DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s amendments to the claims filed on October 15, 2025 have been received and entered. Claims 1, 5-6. 8, 11, 14, 15, 17, 18, 21-22 and 26 have been amended , while claims 204, 23-25 have been canceled. Claims 1, 5-22 and 26 are pending in the instant application.
Election/Restrictions
Applicant's election with traverse of claims 1-22 (group I) in the reply filed on May 12, 2025was acknowledged. Applicant should note that the examiner has required restriction between product and process claims. If the product claims are found allowable, withdrawn process claims (group III) that depend from or otherwise require all the limitations of the allowable product claim will be considered for rejoinder as indicated in previous office action. Upon further consideration election of species requirement between different species are hereby withdrawn and all the withdrawn species are rejoined with the elected species. The requirement is still deemed proper and is therefore made FINAL.
Claim 26 remains withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on May 12, 2025.
Priority
This application is a 371 of PCT/JP2020/021851 filed on 05/27/2020, which claims priority from US provisional application no 63/025,417 filed on 05/15/2020, which claims priority from US provisional application no 62/853,373 filed on 05/28/2019.
Claims 1, 5-22 are under consideration.
Maintained- Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 5-14, 17-21 and 22 remain rejected under 35 U.S.C. 103 as being unpatentable over Pinto et al (Molecular Cell, 2017, 68, 479-490, IDS), Gilbert et al (Cell, 2014, 647-661, IDS) and Storbeck et al (Journal of Biological Chemistry 1998, 273, No. 15, 9139–9147) as evidenced by Kirn (WO/2019/060454, EFD. 09/19/2018 or Genbank accession no GenBank Accession Number NG_009784.1).
With respect to claim 1, 8-9 19-20 and 21, Pinto teaches an AAV6 construct encoding a deactivated Cas9 (Cas9) enzyme and a gRNA, and its use in DM1 (myotonic dystrophy type 1) cells to reduce the production of mutant DMPK RNA comprising expanded CUG repeats (see e3, para. 1 and e4, para. 2). This construct decreases pathological RNA foci and myotonia in vivo (see abstract; p.486). The gRNA targets the CUG repeats of the DMPK 3' UTR (see page 480 left-hand column; Figure 1A-B). Pinto further teaches that other mutant gene comprising expanded CTG repeats, which is an advantage for therapy. Pinto teaches the construct, wherein the gRNA targets the CTG repeats in the DNA, will also be suitable to target CTG repeat-containing RNA that "escapes" the transcriptional repression (see page 487).
With respect to claims 10-12, 13-14, 17, Pinto teaches that a promoter may be U6 promoter- (see page 462, col. 2, para.3) or CMV promoter (see page e4, para. 6).
Pinto differs from claimed invention by not disclosing that (i) the dCas protein of the claimed constructs comprises, in addition, a transcriptional repression domain; and (ii) the gRNA does not target the CTG repeats of the mutant DMPK gene, but a region close to the transcription start site (TSS) of the DMPK gene.
Before the effective filing date of instant application, Pinto provides motivation to use a dCas9-repressor fusion protein that could be used to repress the transcription of a gene of interest (para. 480, col. 1, para. 1). Gilbert cures the deficiency by disclosing that the expression of genes can be inhibited with a dCas9- KRAB (transcriptional repressor) construct, if the sgRNA is designed (see limitation of claims 6 and 7). Gilbert continues to teach expression construct comprising an optimized KRAB-dCas9 fusion protein under the control of a promoter (Figures 5A and 5B) and expression of KRAB-dCas9 robustly depletes transcript levels from sgRNA-targeted genes (see page 653, col. 2, para. 4) (limitation of claim 6-9 and 13). Gilbert teaches that: the sgRNA should target, preferably, a region from -50 to +300 relative to the TSS of the target gene; and the optimum length of the protospacer sequence in the gRNA is 18 to 21 base pairs (see page.648 col. 2; Figure 1C). Storbeck reported regulatory sequence elements in the promoter region and the first intron of the DMPK gene (see abstract), while Kirn/accession number provide relevant DMPK genomic sequence as set forth in SEQ ID NO: 65 comprising nucleotide sequence having 100% identity to SEQ ID NO: 81 (see search result).
Qy 1 CAGAGTAAGGTCAGCAGAGGC 21
|||||||||||||||||||||
Db 5561 CAGAGTAAGGTCAGCAGAGGC 5581
Therefore, it would have been prima facie obvious for a person of ordinary skill in the art seeking to provide an alternative to the construct disclosed in Pinto to combine the teaching with prior art to study the a dCas9-KRAB (transcriptional repressor) fusion protein in combination with gRNA sequences of 18 to 21 base pairs that surround the TSS of the DMPK gene, in the region from -50 to 300 relative to the TSS as suggested in Gilbert and Storbeck, as instantly claimed, with a reasonable expectation of success, before the effective filing date of the instant invention. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do so as prior art suggested that expression of many gene could be inhibited by a dCas9-KRAB (transcriptional repressor) fusion protein with a gRNA sequence of 18 to 21 base pairs surrounding the TSS of the target gene (DMPK gene,) particularly the-50 to 300 regions relative to the TSS (see page 648, Figure 1C) as in Gilbert. As to the specific guide RNA and the region specifically targeted by the guide RNA were available to one of ordinary skill in the art through routine screening with limited experimentation as disclosed in generic teaching of Gilbert with a gRNA sequence of 18 to 21 base pairs surrounding the TSS of the DMPK gene, particularly the-50 to 300 regions relative to the TSS. Absent any functional requirement and/or unexpected superior result, one of skill in the art would have been expected to have a reasonable expectation of success in designing a construct that merely bind to the DMPK DNA using well-known CRISPR-Cas technology as disclosed in Gilbert would obtain gRNA sequences that are capable of inhibiting the expression of DMPK that would include those that target SEQ ID N0:85-87 and 132 or a portion thereof of the instant application. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Claims 13-16 remain rejected under 35 U.S.C. 103 as being unpatentable over Pinto et al (Molecular Cell, 2017, 68, 479-490, IDS), Gilbert et al (Cell, 2014, 647-661, IDS) and Storbeck et al (Journal of Biological Chemistry 1998, Vol. 273, No. 15, Issue of April 10, 9139–9147) as evidenced by Kirn (WO/2019/060454, EFD. 09/19/2018 or Genbank accession no GenBank Accession Number NG_009784.1) as applied above for claims 1, 13 and further in view of Bengtsson et al (Nature communication, 2017, 8:14454, 1-9).
The teaching of Pinto, Gilbert, Storbeck have been described above and relied in same manner here. The combination of reference differs from claimed invention by not disclosing that the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor is a ubiquitous promoter or a muscle specific CK8 promoter.
Bengtsson teaches that spCas9 nuclease could be expression cassette was generated by PCR cloning of NLS-SpCas9-NLS from LentiCRISPRv1 and insertion into AAV containing the ubiquitous elongation factor-1 alpha short promoter for in vitro studies in fibroblasts or the muscle-specific creatine kinase 8 (CK8) regulatory cassette for in vivo studies (see page 6, col. 2, para. 3). Bengtsson provide motivation to restrict endonuclease expression to skeletal and cardiac muscle by use of the muscle-specific CK8 regulatory cassette to reduce the risk of off-target events in non-muscle cells and to minimize elicitation of an immune response (see page 2, col. 2, para. 2).
Therefore, it would have been prima facie obvious for a person of ordinary skill in the art seeking to provide an alternative to the construct disclosed in Pinto to combine the teaching with Gilbert and Storbeck to study the a dCas9-KRAB (transcriptional repressor) fusion protein in combination with gRNA sequences of 18 to 21 base pairs that surround the TSS of the DMPK gene, in the region from -50 to 300 relative to the TSS under the control of ubiquitous or muscle specific CK8 promoter as suggested in Bengtsson, as instantly claimed, with a reasonable expectation of success, before the effective filing date of the instant invention. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to use the muscle-specific CK8 promoter sequence in order to restrict dCas9-KRAB expression to skeletal and cardiac muscle to reduce the risk of off-target events in non-muscle cells and to minimize elicitation of an immune response (see above in Bengtsson). Absent any functional requirement and/or unexpected superior result, one of skill in the art would have been expected to have a reasonable expectation of success in designing a construct that merely bind to the DMPK DNA using well-known CRISPR-Cas technology as disclosed in Gilbert and use of muscle-specific CK8 promoter was successfully reported to reduce the risk of off-target events as in Bengtsson. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Response to arguments
Applicant disagree with the rejection arguing Pinto reference targets a CUG repeat with its gRNA that is different from region targeted by the claimed invention which is different from the region targeted by the claimed invention. Accordingly, the specific sequence targeted by the gRNA is also different between the claimed invention and the Pinto reference. Furthermore, while the claimed invention uses a transcriptional repressor, The Gilbert reference discloses a system (CRISPRi) that suppresses gene expression using a guide RNA and a fusion protein of a transcriptional repressor and dCas9. However, it neither describes targeting the DMPK gene nor discloses or suggests any specific sequence targeted by the gRNA. Applicant continue to argue that since identifying a target sequence suitable for suppressing the expression of DMPK is critical, the reference contains neither a description nor a suggestion regarding that point. As shown in the amended claims, amended claim 1 (based on claim 4) limits the sequence targeted by the gRNA to the sequence confirmed in the present Examples to suppress expression of DMPK. Applicant assert that inventors comprehensively analyzed an enormous number of sequences and identified target sequences of gRNAs suitable for suppressing DMPK expression, as clearly shown in the Examples of the present specification. For instance, as evidenced by the significant difference in the inhibitory effect between the sequence of SEQ ID NO: 83 and that of SEQ ID NO: 84, which were designed at nearby positions (see Tables 1-3 and Figure 1; see also Figure 2), even a person skilled in the art would not have identified the sequences suitable for suppressing DMPK expression without actually designing and analyzing them. . Such sequences could not have been predicted even by combining the teachings of the cited prior art references. Applicants’ arguments have been fully considered, but are not found persuasive.
It appears that Applicant is arguing that the cited references do not expressly suggest the claimed invention. However, it is well established in case law that a reference must be considered not only for what it expressly teaches, but also for what it fairly suggests. In re Burkel, 201 USPQ 67 (CCPA 1979). Furthermore, in the determination of obviousness, the state of the art as well as the level of skill of those in the art are important factors to be considered. The teaching of the cited references must be viewed in light of these factors. It also appears that applicant is attempting to attack each reference individually. However, in a 103 rejection the references must be considered as a whole.
In the instant case, claims are broad and recite the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO. The claims further do not limit the length of the gRNA. MPEP 2111.03 states “The transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Additionally, independent claim 1 recites polynucleotide that does not require any specific functional outcome or inhibition of the expression of DMPK, as argued by the applicant. In view of foregoing, it is apparent that applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., target sequence suppressing the expression of DMPK that applicant deemed it critical) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
Applicants have further engaged in selective reading of the teachings of Pinto and Gilbert to formulate the grounds for not teaching the invention. Applicant in part agree that Pinto targets a CUG repeat with its gRNA of the DMKP gene that is different from region targeted by the claimed invention. Given that claim 1 is broad and encompasses polynucleotide that does not require any functional limitation, it would be obvious for one of ordinary skill in the art to design a construct that binds to the DMPK DNA using well known CRISP-Cas technology. Further, before the effective filing date of instant application, it was known to one of ordinary skill in the art that dCas-repressor fusion protein could be used to suppress the transcription of a gene of interest. Gilbert teaches the sgRNA should target, preferably, a region from -50 to +300 relative to the TSS of the target gene; and the optimum length of the protospacer sequence in the gRNA is 18 to 21 base pairs. In view of forgoing teaching of Gilbert, it would have been obvios to one of ordinary skill in the art to generate dCas9-KRAB (transcriptional repressor) fusion protein in combination with gRNA sequences of 18 to 21 base pairs that surround the TSS of the DMPK gene known in prior art, in particular the region from -50 to 300 relative to the TSS, with reasonable expectation of success. Given the breadth of the gRNA recited in the claims, lack of functional requirement and/or unexpected superior result, one of ordinary skill in the art would have reasonable expectation of obtaining finite number of gRNA sequences targeting a region from -50 to +300 relative to the TSS of the target gene (DMKP or any other) as suggested in Gilbert.
Therefore, in view of the fact patterns of the instant case, and the ground of rejection outlined by the examiner, applicants' arguments are not compelling and do not overcome the rejection of record.
Withdrawn-Claim Rejections - 35 USC § 112-written description
Claims 1, 5-6. 8, 11, 14, 15, 18, 21 and 22 were rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. Applicant’s amendments to base claim 1 and 17 obviates the basis of the rejection, Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot.
Conclusion
No claims allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANOOP K SINGH/Primary Examiner, Art Unit 1632