Prosecution Insights
Last updated: October 02, 2026
Application No. 17/615,520

RNAI CONSTRUCTS FOR INHIBITING SCAP EXPRESSION AND METHODS OF USE THEREOF

Final Rejection §103§DP
Filed
Nov 30, 2021
Priority
May 30, 2019 — provisional 62/854,433 +1 more
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Amgen Inc.
OA Round
2 (Final)
58%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
43 granted / 74 resolved
-1.9% vs TC avg
Strong +41% interview lift
Without
With
+40.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
57 currently pending
Career history
135
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
34.4%
-5.6% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
29.0%
-11.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 74 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Response to Amendment/Status of Claims Receipt of Arguments/Remarks filed on 05/27/2026 is acknowledged. Claims 2,8,17,18,23,24 and 27 were cancelled. Claims 1,3-5,26 and 38 were amended. Claims 40-44 are new. Claims 1,3-5,12,13,15,16,26,29,30,33,34,36,38 and 40-44 are pending. Claims 34,36,38,40,41,43 and 44 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made with traverse in the reply filed on 12/15/2025 but applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, and therefore the requirement was made FINAL. Applicant elected the species of an RNAi construct comprising the antisense sequence SEQ ID NO: 242 and sense sequence SEQ ID NO: 241 which corresponds to Duplex D-2040 in the reply filed on 12/15/2025, and the Examiner expanded to include Duplex D-1040 of table 1 (page 57) comprising the sense sequence of SEQ ID NO: 81 and the antisense sequence of SEQ ID NO: 82 which are the unmodified sequences that correspond to the elected sequences (SEQ ID NOS: 241 and 242) with chemical modifications above. Claims 1,3-5,12,13,15,16,26,29,30,33 and 42 are under examination. Priority This application is a 371 of PCT/US2020/035545, filed 06/01/2020 which claims benefit of 62/854,433, filed 05/30/2019 as reflected by the most recent filing receipt. Withdrawn Objections and Rejections Applicant’s arguments and amendments, see page 7, filed 05/27/2026, with respect to the objection to Figures 1 and 2 have been fully considered and are persuasive due to the amendments which properly label Figures 1 and 2. The objection to the drawings has been withdrawn. Applicant’s arguments and amendments, see page 7, filed 05/27/2026, with respect to the objection to claim 1 have been fully considered and are persuasive due to the amendment to claim 1 to recite the full name of the protein. The objection to claim 1 has been withdrawn. Applicant’s arguments and amendments, see page 7, filed 05/27/2026, with respect to the 35 U.S.C. 112(b) rejection of claims 1-5,8,12,13,15-18,23,24,26,27,29,30 and 33 have been fully considered and are persuasive due to the amendments to claims 1,3 and 26 reciting specific ID NOs rather than referencing Tables, and the amendment to claim 4 deleting “sufficiently complementary”. The 35 U.S.C. 112(b) rejection has been withdrawn. Applicant’s arguments and amendments, see page 8, filed 05/27/2026, with respect to the 35 U.S.C. 102(a)(1) rejection of claims 1-5,7,13,15,29,30 and 33 as anticipated by Soutschek et al. have been fully considered and are persuasive due to the amendments to claim 1 to recite the antisense strand comprises an antisense sequence of SEQ ID NO: 82,86 or 336 and comprises at least one modified nucleotide and at least one phosphorothioate internucleotide linkage and Soutscheck et al. do not anticipate the claims as amended. Therefore, the rejection has been withdrawn. However, upon further consideration a new ground of rejection is made in view of the amendments to the claims and a case of obviousness. Applicant’s arguments and amendments, see page 8, filed 05/27/2026, with respect to the 35 U.S.C. 103 rejection of claims 1-5,8,12,13,15-18,23,24,29,30 and 33 as unpatentable over Soutschek et al. in view of Maier et al. have been fully considered and are persuasive due to the amendments to claims 1 and 3 requiring the entire sequence of SEQ ID NOs: 82 and 81. Therefore, the rejection has been withdrawn. However, upon further consideration a new ground of rejection is made in view of the amendments to the claims requiring the entire sequence of SEQ ID NOs: 82 and 81 using a different combination of references (Soutschek et al. in view of NCBI Ref Seq NM_012235.1). Rejections Necessitated by Amendment Claim Rejections - 35 USC § 103 The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 1,3-5,12,13,15,16,29,30 and 33 are rejected under 35 U.S.C. 103 as being unpatentable over Soutschek et al. (US 20090093426, Published 9 April 2009), in view of NCBI Reference NM_012235.1 (24 Oct 2002). Regarding claims 1 and 3, Soutschek et al. teach double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a SCAP gene, the dsRNA comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, and the antisense strand comprises a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding a SCAP gene (paragraphs 0012-0014). Soutschek et al. teach an antisense strand sequence of the RNAi agent which is SEQ ID NO: 10 (Table 1, page 2), see below. PNG media_image1.png 31 579 media_image1.png Greyscale Nucleotides 1-19 of the antisense strand of SEQ ID NO: 10 of Soutschek et al. has 100% identity to nucleotides 1-19 of instant antisense sequence of SEQ ID NO: 82. See the alignment below, wherein Qy is instant SEQ ID NO: 82 and Db is SEQ ID NO: 10 of Soutschek et al. PNG media_image2.png 165 569 media_image2.png Greyscale Soutschek et al. teach the corresponding sense strand sequence of SEQ ID NO: 9, shown above. Nucleotides 1-18 of the sense sequence of SEQ ID NO: 9 of Soutschek et al. (Db) have 100% identity to nucleotides 3-20 of instant SEQ ID NO: 81 (Qy). PNG media_image3.png 170 563 media_image3.png Greyscale Soutschek et al. teach the above sequences of SEQ ID NO: 9 and 10 as each having ‘TT’ overhang at the 3’ end (see above). Soutschek et al. teach the dsRNA molecules of the invention can be comprised of at least one modified nucleotide such as a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative. Alternatively, the modified nucleotide may be chosen from the group of: a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide (paragraph 0014). Soutschek et al. also teach design of siRNAs to identify siRNAs targeting hamster, mouse and human SCAP using the mRNA sequences of SCAP which were examined by computer analysis to identify homologous sequences of 19 nucleotides that yielded RNAi agents (paragraph 0180). Soutschek et al. do not teach the entire sequence of the antisense sequence of SEQ ID NO: 82 (auaccaggaugccaauccagauu, 23 nt) and the sense sequence of SEQ ID NO: 81 (ucuggauuggcauccuggua, 20 nt). A blast search of the sense sequence of instant SEQ ID NO: 81 shows that nucleotides 1-20 of SEQ ID NO:81 aligns with nucleotides 1818-1837 of NM_012235.4 Homo sapiens SREBF chaperone (SCAP) transcript variant 1, mRNA. PNG media_image4.png 211 589 media_image4.png Greyscale Likewise, a blast search of the antisense sequence of instant SEQ ID NO: 82 shows nucleotides 1-21 of SEQ ID NO:82 aligns with nucleotides 1838-1818 of NM_012235.4 Homo sapiens SREBF chaperone (SCAP) transcript variant 1, mRNA. PNG media_image5.png 217 585 media_image5.png Greyscale The mRNA sequence of Homo sapiens SCAP transcript variant 1 of NM_012235.1 was publicly available (24 Oct 2002) before the effective filing date and the mRNA sequence is shown below. PNG media_image6.png 796 503 media_image6.png Greyscale PNG media_image7.png 126 515 media_image7.png Greyscale Regarding claims 4-5, Soutschek et al. teach the dsRNA comprises two RNA strands that are sufficiently complementary to hybridize to form a duplex structure. One strand of the dsRNA (the antisense strand) comprises a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of a SCAP gene, the other strand (the sense strand) comprises a region which is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. Generally, the duplex structure is between 15 and 30 base pairs in length (paragraph 0060). Soutschek et al. teach the duplex structure may also be between 18 and 25 base pairs in length (paragraph 0060). Regarding the sequences of SEQ ID NO: 82 and SEQ ID NO: 81, see the teachings above of Soutschek and NCBI Reference NM_012235.1. Regarding claim 12, Soutschek et al. teach “blunt end” means that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhang. A “blunt ended” dsRNA is a dsRNA that has no nucleotide overhang at either end of the molecule (paragraph 0047), and the dsRNA may also have a blunt end, generally located at the 5′-end of the antisense strand. Such dsRNAs have improved stability and inhibitory activity, thus allowing administration at low dosages, i.e., less than 5 mg/kg body weight of the recipient per day (paragraph 0066). Regarding claims 13,15 and 16, as Soutschek et al. teach the above sequences of SEQ ID NO: 9 and 10 as each having ‘TT’ overhang at the 3’ end (see above), and therefore teach at least one nucleotide overhang of 1-4 unpaired nucleotides (claim 13), and a nucleotide overhang at the 3’ end of both the sense strand and the antisense strand (claim 15), and wherein the nucleotide overhang comprises 5’-dTdT-3’ dinucleotide (claim 16). Regarding claims 29-30, the wherein clause is a functional limitation that would be carried out by structure of the recited RNAi construct. Nevertheless, Soutschek et al. teach the dsRNAs molecules upon contacting with a cell expressing the SCAP gene, inhibits the expression of the SCAP gene by at least 20%, or at least 25%, 30%, 35%, 40%, 45%, 50%, 55% 60%, 65%, 70%, 85%, 90% or 95%, e.g. in primary hamster hepatocytes (paragraph 0013). Regarding claim 33, Soutschek et al. teach a pharmaceutical composition comprising one or more dsRNA of the invention and a pharmaceutically acceptable carrier or delivery vehicle, and preferably the dsRNA is chosen from ….AD-9494… (paragraph 0023). See AD-9494 below for reference. PNG media_image8.png 35 593 media_image8.png Greyscale Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the effective filing date to provide a dsRNA agent that inhibits SCAP expression as taught by Soutschek et al. and use the teachings of Soutschek et al. regarding the length of the RNAi duplex region being 15-30 base pairs in length, and the NCBI Reference Sequence Accession number NM_012235.1 of the SCAP mRNA sequence, to arrive at the claimed invention with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to design and provide a dsRNA agent that targets SCAP and to use the known mRNA sequence of NCBI Reference Sequence Accession number NM_012235.1 and the design method and dsRNA sequences of Soutschek et al. and arrive at the instant sequences of SEQ ID NOs: 82 and 81 to provide a dsRNA with enhanced RNAi activity. In addition, because the mRNA sequence of SCAP (NCBI Reference Sequence Accession number NM_012235.1) was publicly available, and nucleotides 1-20 of SEQ ID NO:81 aligns with nucleotides 1818-1837 of NM_012235 and nucleotides 1-21 of SEQ ID NO:82 aligns with nucleotides 1838-1818 of NM_012235, an ordinary artisan could have used the teachings of Soutschek et al. regarding overhangs and chemical modifications to arrive at the instant sense and antisense sequences with a reasonable expectation of success based on a 21-mer and 23-mer and the modifications known in the art. Accordingly, the limitations of claims 1,3-5,12,13,15,16,29,30 and 33 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Claims 26 and 42 are rejected under 35 U.S.C. 103 as being unpatentable over Soutschek et al. in view of NCBI Reference NM_012235.1 as applied to claims 1,3-5,12,13,15,16,29,30 and 33 above, and further in view of Maier et al. (US 20170275626, Published 28 Sept 2017), Li et al. (US 20180195069, Published 12 July 2018), and Ma et al. (Nature 20 May 2004; 429(6989): 318-322). Claim Interpretation: Table 2, page 63 shows the elected sequences of Duplex D-2040 contain modifications, and page 61 defines the modifications. Sense sequence 5’-3’ Antisense sequence 5’-3’ PNG media_image9.png 45 653 media_image9.png Greyscale PNG media_image10.png 373 647 media_image10.png Greyscale The above chemical modification motifs can be summarized as below: Sense strand: positions 1-8,10,15-20 2’-OMe; positions 9,11-14 2’-F; phosphorothioate linkage between positions 20 and 21; position 21 inverted abasic residue. Antisense strand: positions 1,3-6,8-11,13,15-23 2’-OMe; positions 2,7,12,14 2’-F; phosphorothioate linkage between positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23. The teachings of Soutschek et al. and NCBI Reference NM_012235.1 have been described above. Regarding claim 42, Soutschek et al. teach a pharmaceutical composition comprising one or more dsRNA of the invention and a pharmaceutically acceptable carrier or delivery vehicle, and preferably the dsRNA is chosen from ….AD-9494… (paragraph 0023). While Soutschek et al. teach chemical modifications such as phosphorothioate linkages and 2’-OMe modifications, Soutschek et al. does not teach the specific chemical modification pattern of instant SEQ ID NO: 241 and SEQ ID NO: 242 as shown above. Before the effective filing date, Maier et al. taught RNAi duplex agents having particular motifs that are advantageous for inhibition of target gene expression (paragraph 0002). Maier et al. taught dsRNA comprising a sense strand and antisense strand with various motifs, and taught an antisense strand having a length of 23 nucleotides, 2’-OMe modifications at positions 1,3,7,9,11,13,15,17,19-23 and 2’-F modifications at positions 2,4-6,8,10,12,14,16 and 18; phosphorothioate internucleotide linkages between positions 1 and 2 and 2 and 3, and between positions 21 and 22 and 22 and 23 counting from the 5’ end (paragraphs 0155-0158). Maier et al. also taught dsRNA agents comprising a sense strand comprising 2’-F modifications at positions 2,6,9,14 and 16, and 2’-OMe modifications at positions 1,3-5,7,8,10-13,15 and 17-23 (paragraph 0202) and phosphorothioate internucleotide linkages between positions 1 and 2 and 2 and 3, and between positions 21 and 22 and 22 and 23 counting from the 5’ end (paragraph 0203). Maier et al. taught the inventors found that having 2’-OMe modifications at nucleotide positions 2 and 14 from the 5’ end of the antisense strand dampened gene silencing activity, and that by introducing chemical modifications at the 2’-position or equivalent positions in a non-ribose, acyclic, or backbone that provide less steric bulk than a 2’-OME modification at certain positions in antisense and/or sense strand, the dsRNA agents were able to regain the gene silencing activity (paragraph 0261). Maier et al. also taught the dsRNA agent can comprise a phosphorus-containing group at the 5’ end of the sense strand or antisense strand and can be a 5’-end phosphate (paragraph 0052). Maier et al. taught 5’-phosphorylation of dsRNA is desirable for loading of siRNAs into the RISC complex resulting in RNAi-mediated gene silencing, and that metabolically stable 5’ phosphate mimics can lead to higher stability, increased RISC loading and more potent gene silencing (paragraph 0745). Maier et al. taught a 5’-phosphate and benefits of 5’-phosphorylation of dsRNA is desirable for loading of siRNAs into the RISC complex resulting in RNAi-mediated gene silencing, and that metabolically stable 5’ phosphate mimics can lead to higher stability, increased RISC loading and more potent gene silencing (paragraph 0745). Therefore, it was known in the prior art to provide a dsRNA wherein the antisense strand has mixture of 2'-O-methyl and 2'-F at various positions, including many of the instant recited positions, and it was known in the art that 2’OMe modifications at positions 2 and 14 from the 5’ end of the antisense strand dampened gene activity and providing other chemical modifications at these positions that provide less steric bulk (Maier et al. taught 2’-F modifications at positions 2 and 14), and was known in the art to provide phosphorothioate internucleotide linkages at the recited positions in the antisense sequences. Regarding the inverted abasic residue on the 3’ end of the sense strand, Li et al. taught RNA interference agents for inhibiting alpha-1 antitrypsin gene expression (paragraph 0002), that have antisense strands and sense strands, and taught RNAi agents comprising sense strand sequences with chemical modifications including 2’-O-methyl, 2’-fluoro, phosphorothioate linkages at specific positions, as well as an inverted abasic deoxyribose (invAb) at the last position at the 3’ end of the sense strand (paragraphs 0096-0099), and that in some embodiments the 3’ end of the sense strand may include additional abasic residues including UUAb, UAb or Ab added to the 3’ end of the sense strand, and in some embodiments the abasic residues are inverted (invAb) (paragraph 0153). Li et al. taught that inclusion of one or more inverted abasic residues or abasic sites at or near the terminal end or ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent (paragraph 0153). Regarding the UU overhang on the 3’ end of the antisense strand, Ma et al. taught siRNAs and that the PAZ domain is an RNA-binding module found in Argonaute and some Dicer proteins, and that PAZ anchors the 2-nucleotide 3’ overhang of the siRNA-like duplex within a highly conserved binding pocket (Abstract). Ma et al. taught siRNAs that are 19-23 base-paired duplex with a 2-nucleotide 3’ overhangs at both ends and that the PAZ domain requires the 2-nt 3’ overhang for efficient complex formation (page 1). Ma et al. taught that RNAs containing UU and AG 3’ overhangs bind PAZ with the highest affinities, and that the overhang contributes critically to the binding, and in which the PAZ domain optimally fits the duplex end with the 2-nt 3’-overhang in a sequence-independent manner (page 3 bottom to page 4 top). Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the effective filing date to provide a dsRNA agent that inhibits SCAP expression as taught by Soutschek et al. in view of the NCBI Reference Sequence Accession number NM_012235.1 of the SCAP mRNA sequence, and use the teachings of Maier et al. regarding RNAi duplex agents having particular motifs that are advantageous for inhibition of target gene expression with chemical modifications at certain positions of the antisense and sense strands, and the teachings of Li et al. regarding the position and benefits of the inverted abasic residue on the sense strand and the teachings of Ma et al. regarding the UU overhang on the 3’ end of the antisense strand, to arrive at the claimed invention with a reasonable expectation of success. There would be a reasonable expectation of success because both Soutschek et al. and Maier et al. pertain to dsRNA for inhibiting expression of a target gene, and Soutschek et al. suggests the same chemical modifications as Maier et al. One of ordinary skill in the art would have been motivated to design and provide a dsRNA agent that targets SCAP as taught by Soutschek et al. in view of the NCBI Reference Sequence Accession number NM_012235.1 and to arrive at the specific modification pattern of the antisense sequence and sense sequence based on the teachings of Maier et al. teaching the RNAi duplex agents having particular motifs that are advantageous for inhibition of target gene expression including phosphorothioate internucleotide linkages, 2’-O-Me,and 2’-F at specific positions and varying the positions of these modifications, and that having 2’-OMe modifications at nucleotide positions 2 and 14 from the 5’ end of the antisense strand dampened gene silencing activity (paragraph 0261). One would have been motivated by the teachings of Li et al. regarding the position and benefits of the inverted abasic residue on the sense strand and the teachings of Ma et al. regarding the UU overhang on the 3’ end of the antisense strand, to arrive at the claimed invention with a reasonable expectation of success. Although the cited art does not specifically teach the exact modification pattern, it would have been obvious for one ordinarily skilled in the art to perform routine optimization of the pattern to achieve improved results. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. MPEP 2144.05 provides In re Williams, 36 F.2d 436, 438, 4 USPQ 237 (CCPA 1929) ("It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions." In the instant case, the focus is in the change of form, or substitution of equivalents over the prior art. Substitution of equivalents in terms of identifying optimal locations, both in terms of potency and reduced toxic effects, for 2’F and 2’-OMe modifications in dsRNA, since varying 2’-F and 2’-OMe positions in a double stranded nucleic acid for optimal or better results in known in the prior art. Accordingly, the limitations of claims 26 and 42 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Response to Arguments Applicant’s arguments and amendments, see pages 8-9, filed 05/27/2026, with respect to the rejection(s) of claim(s) 26 and 27 under 35 U.S.C. 103 have been fully considered but are not persuasive. The Examiner is still rejecting claim 26 as well as new claim 42 (claim 27 was cancelled), using the same references (Soutschek et al., NCBI Ref Seq NM_012235.1, Maier et al., Li et al. and Ma et al. Applicant argues on page 9 that the cited references do not disclose or suggest the RNAi constructs recited in the amended claims, and the references do not disclose or suggest the specific modified sense/antisense sequence pairs recited in claim 26. Applicant argues the amended claims recite specific RNAi sequences containing specific modifications, and the cited references do not provide an articulated rationale of why a person of ordinary skill would have selected these particular SCAP-targeting sequences and combined them with the specific modification patterns present in the sequences now claimed with a reasonable expectation of achieving the demonstrated SCAP inhibitor activity. Applicant states the Office Action relies on “routine optimization” to bridge this gap, but is insufficient, and routine optimization may be applicable where the prior art discloses the general conditions of a claim and identifies a result-effective variable that can be adjusted within a known range (See MPEP 2144.05). The amended claims do not recite a numerical range or simple optimization of degree but recite specific RNAi constructs having defined nucleotide sequences, defined chemical modifications, defined strand pairing and defined terminal structures. Applicant argues the cited references provide no direction to make selections of specific and defined nucleotide sequences, chemical modifications, strand pairings and chemical structures in the manner now claimed, and the Office Action does not provide any rationale why the general teachings that certain classes of RNAi modifications may be useful in some contexts would render every specific modified RNAi construct obvious. The effect of a particular modification pattern is context-dependent and cannot be assumed to be predictable across different target sequences, strand pairings, terminal structures, and modification position can effect potency, stability, strand selection, RISC loading and target knockdown and therefore the claimed sequences and modification patterns was not a matter of routine substitution or routine optimization. This is not found persuasive. Regarding Applicant’s argument about routine optimization, the rejection stated, “in the instant case, the focus is in the change of form, or substitution of equivalents over the proper art. Substitution of equivalents in terms of identifying optimal locations in terms of potency and reduced toxic effects, for 2’-F and 2’-OMe modifications in dsRNA, since varying 2’-F and 2’-OMe positions in a double stranded nucleic acid for optimal or better results is known in the prior art. Therefore, it is not found persuasive that this is insufficient, as the rejection stated motivations from each of the references regarding specific chemical modifications at specific locations of the sense and antisense strands. Regarding Applicant’s argument that a particular modification pattern is context dependent and cannot be assumed to be predictable across different target sequences….Obviousness does not require absolute predictability, however, at least some degree of predictability is required. Evidence showing there was no reasonable expectation of success may support a conclusion of nonobviousness. NOTE: MPEP 2143.02. Applicant argues on page 10 that the specification demonstrates the recited RNAi sequences significantly inhibit SCAP expression in vitro and in vivo. Applicant states Duplex D-2087, comprising antisense SEQ ID NO: 478 which is the modified version of SEQ ID NO: 336 inhibited SCAP expression by about 90% in vitro. Duplex D-2040 comprising antisense SEQ ID NO: 242 shows strong in vivo activity, including approximately 85% SCAP silencing in the AMLN mouse model and further shows that duplexes D-2040 and D-2042 comprising antisense SEQ ID NOs: 242 and 246 achieved greater than 85% reduction in SCAP mRNA in the ALIOS model (SEQ ID NOS: 242 and 246 are modified version of SEQ ID NOs: 82 and 86). Applicant argues the Office Action’s rationale depends on selecting discrete teachings from multiple references and combining with Applicant’s disclosure as a roadmap, which is the definition of hindsight reconstruction. This is not found persuasive. Regarding Applicant’s argument regarding the significant inhibition of SCAP expression both in vitro and in vivo of Duplex D-2087, Duplex D-2040 and D-2042, the results are not commensurate in scope with claims 1,3-5,12,13,15,16,29,30 and 33 as these claims do not require the specific chemical modification pattern of the duplexes that Applicant points to. Whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980) (Claims were directed to a process for removing corrosion at "elevated temperatures" using a certain ion exchange resin (with the exception of claim 8 which recited a temperature in excess of 100C). Appellant demonstrated unexpected results via comparative tests with the prior art ion exchange resin at 110C and 130C. The court affirmed the rejection of claims 1-7 and 9-10 because the term "elevated temperatures" encompassed temperatures as low as 60C where the prior art ion exchange resin was known to perform well. The rejection of claim 8, directed to a temperature in excess of 100C, was reversed.). See also In re Peterson, 315 F.3d 1325, 1329-31, 65 USPQ2d 1379, 1382-85 (Fed. Cir. 2003) (data showing improved alloy strength with the addition of 2% rhenium did not evidence unexpected results for the entire claimed range of about 1-3% rhenium); In re Grasselli, 713 F.2d 731, 741, 218 USPQ 769, 777 (Fed. Cir. 1983) (Claims were directed to certain catalysts containing an alkali metal. Evidence presented to rebut an obviousness rejection compared catalysts containing sodium with the prior art. The court held this evidence insufficient to rebut the prima facie case because experiments limited to sodium were not commensurate in scope with the claims.). Note: MPEP 716.02(d). With regards to claims 26 and 42 which do require a specific chemical modification pattern, it is noted that other duplexes that do not fall within the scope of the claims had the same or better silencing as D-2040 and D-2042 as shown in Table 9, page 77. For Example Duplex D-2125 had 89.01% silencing, D-2126 had 86.53% silencing. Any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected. An unexpected property or result must actually be unexpected and of statistical and practical significance. The burden is on the applicant to establish the results are in fact unexpected, unobvious and of statistical and practical significance. See MPEP 716.02. Regarding Applicant’s argument pertaining to hindsight reconstruction, "[a]ny judgment on obviousness is in a sense necessarily a reconstruction based on hindsight reasoning, but so long as it takes into account only knowledge which was within the level of ordinary skill in the art at the time the claimed invention was made and does not include knowledge gleaned only from applicant’s disclosure, such a reconstruction is proper." In re McLaughlin, 443 F.2d 1392, 1395, 170 USPQ 209, 212 (CCPA 1971). With regards to Applicants argument that the cited references provide no direction to make selections of specific and defined nucleotide sequences, chemical modifications, strand pairings and chemical structures, the examiner cited teachings and motivations from the cited references regarding specific modifications at specific locations and positions (Office Action, pages 14-16,18,21,25) for one of ordinary skill in the art to arrive at the instant claims with a reasonable expectation of success. Applicant argues on page 10 that the additional references cited against claims 26 and 27 do not remedy these deficiencies, as NCBI Ref Seq NM_012235.1, Li et al. and Ma et al. do not disclose or suggest the specific antisense sequences in amended claim 1 or the specific pairs required in amended claim 26 and do not provide a reason to select and combine the claimed sequences, chemical modification patterns and terminal structures with a reasonable expectation of achieving the demonstrated SCAP silencing activity. This is not found persuasive for the reasons cited above. The examiner cited teachings and motivations from the cited references regarding specific modifications at specific locations and positions (Office Action, pages 14-16,18,21,25) for one of ordinary skill in the art to arrive at the instant claims with a reasonable expectation of success. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1,3-5,12,13,15,16,26,29,30,33 and 42 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-42 of copending Application No. 18/867,536 (‘536) in view of Soutschek et al., Maier et al., and NCBI Reference NM_012235.1 (24 Oct 2002), cited above. Claim 1 of ‘536 recites an RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region having at least 15 contiguous nucleotides differing by no more than 3 nucleotides from an antisense sequence listed in Table 1, and wherein the RNAi construct inhibits the expression of a SREBP Cleavage Activating Protein (SCAP) mRNA. Table 1 discloses many sense and antisense sequence with chemical modification patterns. Duplex No. 20 has the same chemical modification pattern as instant SEQ ID NOs: 241 and 242, other than a phosphate on the 5’ end of the sense strand. Instant SEQ ID NOs 241 and 242: PNG media_image9.png 45 653 media_image9.png Greyscale Duplex 20 of ‘536: PNG media_image11.png 61 790 media_image11.png Greyscale Claims 2-9 of ‘536 recite the same or similar limitations to instant claims 4 and 5 regarding the length of the duplex region and length of the sense and antisense strands, claim 10 of ‘536 recites at least one blunt end as in instant claim 12, and claims 11-14 recite the same limitations of the overhangs as in instant claims 13,15 and 16. Claims 15-23 of ‘536 recite nucleotide modifications and claims 24-26 recite the antisense sense strand comprises a sequence selected from the antisense sequences listed in Table 1, and the sense strand comprises a sequence selected from the sense sequences listed in Table 1, and wherein the RNAi construct is any one of the duplex compounds listed in Table 1. Claims 28-34 of ‘536 recite the same limitations as instant claims 29,30 regarding reducing the level of SCAP in liver cells; claim 35 of ‘536 recites a composition comprising the RNAi construct of any one of claims 1-34 and a pharmaceutically acceptable carrier, excipient or diluent, as does instant claim 33 and 42. Claims 36-42 of ‘536 recite methods or reducing expression of SCAP in a patient and uses thereof. ‘536 does not recite the same sequences as instant SEQ ID NOs: 241 and 242, or a phosphate on the 5’ end of the sense strand. The teachings of Soutschek et al., Maier et al., and NCBI Reference NM_012235.1 have all been described above in the 103 rejections. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the claims of ‘536 based on the teachings of Soutschek et al., Maier et al., and NCBI Reference NM_012235.1 to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success because Soutschek et al. pertains to dsRNA for inhibiting SCAP and Maier et al. pertain to dsRNA for inhibiting expression of a target gene. One of ordinary skill in the art would have been motivated to design and provide a dsRNA agent that targets SCAP and to use the known mRNA sequence of NCBI Reference Sequence Accession number NM_012235.1 and the design method of Soutschek et al. and arrive at the instant sequences of SEQ ID NOs: 241 and 242 based on the teachings of Soutschek et al. and the 5’ phosphate modifications on the sense strand based on the teachings of Maier et al. teaching RNAi duplex agents with a sense strand comprising a 5’-phosphate and benefits of 5’-phosphorylation of dsRNA is desirable for loading of siRNAs into the RISC complex resulting in RNAi-mediated gene silencing, and that metabolically stable 5’ phosphate mimics can lead to higher stability, increased RISC loading and more potent gene silencing, to provide a dsRNA with enhanced RNAi activity. In addition, because the mRNA sequence of SCAP (NCBI Reference Sequence Accession number NM_012235.1) was publicly available, and nucleotides 1-20 of SEQ ID NO:241 aligns with nucleotides 1818-1837 of NM_012235 and nucleotides 1-21 of SEQ ID NO:242 aligns with nucleotides 1838-1818 of NM_012235, an ordinary artisan could have used the teachings of Soutschek et al., Maier et al. to arrive at the instant sense and antisense sequences with a reasonable expectation of success based on a 21-mer and 23-mer and the known chemical motif patterns and modifications known in the art. This is a provisional nonstatutory double patenting rejection. Response to Arguments Applicant’s arguments and amendments, see page 11, filed 05/27/2026, with respect to the Non-Statutory Double Patenting rejection(s) of claim(s) 1-5,8,12,13,15-18,23,24,26,27,29,30 and 33 have been fully considered but are not persuasive. Applicant summarizes what amended claims 1 and 26 recite and that the cited claims of the ‘536 application do not recite these antisense sequences, the corresponding sense sequences or the claimed duplexes. Applicant argues that the rejection provides no further rational and relies on the same hindsight reconstruction as the 103 rejection, and the combination of Soutschek, Maier, and NCBI Ref NM_012235.1 provides no teaching or suggestion for a skilled artisan to select the particular modified SCAP-targeting sequences recited in the amended claims with a reasonable expectation of achieving the demonstrated SCAP inhibitory activity. This is not found persuasive. The response to the same arguments has been provided above. The examiner cited teachings and motivations from the cited references regarding specific modifications at specific locations and positions (Office Action, pages 14-16,18,21,25) for one of ordinary skill in the art to arrive at the instant claims with a reasonable expectation of success. Conclusion Claims 1,3-5,12,13,15,16,26,29,30,33 and 42 are rejected. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Nov 30, 2021
Application Filed
Feb 27, 2026
Non-Final Rejection mailed — §103, §DP
May 27, 2026
Response Filed
Aug 03, 2026
Final Rejection mailed — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735701
TRANS-SPLICING RIBOZYME SPECIFIC TO APOE4 RNA AND USE THEREOF
4y 8m to grant Granted Sep 15, 2026
Patent 12655432
OLIGONUCLEOTIDES FOR SOD1 MODULATION
3y 7m to grant Granted Jun 16, 2026
Patent 12655461
BIOSENSORS FOR SELECTIVELY IDENTIFYING AZIDE IONS
3y 6m to grant Granted Jun 16, 2026
Patent 12649939
NOVEL PROCESSES FOR THE PRODUCTION OF OLIGONUCLEOTIDES
6y 0m to grant Granted Jun 09, 2026
Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
3y 4m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+40.9%)
3y 7m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 74 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month