the “hG1E” enhancer variants encompassed by the independent claim, it is axiomatic that said variants are, by definition, heterologous to the sequence encoding a GATA1 polypeptide, including non-human GATA1 polypeptides, and variants thereof, per the at least 95% identity to SEQ ID NO’s: 1-5 (Claim 41). Applicant argues that the specification provides the source sequence. Applicant’s argument(s) has been fully considered, but is not persuasive. As discussed above, while Figure 9D labels “peak3”, “peak2”, and “peak1” in the illustration, Figure 8A fails identify which peak is “peak3”, as opposed to “peak2”, as opposed to “peak1”. A keyword search of the specification fails to retrieve “peak3”, “peak2”, and “peak1”, and thus, here too, Figure 9A is uninformative to “the first sequence”, “the second sequence”, and “the third sequence”, each recited at a high level of generality, and the specification fails to disclose the nucleotide sequences of “peak3”, “peak2”, and “peak1” in SEQ ID NO:62, respectively. The specification fails to disclose the nucleotide sequences of “the first”, “the second”, and “the third” sequences, respectively, in SEQ ID NO:62. Rather, SEQ ID NO:62 is merely disclosed as a nucleotide sequence that is 7503 nucleotides in length. The claimed “the first sequence”, “the second sequence”, and “the third sequence” are each recited at a high level of generality, and are broader in scope than the three hematopoietic enhancer elements of SEQ ID NO:62. Applicant argues that the claims do not encompass about 1x10^301 structurally and functionally undisclosed nucleic acids that are to necessarily and predictably have the functional property of being an enhancer, let alone an enhancer responsible for erythroid-specific expression of GATA1. Rather, the claims are directed to only sequences found upstream of and within 7kb of the boundary of the endogenous human GATA1 open reading frame, and which have open chromatin structure in differentiating human erythroid cells. Applicant’s argument(s) has been fully considered, but is not persuasive. The claims would seem to encompass a “hG1E” enhancer having a nucleotide sequence of about 500 nucleotides, for example. However, as evidenced by Figure 8A, there are multitude of structurally different DNA sequences positioned upstream of and within 7kb of the boundary of the endogenous human GATA1 open reading frame having “open chromatin structure”, depending upon the referenced differentiating human erythroid cell from which one assays, that when concatenated may yield a synthetic enhancer element of about 500 nucleotides in length. While the specification discloses heterologous hematopoietic enhancers such as SEQ ID NO’s 10, 11, 12, 38, and 39 [00105-110], the specification discloses the claimed synthetic element need only be at least 60% identical to any one referenced SEQ ID NO. Thus, the breadth of the claimed first, second, and/or third DNA sequence(s) would each appear to encompass an enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids that are to be concatenated. Instant Claim 36 and Claim 53 recitations are much broader in scope than SEQ ID NO:62. Applicant argues that the limitation “open chromatin structure in differentiating human erythroid cells” is a structural description, and that “positioned upstream of and within at least 7kb of the boundary…” provides further structural description. Applicant’s argument(s) has been fully considered, but is not persuasive. While “positioned upstream of and within at least 7kb of the boundary…” is structural, the limitation “open chromatin structure in differentiating human erythroid cells” is a functional property. The claims would seem to encompass a “hG1E” enhancer having a nucleotide sequence of about 500 nucleotides, for example. 4^500 is an enormously vast genus of about 1x10^301 structurally and functionally undisclosed nucleic acids. The specification discloses the hG1E element has the functional property of being responsible for erythroid-specific expression of GATA1 (e.g. [00298]). While the specification discloses heterologous hematopoietic enhancers such as SEQ ID NO’s 10, 11, 12, 38, and 39 [00105-110], such are not disclosed to be the hG1E enhancer element. Further, the specification fails to disclose a common core structure of SEQ ID NO’s 10, 11, 12, 38, and 39 that are necessary and sufficient to achieve the functional property of being a hematopoietic enhancer, let alone something that is shared with the structurally undisclosed hG1E enhancer element. Applicant argues that the two different structural characteristics are provided in SEQ ID NO:62. Applicant’s argument(s) has been fully considered, but is not persuasive. As discussed above, SEQ ID NO:62 is 7503 nucleotides in length, and is disclosed to comprise an IRES sequence operably linked to a nucleotide sequence encoding GFP and three hematopoietic enhancer elements (e.g. pg 66). However, the specification fails to identify which nucleotides of SEQ ID NO:62 encode: i) the IRES; ii) the GFP; iii) the first hematopoietic enhancer element; iv) the second hematopoietic enhancer element; and v) the third hematopoietic enhancer element, respectively. Reference SEQ ID NO:62 is uninformative as it pertains to the nucleotide sequence(s) [structure(s)] of the claimed first, second, and third hematopoietic enhancer elements, respectively, let alone concatenations thereof. Applicant argues that the genus of possible nucleic acids does not apply to the claims because the claims require the three regions. Applicant’s argument(s) has been fully considered, but is not persuasive. The claims fail to recite the nucleotide sequence of the first, second, and third regions, individually and respectively, that are then to be concatenated. Rather, such limitations are recited only using functional language. Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’). 6. Claims 36 and 38-51 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Applicant has amended independent Claim 36 to recite: i) a first human sequence; ii) a second human sequence; and iii) a third human sequence. The Examiner incorporates herein the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections. The term “human” is a relative term which renders the claim indefinite. The term “human” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The term is indefinite because the specification does not clearly redefine the term. As evidenced by Figure 8A, the first, second, and/or third sequences each need only be about 250 nucleotides in length, respectively. As evidenced by [00121], disclosing a minimum of 979 nucleotides, the first, second, and/or third sequences each need only be about 325 nucleotides in length, respectively. As evidenced by [00110], the specification discloses the claimed first, second, and/or third sequences each need only be at least 60% identical to any one referenced SEQ ID NO. (60%)(250 nucleotides) allows for as many as 150 nucleotide insertions, deletions, and/or substitutions. 4^150 = about 3x10^150 nucleotide variants of the first, second, and/or third sequences, respectively. (60%)(325 nucleotides) allows for as many as 195 nucleotide insertions, deletions, and/or substitutions. 4^195 = about 4x10^195 nucleotide variants of the first, second, and/or third sequences, respectively. The claims fail to recite, and the specification fails to disclose, the genus of about 3x10^150 nucleotide variants of the first, second, and/or third sequences, respectively, nor about 4x10^195 nucleotide variants of the first, second, and/or third sequences, respectively, that are objectively and necessarily “human”, as opposed to the genus of about 3x10^150 nucleotide variants of the first, second, and/or third sequences, respectively, nor about 4x10^195 nucleotide variants of the first, second, and/or third sequences, respectively, that are objectively and necessarily not “human”, for example. Rather, the only recitation and/or disclosure is currently amended Claim 53, wherein: i) the first human sequence is nucleotides 2708-3043 of SEQ ID NO:62; ii) the second human sequence is nucleotides 3052-3430 of SEQ ID NO:62; and iii) the third human sequence is nucleotides 3437-4251 of SEQ ID NO:62. Thus, that which is considered “human”, as opposed to non-human, is considered an arbitrary and subjective determination. For example, the 5’G1HE element taught by Ohneda et al (2002; of record in IDS; e.g. Figure 2) comprises a nucleotide sequence substantially the same as (100% identity) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT |||||||||||||||||||||||||||||||||||| CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT The double GATA element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (109/112 = 97% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: ACACCCTCACCCCAAGACAGCCTGTTACTGCGGCGCCAACAGCCACGGTCGCCTACATCT |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ACACCCTCACCCCAAGACAGCC—GTTA-TGCGGCGCCAACAGCCACGGTCGCCTACATCT GATAAGACTTATCTGCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG ||||||||||||| |||||||||||||||||||||||||||||||||||||| GATAAGACTTATC-GCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG The CACCC element(s) taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (27/29 = 93% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CCCCTCCCCTGGACTGCCCCACCCACTGG |||||||||||||||||| ||||| |||| CCCCTCCCCTGGACTGCC-CACCC-CTGG The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Independent Claim 36 fails to recite the minimal nucleotide sequence to be present in the first, second, and third [human] sequences, respectively. Thus, while it is recognized that some minimal sequence, e.g. 5, 10, 15, or 20 nucleotides must be present in each of the first, second, and third sequences, respectively, having some degree of ‘human-ness’, the breadth of the claim(s) allows for the presence of additional nucleotides in the first, second, and/or third sequences, respectively, that are not “human”. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Absent objective evidence to the contrary, it would be remedial for Applicant to amend the independent Claim 36 to recite the nucleotide(s) of SEQ ID NO:62 that are to be present in: i) the first human sequence is nucleotides ### of SEQ ID NO:62; ii) the second human sequence is nucleotides ### of SEQ ID NO:62; and iii) the third human sequence is nucleotides ### of SEQ ID NO:62. See, for example, Applicant’s amendment to Claim 53. 7. Claim(s) 36 and 38-51 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Applicant has amended independent Claim 36 to recite: i) a first human sequence; ii) a second human sequence; and iii) a third human sequence. The Examiner incorporates herein the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections. The term “human” is a relative term which renders the claim indefinite. The term “human” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The term is indefinite because the specification does not clearly redefine the term. In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000). The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). As evidenced by Figure 8A, the first, second, and/or third sequences each need only be about 250 nucleotides in length, respectively. As evidenced by [00121], disclosing a minimum of 979 nucleotides, the first, second, and/or third sequences each need only be about 325 nucleotides in length, respectively. As evidenced by [00110], the specification discloses the claimed first, second, and/or third sequences each need only be at least 60% identical to any one referenced SEQ ID NO. (60%)(250 nucleotides) allows for as many as 150 nucleotide insertions, deletions, and/or substitutions. 4^150 = about 3x10^150 nucleotide variants of the first, second, and/or third sequences, respectively. (60%)(325 nucleotides) allows for as many as 195 nucleotide insertions, deletions, and/or substitutions. 4^195 = about 4x10^195 nucleotide variants of the first, second, and/or third sequences, respectively. The claims fail to recite, and the specification fails to disclose, the genus of about 3x10^150 nucleotide variants of the first, second, and/or third sequences, respectively, nor about 4x10^195 nucleotide variants of the first, second, and/or third sequences, respectively, that are objectively and necessarily “human”, as opposed to the genus of about 3x10^150 nucleotide variants of the first, second, and/or third sequences, respectively, nor about 4x10^195 nucleotide variants of the first, second, and/or third sequences, respectively, that are objectively and necessarily not “human”, for example. Rather, the only recitation and/or disclosure is currently amended Claim 53, wherein: i) the first human sequence is nucleotides 2708-3043 of SEQ ID NO:62; ii) the second human sequence is nucleotides 3052-3430 of SEQ ID NO:62; and iii) the third human sequence is nucleotides 3437-4251 of SEQ ID NO:62. Thus, that which is considered “human”, as opposed to non-human, is considered an arbitrary and subjective determination. For example, the 5’G1HE element taught by Ohneda et al (2002; of record in IDS; e.g. Figure 2) comprises a nucleotide sequence substantially the same as (100% identity) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT |||||||||||||||||||||||||||||||||||| CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT The double GATA element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (109/112 = 97% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: ACACCCTCACCCCAAGACAGCCTGTTACTGCGGCGCCAACAGCCACGGTCGCCTACATCT |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ACACCCTCACCCCAAGACAGCC—GTTA-TGCGGCGCCAACAGCCACGGTCGCCTACATCT GATAAGACTTATCTGCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG ||||||||||||| |||||||||||||||||||||||||||||||||||||| GATAAGACTTATC-GCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG The CACCC element(s) taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (27/29 = 93% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CCCCTCCCCTGGACTGCCCCACCCACTGG |||||||||||||||||| ||||| |||| CCCCTCCCCTGGACTGCC-CACCC-CTGG The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Independent Claim 36 fails to recite the minimal nucleotide sequence to be present in the first, second, and third [human] sequences, respectively. Thus, while it is recognized that some minimal sequence, e.g. 5, 10, 15, or 20 nucleotides must be present in each of the first, second, and third sequences, respectively, having some degree of ‘human-ness’, the breadth of the claim(s) allows for the presence of additional nucleotides in the first, second, and/or third sequences, respectively, that are not “human”. Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Absent objective evidence to the contrary, it would be remedial for Applicant to amend the independent Claim 36 to recite the nucleotide(s) of SEQ ID NO:62 that are to be present in: i) the first human sequence is nucleotides ### of SEQ ID NO:62; ii) the second human sequence is nucleotides ### of SEQ ID NO:62; and iii) the third human sequence is nucleotides ### of SEQ ID NO:62. See, for example, Applicant’s amendment to Claim 53. 8. Claims 36 and 38-51 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Evidence that independent Claim 36 fail(s) to correspond in scope with that which the inventor or a joint inventor, or for pre-AIA applications the applicant regards as the invention can be found in the reply filed April 2, 2026. In that paper, the inventor or a joint inventor, or for pre-AIA applications the applicant has declared (Voit Declaration filed under 37 CFR §1.132 on April 2, 2026, para 12-15) that the construct of Claim 36 has a different functional property than that of Ohneda et al (see also data figure provided, in reference to Voit et al (2025; of record in IDS; Figure 1B), and this statement indicates that the invention is different from what is defined in the claim(s) because whereas instant independent Claim 36 recites the first, second, and third regions at a high level of generality, Applicant declares the nucleic acid requires the entirety of domains 1, 2, and 3 illustrated in Voit et al Figure 1b, limitations not required by instant independent Claim 36. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Absent objective evidence to the contrary, it would be remedial for Applicant to amend the independent Claim 36 to recite the nucleotide(s) of SEQ ID NO:62 that are to be present in: i) the first human sequence is nucleotides ### of SEQ ID NO:62; ii) the second human sequence is nucleotides ### of SEQ ID NO:62; and iii) the third human sequence is nucleotides ### of SEQ ID NO:62. See, for example, Applicant’s amendment to Claim 53. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 9. Claims 36, 38-39, 43, and 48-49 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ohneda et al (2002; of record in IDS) in view of NovoPro (2025; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. In light of the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections, the Examiner applies the following rejections per the first, second, and third DNA sequences recited at a high level of generality. With respect to Claim 36, Ohneda et al is considered relevant prior art for having taught a nucleic molecule comprising: i) a sequence comprising a concatenation of a first, second, and third DNA sequence positioned upstream of and within 7kb of the boundary of the endogenous murine and human GATA1 open reading frames (e.g. Figures 1c and 2; pg 1246, col. 1, “constructed an artificial minigene…in which the three mouse/human homologous regulatory regions were connected in series” (syn. concatenated)); and ii) a sequence encoding a GATA1 polypeptide (e.g. pg 1250, col. 1, “We generated….GATA-1 cDNA under the control of [synthetic enhancer/promoter]”; “transgenic expression of a GATA-1 cDNA under control of the minigene rescued…”). While Ohneda et al do not teach ipsis verbis said first, second, and third DNA sequences “have open chromatin structure in differentiating human erythroid cells”, Ohneda et al taught the elements of the synthetic enhancer were shown to be essential for hematopoietic lineage specific promoter activity and expression of GATA-1 in both primitive and definitive erythroid lineages (syn. differentiating erythroid cells) (e.g. pg 1243, col. 2; pg 1244, col. 2; ), and that said region is thought to form open chromatin structure, providing ready access for transcription factor-binding (e.g. pg 1246, col. 1), and thus reasonably infers that said first, second, and third DNA sequences would “have open chromatin structure in differentiating human erythroid cells”, as said sequences are highly conserved between mouse and human (e.g. Figure 2). Furthermore, the 5’G1HE element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as a corresponding sequence present in SEQ ID NO:62 (upper line), as shown below: CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT |||||||||||||||||||||||||||||||||||| CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT The doubleGATA element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as a corresponding sequence present in SEQ ID NO:62 (upper line), as shown below: ACACCCTCACCCCAAGACAGCCTGTTACTGCGGCGCCAACAGCCACGGTCGCCTACATCT |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ACACCCTCACCCCAAGACAGCC—GTTA-TGCGGCGCCAACAGCCACGGTCGCCTACATCT GATAAGACTTATCTGCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG ||||||||||||| |||||||||||||||||||||||||||||||||||||| GATAAGACTTATC-GCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG The CACCC element(s) taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as a corresponding sequence present in SEQ ID NO:62 (upper line), as shown below: CCCCTCCCCTGGACTGCCCCACCCACTGG |||||||||||||||||| ||||| |||| CCCCTCCCCTGGACTGCC-CACCC-CTGG "Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art first, second, and/or third GATA-1 enhancer elements do/does not inherently and/or naturally possess the same properties, to wit, “have open chromatin structure in differentiating human erythroid cells”, as the instantly claimed first, second, and/or third GATA-1 enhancer elements. Since the Patent Office does not have the facilities for examining and comparing applicants' first, second, and third DNA sequences with the first, second, and third DNA sequences of the prior art reference, the burden is upon applicants to show a distinction between the material structural and functional characteristics of the claimed compounds and the compounds of the prior art. See In re Best, 562 F.2d 1252, 195 USPQ 430 (CCPA 1977) and In re Fitzgerald et al., 205 USPQ 594. With respect to the amended limitations of a first, second, and third “human” DNA sequence, the Examiner incorporates herein the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections. For example, the 5’G1HE element taught by Ohneda et al (2002; of record in IDS; e.g. Figure 2) comprises a nucleotide sequence substantially the same as (100% identity) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT |||||||||||||||||||||||||||||||||||| CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT The double GATA element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (109/112 = 97% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: ACACCCTCACCCCAAGACAGCCTGTTACTGCGGCGCCAACAGCCACGGTCGCCTACATCT |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ACACCCTCACCCCAAGACAGCC—GTTA-TGCGGCGCCAACAGCCACGGTCGCCTACATCT GATAAGACTTATCTGCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG ||||||||||||| |||||||||||||||||||||||||||||||||||||| GATAAGACTTATC-GCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG The CACCC element(s) taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (27/29 = 93% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CCCCTCCCCTGGACTGCCCCACCCACTGG |||||||||||||||||| ||||| |||| CCCCTCCCCTGGACTGCC-CACCC-CTGG "Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art nucleic acid product does not inherently possess the same properties as the instantly claimed product. The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Independent Claim 36 fails to recite the minimal nucleotide sequence to be present in the first, second, and third [human] sequences, respectively. Thus, while it is recognized that some minimal sequence, e.g. 5, 10, 15, or 20 nucleotides must be present in each of the first, second, and third sequences, respectively, having some degree of ‘human-ness’, the breadth of the claim(s) allows for the presence of additional nucleotides in the first, second, and/or third sequences, respectively, that are not “human”. To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections. Resolving the level of ordinary skill in the pertinent art. People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and nucleic acid expression vectors. Therefore, the level of ordinary skill in this art is high. "A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to substitute the three mouse GATA-1 enhancer elements identified by Ohneda et al with the corresponding three human GATA-1 enhancer elements identified by Ohneda et al in a synthetic GATA-1 enhancer construct with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would have been motivated to substitute the three mouse GATA-1 enhancer elements identified by Ohneda et al with the corresponding the three human GATA-1 enhancer elements identified by Ohneda et al in a synthetic GATA-1 enhancer construct because Ohneda et al showed that said sequences are highly conserved between mouse and human (e.g. Figure 2; pg 1246, col. 1, “constructed an artificial minigene…in which the three mouse/human homologous regulatory regions were connected in series” (syn. concatenated)), taught the elements of the synthetic enhancer were shown to be essential for hematopoietic lineage specific promoter activity and expression of GATA-1 in both primitive and definitive erythroid lineages (syn. differentiating erythroid cells), said region is thought to form open chromatin structure, providing ready access for transcription factor-binding, and that a nucleic acid comprising the synthetic enhancer/promoter operably linked to a GATA-1 cDNA rescues GATA-1 mutant mice from lethality, being sufficient to direct erythroid-specific gene expression in vivo and support erythropoiesis (e.g. pg 1250, col. 1; pg 1251, col. 1), and it would be logical and/or common sense for the ordinary artisan to make such a construct to ascertain whether the functional properties of synthetic mouse GATA-1 enhancer construct were also conserved in a synthetic human GATA-1 enhancer construct, as suggested by the nucleotide sequence conservation. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 38, Ohneda et al taught wherein the synthetic nucleic acid molecule comprises a promoter operably linked to the synthetic enhancer element and GATA-1 cDNA (e.g. pg 1246, col. 1). With respect to Claim 39, Ohneda et al taught wherein the promoter is not a GATA-1 promoter (e.g. pg 1246, col. 1). With respect to Claim 43, Ohneda et al taught wherein the expression construct comprises a posttranscriptional regulatory element operably linked to the sequence encoding the GATA1 polypeptide (e.g. pg 1250, col. 1, “full length GATA-1 cDNA”, which is understood in the art to naturally comprise a polyA sequence; pg 1252, col. 2, Methods, cloned into the pSVbeta vector, which inherently and naturally comprises a polyA sequence, as evidenced by NovoPro). With respect to Claim 48, Ohneda et al taught a vector comprising the expression cassette of Claim 36 (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). With respect to Claim 49, Ohneda et al taught a vector is a plasmid (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments The Examiner acknowledges and has considered the Voit Declaration filed under 37 CFR §1.132 on April 2, 2026. Voit declares (para 8) that the primitive erythroid cells of Ohneda et al is a specific cell type distinct from “erythroid cells” or “erythroid progenitor” cells, and that primitive erythroid cells are not progenitors of erythroid cells. Rather, they are made only during a brief period of embryogenesis. Voit’s argument(s) has been fully considered, but is not persuasive. As a first matter, the claims are directed to a nucleic acid molecule comprising a first, second, and third sequence [structures] having the functional properties of open chromatin structure in differentiating human erythroid cells. Ohneda et al taught a nucleic acid molecule comprising a first, second, and third sequence having the functional properties of open chromatin structure in erythroid cells, thereby being “erythroid-specific” (e.g. pg 1243, col. 2), The 5’G1HE element taught by Ohneda et al (2002; of record in IDS; e.g. Figure 2) comprises a nucleotide sequence substantially the same as (100% identity) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT |||||||||||||||||||||||||||||||||||| CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT The double GATA element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (109/112 = 97% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: ACACCCTCACCCCAAGACAGCCTGTTACTGCGGCGCCAACAGCCACGGTCGCCTACATCT |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ACACCCTCACCCCAAGACAGCC—GTTA-TGCGGCGCCAACAGCCACGGTCGCCTACATCT GATAAGACTTATCTGCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG ||||||||||||| |||||||||||||||||||||||||||||||||||||| GATAAGACTTATC-GCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG The CACCC element(s) taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (27/29 = 93% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CCCCTCCCCTGGACTGCCCCACCCACTGG |||||||||||||||||| ||||| |||| CCCCTCCCCTGGACTGCC-CACCC-CTGG "Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art nucleic acid product does not inherently possess the same properties as the instantly claimed product. The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Independent Claim 36 fails to recite the minimal nucleotide sequence to be present in the first, second, and third [human] sequences, respectively. Thus, while it is recognized that some minimal sequence, e.g. 5, 10, 15, or 20 nucleotides must be present in each of the first, second, and third sequences, respectively, having some degree of ‘human-ness’, the breadth of the claim(s) allows for the presence of additional nucleotides in the first, second, and/or third sequences, respectively, that are not “human”. To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections. Voit declares (para 10-11) that the GdC minigene of Ohneda et al is not sufficient to drive erythroid expression of GATA1 in definitive erythropoiesis. Voit’s argument(s) has been fully considered, but is not persuasive. Independent Claim 36 fails to recite this functional requirement. Rather, the claim is enormously broad for the genus of structural variants encompassed by the claim. See above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections. Voit declares (para 12-15) that the construct of Ohneda et al do not have the same functional properties as that of the construct of the instant claims, including the construct driven by EF1a promoter. Voit’s argument(s) has been fully considered, but is not persuasive. As a first matter, the claims are directed to a nucleic acid molecule comprising a first, second, and third sequence [structures] having the functional properties of open chromatin structure in differentiating human erythroid cells. Ohneda et al taught a nucleic acid molecule comprising a first, second, and third sequence having the functional properties of open chromatin structure in erythroid cells, thereby being “erythroid-specific” (e.g. pg 1243, col. 2), The 5’G1HE element taught by Ohneda et al (2002; of record in IDS; e.g. Figure 2) comprises a nucleotide sequence substantially the same as (100% identity) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT |||||||||||||||||||||||||||||||||||| CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT The double GATA element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (109/112 = 97% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: ACACCCTCACCCCAAGACAGCCTGTTACTGCGGCGCCAACAGCCACGGTCGCCTACATCT |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ACACCCTCACCCCAAGACAGCC—GTTA-TGCGGCGCCAACAGCCACGGTCGCCTACATCT GATAAGACTTATCTGCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG ||||||||||||| |||||||||||||||||||||||||||||||||||||| GATAAGACTTATC-GCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG The CACCC element(s) taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (27/29 = 93% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CCCCTCCCCTGGACTGCCCCACCCACTGG |||||||||||||||||| ||||| |||| CCCCTCCCCTGGACTGCC-CACCC-CTGG "Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art nucleic acid product does not inherently possess the same properties as the instantly claimed product. The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Independent Claim 36 fails to recite the minimal nucleotide sequence to be present in the first, second, and third [human] sequences, respectively. Thus, while it is recognized that some minimal sequence, e.g. 5, 10, 15, or 20 nucleotides must be present in each of the first, second, and third sequences, respectively, having some degree of ‘human-ness’, the breadth of the claim(s) allows for the presence of additional nucleotides in the first, second, and/or third sequences, respectively, that are not “human”. To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections. Applicant argues that Applicant’s argument(s) has been fully considered, but is not persuasive. For example, the 5’G1HE element taught by Ohneda et al (2002; of record in IDS; e.g. Figure 2) comprises a nucleotide sequence substantially the same as (100% identity) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT |||||||||||||||||||||||||||||||||||| CTGATTCCCTTATCTGCCCACTCCCAGCTGCCTCCT The double GATA element taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (109/112 = 97% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: ACACCCTCACCCCAAGACAGCCTGTTACTGCGGCGCCAACAGCCACGGTCGCCTACATCT |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ACACCCTCACCCCAAGACAGCC—GTTA-TGCGGCGCCAACAGCCACGGTCGCCTACATCT GATAAGACTTATCTGCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG ||||||||||||| |||||||||||||||||||||||||||||||||||||| GATAAGACTTATC-GCTGCCCCAGGGCAGGCCGGAGCTGGCGTAAGCCCCAG The CACCC element(s) taught by Ohneda et al (e.g. Figure 2) comprises a nucleotide sequence substantially the same as (27/29 = 93% identity and/or 100% identity to subregion(s) thereof) a corresponding sequence present in SEQ ID NO:62 (upper line), and thus is considered to be “human”, as shown below: CCCCTCCCCTGGACTGCCCCACCCACTGG |||||||||||||||||| ||||| |||| CCCCTCCCCTGGACTGCC-CACCC-CTGG The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Independent Claim 36 fails to recite the minimal nucleotide sequence to be present in the first, second, and third [human] sequences, respectively. Thus, while it is recognized that some minimal sequence, e.g. 5, 10, 15, or 20 nucleotides must be present in each of the first, second, and third sequences, respectively, having some degree of ‘human-ness’, the breadth of the claim(s) allows for the presence of additional nucleotides in the first, second, and/or third sequences, respectively, that are not “human”. 10. Claims 41-43 and 48-49 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ohneda et al (2002; of record in IDS) in view of NovoPro (2025; of record), as applied to Claims 36, 38-39, 43, and 48-49 above, and in further view of GenBank NM_002049 (human GATA-1, February 5, 2018). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Ohneda et al do not teach wherein the nucleic acid encoding the GATA-1 polypeptide comprises a nucleotide sequence at least 95% identical to instant SEQ ID NO:1. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 41-42, GenBank NM_002049 is considered relevant prior art for having taught a nucleic acid encoding a human GATA-1 polypeptide, wherein the nucleic acid comprises a sequence that is 100% identical to instant SEQ ID NO:1. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a nucleic acid encoding a mouse GATA-1 polypeptide with a nucleic acid encoding a human GATA-1 polypeptide in the expression vector of Ohneda et al comprising the synthetic hematopoietic/erythroid enhancer elements with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a nucleic acid encoding a mouse GATA-1 polypeptide with a nucleic acid encoding a human GATA-1 polypeptide in the expression vector of Ohneda et al comprising the synthetic hematopoietic/erythroid enhancer elements because those of ordinary skill in the art had long-recognized a nucleic acid encoding a human GATA-1 polypeptide having 100% identity to instant SEQ ID NO:1, Ohneda et al taught the GATA-1 enhancer element(s) sequence comparison(s) between mouse and humans, whereby the synthetic mouse GATA-1 enhancer/mouse GATA-1 cDNA expression cassette was able to rescue GATA-1 loss-of-function in the mouse context, and it would be common sense to recapitulate such a configuration in the context of a human GATA-1 enhancer/human GATA-1 cDNA expression cassette. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 43, Ohneda et al taught wherein the expression construct comprises a posttranscriptional regulatory element operably linked to the sequence encoding the GATA1 polypeptide (e.g. pg 1250, col. 1, “full length GATA-1 cDNA”, which is understood in the art to naturally comprise a polyA sequence; pg 1252, col. 2, Methods, cloned into the pSVbeta vector, which inherently and naturally comprises a polyA sequence, as evidenced by NovoPro). GenBank NM_002049 taught a nucleic acid encoding a human GATA-1 polypeptide, wherein the nucleic acid naturally comprises a polyA sequence. With respect to Claim 48, Ohneda et al taught a vector comprising the expression cassette of Claim 36 (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). With respect to Claim 49, Ohneda et al taught wherein the vector is a plasmid (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments/Amendments Applicant does not contest the teachings of GenBank NM_002049 as applied to the obviousness to substitute a nucleic acid encoding a mouse GATA-1 polypeptide with a nucleic acid encoding a human GATA-1 polypeptide in the expression vector of Ohneda et al comprising the synthetic hematopoietic/erythroid enhancer elements with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a nucleic acid encoding a mouse GATA-1 polypeptide with a nucleic acid encoding a human GATA-1 polypeptide in the expression vector of Ohneda et al comprising the synthetic hematopoietic/erythroid enhancer elements because those of ordinary skill in the art had long-recognized a nucleic acid encoding a human GATA-1 polypeptide having 100% identity to instant SEQ ID NO:1, Ohneda et al taught the GATA-1 enhancer element(s) sequence comparison(s) between mouse and humans, whereby the synthetic mouse GATA-1 enhancer/mouse GATA-1 cDNA expression cassette was able to rescue GATA-1 loss-of-function in the mouse context, and it would be common sense to recapitulate such a configuration in the context of a human GATA-1 enhancer/human GATA-1 cDNA expression cassette. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). 11. Claims 38-39, 43, and 45-49 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ohneda et al (2002; of record in IDS) in view of NovoPro (2025; of record), as applied to Claims 36, 38-39, 43, and 48-49 above, and in further view of Iwasaki et al (2003; of record in specification). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Ohneda et al do not teach wherein the nucleic acid encoding the GATA-1 polypeptide further comprises an IRES element. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 45-47, Iwasaki et al is considered relevant prior art for having taught a GATA-1 expression cassette, wherein the nucleic acid encoding the GATA-1 polypeptide further comprises an IRES element operably linked to a nucleic acid encoding a selectable marker protein, e.g. GFP. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to modify the GATA-1 expression cassette of Ohneda et al to further comprise an IRES element operably linked to GFP with a reasonable expectation of success because Iwasaki et al successfully demonstrated the ability to co-express GATA-1 with GFP from the same expression vector using an IRES element, whereby those of ordinary skill in the art had long-recognized GFP to be a marker protein allowing the ordinary artisan to visualize those cells expressing the artisan’s transgene(s) of interest, including GATA-1, as demonstrated by Iwasaki et al. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 38, Ohneda et al taught wherein the synthetic nucleic acid molecule comprises a promoter operably linked to the synthetic enhancer element and GATA-1 cDNA (e.g. pg 1246, col. 1). Iwasaki et al taught wherein the synthetic nucleic acid molecule comprises a promoter operably linked to the synthetic enhancer element and GATA-1 cDNA (e.g. the promoter naturally present in the retroviral LTR). With respect to Claim 39, Ohneda et al taught wherein the promoter is not a GATA-1 promoter (e.g. pg 1246, col. 1). Iwasaki et al taught wherein the synthetic nucleic acid molecule comprises a promoter operably linked to the synthetic enhancer element and GATA-1 cDNA (e.g. the promoter naturally present in the retroviral LTR). With respect to Claim 43, Ohneda et al taught wherein the expression construct comprises a posttranscriptional regulatory element operably linked to the sequence encoding the GATA1 polypeptide (e.g. pg 1250, col. 1, “full length GATA-1 cDNA”, which is understood in the art to naturally comprise a polyA sequence; pg 1252, col. 2, Methods, cloned into the pSVbeta vector, which inherently and naturally comprises a polyA sequence, as evidenced by NovoPro). Iwasaki et al taught wherein the expression construct comprises a posttranscriptional regulatory element operably linked to the sequence encoding the GATA1 polypeptide (e.g. pg 460, col. 1, “full length GATA-1 cDNA”, which is understood in the art to naturally comprise a polyA sequence). With respect to Claim 48, Ohneda et al taught a vector comprising the expression cassette of Claim 36 (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Iwasaki et al taught a vector comprising the expression cassette (e.g. Figure 1c). With respect to Claim 49, Ohneda et al taught wherein the vector is a plasmid (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Iwasaki et al taught wherein the vector is a retroviral vector (e.g. Figure 1c; pg 460, col. 1, Methods). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments/Amendments Applicant does not contest the teachings of Iwasaki et al (2003; of record in specification) as applied to the obviousness to to modify the GATA-1 expression cassette of Ohneda et al to further comprise an IRES element operably linked to GFP with a reasonable expectation of success because Iwasaki et al successfully demonstrated the ability to co-express GATA-1 with GFP from the same expression vector using an IRES element, whereby those of ordinary skill in the art had long-recognized GFP to be a marker protein allowing the ordinary artisan to visualize those cells expressing the artisan’s transgene(s) of interest, including GATA-1, as demonstrated by Iwasaki et al. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). 12. Claims 38-40 and 48-49 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ohneda et al (2002; of record in IDS) in view of NovoPro (2025; of record), as applied to Claims 36, 38-39, 43, and 48-49 above, and in further view of Hamlett et al (2008; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Ohneda et al do not teach wherein the nucleic acid encoding the GATA-1 polypeptide is operably linked to an EF-1alpha promoter. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 38-40, Hamlett et al is considered relevant prior art for having taught a GATA-1 expression cassette, wherein the nucleic acid encoding the GATA-1 polypeptide is operably linked to an EF-1alpha promoter (e.g. pg 2739, col. 1, Methods, Constructs; Figure 1a). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first heterologous promoter operably linked to a nucleic acid encoding GATA-1 with a second heterologous promoter, to wit, EF-1alpha promoter, operably linked to a nucleic acid encoding GATA-1 in an expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first heterologous promoter operably linked to a nucleic acid encoding GATA-1 with a second heterologous promoter, to wit, EF-1alpha promoter, operably linked to a nucleic acid encoding GATA-1 in an expression cassette because those of ordinary skill in the art previously recognized and successfully reduced to practice the ability to express GATA-1 in hematopoietic cells using an EF-1alpha promoter. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 43, Ohneda et al taught wherein the expression construct comprises a posttranscriptional regulatory element operably linked to the sequence encoding the GATA1 polypeptide (e.g. pg 1250, col. 1, “full length GATA-1 cDNA”, which is understood in the art to naturally comprise a polyA sequence; pg 1252, col. 2, Methods, cloned into the pSVbeta vector, which inherently and naturally comprises a polyA sequence, as evidenced by NovoPro). Hamlett et al taught wherein the expression construct comprises a posttranscriptional regulatory element operably linked to the sequence encoding the GATA1 polypeptide, which is understood in the art to naturally comprise a polyA sequence). With respect to Claim 48, Ohneda et al taught a vector comprising the expression cassette of Claim 36 (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Hamlett et al taught a vector comprising the expression cassette (e.g. pg 2740, col. 1, Results, “plasmid”). With respect to Claim 49, Ohneda et al taught wherein the vector is a plasmid (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Hamlett et al taught wherein the vector is a plasmid (e.g. pg 2740, col. 1, Results, “plasmid”). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments/Amendments Applicant does not contest the teachings of Hamlett et al (2008; of record) as applied to the obviousness to substitute a first heterologous promoter operably linked to a nucleic acid encoding GATA-1 with a second heterologous promoter, to wit, EF-1alpha promoter, operably linked to a nucleic acid encoding GATA-1 in an expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first heterologous promoter operably linked to a nucleic acid encoding GATA-1 with a second heterologous promoter, to wit, EF-1alpha promoter, operably linked to a nucleic acid encoding GATA-1 in an expression cassette because those of ordinary skill in the art previously recognized and successfully reduced to practice the ability to express GATA-1 in hematopoietic cells using an EF-1alpha promoter. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). 13. Claims 43-44 and 48-50 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ohneda et al (2002; of record in IDS) in view of NovoPro (2025; of record), as applied to Claims 36, 38-39, 43, and 48-49 above, and in further view of Moreau-Gaudry et al (2001; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Ohneda et al do not teach wherein the GATA-1 expression cassette further comprises a WPRE element. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 43-44, Moreau-Gaudry et al is considered relevant prior art for having taught a transgene expression cassettes for expressing the artisan’s transgene of interest in erythroid cells, wherein the expression cassette comprises at least one GATA-1 erythroid enhancer, a heterologous, non-GATA-1, promoter, and a WPRE element (e.g. Abstract; Figure 1). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the expression cassette of Ohneda et al to further comprise a WPRE element with a reasonable expectation of success because Moreau-Gaudry et al previously taught and successfully reduced to practice the ability to synthesize an expression vector comprising one or more GATA-1 erythroid enhancers, a heterologous promoter, and a WPRE element, thereby the inclusion of the WPRE element with the GATA-1 erythroid enhancers resulted in at least a 2-fold increased transgene expression (e.g. pg 2667, col. 2) It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 48, Ohneda et al taught a vector comprising the expression cassette of Claim 36 (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Moreau-Gaudry et al taught a vector comprising the expression cassette (e.g. Figure 1). With respect to Claim 49, Ohneda et al taught wherein the vector is a plasmid (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Moreau-Gaudry et al taught wherein the vector is a lentivirus (e.g. Figure 1). With respect to Claim 50, Moreau-Gaudry et al taught lentivirus particles comprising the vector (e.g. pg 2666, Methods). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments/Amendments Applicant does not contest the teachings of Moreau-Gaudry et al (2001; of record) as applied to the obviousness to modify the expression cassette of Ohneda et al to further comprise a WPRE element with a reasonable expectation of success because Moreau-Gaudry et al previously taught and successfully reduced to practice the ability to synthesize an expression vector comprising one or more GATA-1 erythroid enhancers, a heterologous promoter, and a WPRE element, thereby the inclusion of the WPRE element with the GATA-1 erythroid enhancers resulted in at least a 2-fold increased transgene expression (e.g. pg 2667, col. 2) It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). 14. Claims 48-51 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Ohneda et al (2002; of record in IDS) in view of NovoPro (2025; of record), and Moreau-Gaudry et al (2001; of record), as applied to Claims 36, 38-39, 43, and 48-50 above, and in further view of Hartikka et al (2000; of record) and Tiscornia et al (2006; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Ohneda et al do not teach wherein the GATA-1 expression cassette further comprises a pharmaceutically acceptable carrier. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim 51, Hartikka et al is considered relevant prior art for having taught formulating a plasmid expression vector with a pharmaceutically acceptable carrier, e.g. saline or PBS (e.g. Abstract), as such is the preferred vehicle for delivering plasmid DNA. Similarly, Tiscornia et al is considered relevant prior art for having taught formulating a lentivirus vector with a pharmaceutically acceptable carrier, e.g. PBS (pg 244, Lentiviral vectors). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the expression cassette of Ohneda et al to further comprise a pharmaceutically acceptable carrier, e.g. saline or PBS, with a reasonable expectation of success because those of ordinary skill in the art have long-recognized and routinely successfully reduced to practice the ability to formulate the artisan’s vector, be it plasmid or lentivirus, with a pharmaceutically acceptable carrier. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 48, Ohneda et al taught a vector comprising the expression cassette of Claim 36 (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Moreau-Gaudry et al taught a vector comprising the expression cassette (e.g. Figure 1). Hartikka et al taught wherein the expression cassette is within a plasmid expression vector. Tiscornia et al taught wherein the expression cassette is within a lentivirus vector. With respect to Claim 49, Ohneda et al taught wherein the vector is a plasmid (e.g. pg 1252, col. 2, Methods, cloned into the pSVbeta vector). Moreau-Gaudry et al taught wherein the vector is a lentivirus (e.g. Figure 1). Hartikka et al taught wherein the vector is a plasmid expression vector. Tiscornia et al taught wherein the vector is a lentivirus vector. With respect to Claim 50, Moreau-Gaudry et al taught lentivirus particles comprising the vector (e.g. pg 2666, Methods). Tiscornia et al taught lentivirus particles comprising the vector. The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments/Amendments Applicant does not contest the teachings of Hartikka et al (2000; of record)) and Tiscornia et al (2006; of record) as applied to the obviousness to modify the expression cassette of Ohneda et al to further comprise a pharmaceutically acceptable carrier, e.g. saline or PBS, with a reasonable expectation of success because those of ordinary skill in the art have long-recognized and routinely successfully reduced to practice the ability to formulate the artisan’s vector, be it plasmid or lentivirus, with a pharmaceutically acceptable carrier. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). Conclusion 15. No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. KEVIN K. HILL Examiner Art Unit 1638 /KEVIN K HILL/Primary Examiner, Art Unit 1638
Read full office action

Prosecution Timeline

Show 2 earlier events
Jul 18, 2025
Response Filed
Jul 30, 2025
Final Rejection mailed — §103, §112
Sep 08, 2025
Request for Continued Examination
Sep 11, 2025
Response after Non-Final Action
Dec 03, 2025
Non-Final Rejection mailed — §103, §112
Apr 02, 2026
Response Filed
Apr 02, 2026
Response after Non-Final Action
May 06, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12612647
Compositions Useful in Treatment of Spinal Muscular Atrophy
3y 3m to grant Granted Apr 28, 2026
Patent 12589168
COMPOSITIONS AND METHODS FOR TREATING SENSORINEURAL HEARING LOSS USING OTOFERLIN DUAL VECTOR SYSTEMS
3y 11m to grant Granted Mar 31, 2026
Patent 12576135
Compositions and Methods for Anti-TnMUC1 Gold CAR T-cells
3y 5m to grant Granted Mar 17, 2026
Patent 12559717
GENE THERAPY FOR RECESSIVE DYSTROPHIC EPIDERMOLYSIS BULLOSA USING GENETICALLY CORRECTED AUTOLOGOUS KERATINOCYTES
10m to grant Granted Feb 24, 2026
Patent 12544461
ISOLATED NUCLEIC ACID MOLECULE AND APPLICATION THEREOF
3y 7m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
36%
Grant Probability
70%
With Interview (+33.4%)
3y 8m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 854 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month