Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Claims 7-9, 11, 13-18, 21-22, 24-25, 27, 30-51, and 53-120 are canceled. Claims 125 and 126 are new. Claims 1-6, 10, 12, 19-20, 23, 26, 28-29, 52 and 121-126 are pending and under consideration in this action.
Response to Amendment
The amendment filed 08/20/2025 is entered.
The § 112(b) rejection of claim 52 is withdrawn in light of the amendment.
The § 103 rejection of claims 1-6, 10, 12-13, 19-20, 23, 26, 28, and 121-123 over Oestergaard in view of Leanna with evidence from Tosoh is withdrawn in light of the amendment. However, a new rejection necessitated by amendment is discussed below.
The § 103 rejection of claim 14 over Oestergaard, Leanna and Sugo is obviated because the claim is canceled.
The § 103 rejection of claim 29 over Oestergaard in view of Nadkarni is withdrawn in light of the amendment. However, a new rejection necessitated by amendment is discussed below.
The § 103 rejection of claims 52 and 124 over Oestergaard, Leanna and Nadkarni is withdrawn in light of the amendment. However, a new rejection necessitated by amendment is discussed below.
Applicants' amendments and arguments filed on 08/20/2025 have been fully considered. Rejections and/or objections not reiterated from previous office actions are hereby withdrawn. The following rejections and/or objections are either reiterated or newly applied. They constitute the complete set presently being applied to the instant application.
Priority
Applicant's claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
The disclosure of the prior-filed applications, provisional applications 62/992,187 (filed 3/20/20) and 62/858964 (filed 06/07/19) and the PCT/US2020/036307 (filed 06/05/2020), fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The claims now require an antibody that is a Fab fragment of an anti-transferrin antibody fragment, which is not supported in any priority document.
Accordingly, claims 1-6, 10, 12, 19-20, 23, 26, 28-29, 52 and 121-126 are entitled to an effective filing date of 12/06/2021.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
(New rejection necessitated by amendment) Claims 1-6, 10, 12, 19-20, 23, 26, 28-29, 52 and 121-126 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The amendment filed on 08/20/2025 has introduced NEW MATTER into the claims.
Claim 1, as filed on 08/20/2025, recites a method of isolating a complex or plurality of complexes each comprising an antibody covalently linked to one or more oligonucleotides, wherein the antibody is a Fab fragment of an anti-transferrin antibody, wherein the one or more oligonucleotides comprise at least one modified internucleotide linkage, wherein the at least one modified internucleotide linkage is a phosphorothioate linkage, and wherein the one or more oligonucleotides is a gapmer, the method comprising:(i) contacting a mixture comprising the complex or plurality of complexes and unlinked antibodies with a hydrophobic resin under conditions in which the complex or plurality of complexes but not the unlinked antibodies adsorb to the hydrophobic resin, thus separating the unlinked antibodies from the complex or plurality of complexes adsorbed to the hydrophobic resin; and (ii) eluting the complex or plurality of complexes from the hydrophobic resin under conditions in which the complex or plurality of complexes dissociate from the hydrophobic resin.
Claim 29, as filed on 08/20/2025, recites a method of isolating a complex or plurality of complexes each comprising an antibody covalently linked to one or more oligonucleotides, wherein the antibody is a Fab fragment of an anti-transferrin antibody, wherein the one or more oligonucleotides comprise at least one modified internucleotide linkage, wherein the at least one modified internucleotide linkage is a phosphorothioate linkage, and wherein the one or more oligonucleotides is a gapmer, the method comprising: (i) contacting a mixture comprising the complex or plurality of complexes and unlinked oligonucleotides with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complex or plurality of complexes adsorb to the mixed-mode resin, and (ii) eluting the complex or plurality of complexes from the mixed-mode resin under conditions in which the complex or plurality of complexes dissociate from the mixed-mode resin.
Claim 52, as filed on 08/20/2025, recites a method of isolating a complex or plurality of complexes each comprising an antibody covalently linked to one or more oligonucleotides, wherein the antibody is a Fab fragment of an anti-transferrin antibody, wherein the one or more oligonucleotides comprise at least one modified internucleotide linkage, wherein the at least one modified internucleotide linkage is a phosphorothioate linkage, and wherein the one or more oligonucleotides is a gapmer, the method comprising: (i) contacting a first mixture comprising the complex or plurality of complexes, unlinked antibodies, and unlinked oligonucleotides with a hydrophobic resin under conditions in which the complex or plurality of complexes and the unlinked oligonucleotides but not the unlinked antibodies adsorb to the hydrophobic resin, thus separating the unlinked antibodies from the complex or plurality of complexes and the unlinked oligonucleotides adsorbed to the hydrophobic resin; (ii) obtaining a second mixture comprising the complex or plurality of complexes and the unlinked oligonucleotides by eluting the complex or plurality of complexes and the unlinked oligonucleotides from the hydrophobic resin under conditions in which the complex or plurality of complexes dissociate from the hydrophobic resin; (iii) contacting the second mixture obtained in step (ii) with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complex or plurality of complexes adsorb to the mixed-mode resin, and (iv) eluting the complex or plurality of complexes from the mixed-mode resin under conditions in which the complex or plurality of complexes dissociate from the mixed-mode resin.
Claims 1-6, 10, 12, 19-20, 23, 26, 28-29, 52 and 121-126 contain(s) new matter because of the limitation requiring the antibody to be a Fab fragment of an anti-transferrin antibody.
Claim 125, as filed on 08/20/2025, recites the method of claim 1, wherein the one or more oligonucleotides is covalently linked to the antibody via a lysine residue of the antibody.
Claim 125 contains new matter because of the limitation requiring the one or more oligonucleotides to be covalently linked to the antibody via a lysine residue of the antibody; wherein the antibody is a Fab fragment of an anti-transferrin antibody, wherein the one or more oligonucleotides comprise at least one modified internucleotide linkage, wherein the at least one modified internucleotide linkage is a phosphorothioate linkage, and wherein the one or more oligonucleotides is a gapmer.
Applicant’s amendment, filed 08/20/2025, directs to support for amended claims 1, 29 and 52 to paragraphs [0014], [0027], and [0037] of the specification filed 12/06/2021 and original claims 13 and 14. Furthermore, Applicant directs support for new claim 125 to paragraph [00113]. Applicant asserts that no new matter has been added. See the first paragraph on page 7 of the remarks filed 08/20/2025. However, the specification and the original claims do not provide sufficient written description of the above underlined limitations.
The specification as filed and the original claims do not provide support for the above underlined limitations in claims 1, 29 and 52. The instant specification teaches some embodiments in which the antibody is an anti-transferrin receptor antibody (e.g., any of the anti-transferrin receptor antibodies listed in Table 2) or any antigen binding fragments thereof (e.g., a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a scFv, or a Fv fragment). See [00106] and table 2 spanning pages 49-51. The transferrin receptor antibodies described in the disclosure can be in any antibody form, including, but not limited to, intact (i.e., full-length) antibodies, antigen-binding fragments thereof (such as Fab, Fab', F(ab')2, Fv), single chain antibodies, bi-specific antibodies, or nanobodies. See [00106] and [00246]. Furthermore, original claim 14, filed 12/06/2021, recites a method of any one of claims 1-13, wherein the antibody is an anti-transferrin receptor antibody; and claim 13 recites wherein the antibody is a full length IgG, a Fab fragment, a Fab’ fragment, a F(ab’)2 fragment, a scFv, or a Fv fragment. Thus, the specification and the original filed claims provide support for a Fab fragment of an anti-transferrin receptor antibody. However, the instant anti-transferrin antibody is not limited to an anti-transferrin receptor antibody, and encompasses any anti-transferrin antibody. The specification also describes separate antibody embodiments, where in some embodiments, the antibody is a full length IgG, a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a scFv, or a Fv fragment; and in some embodiments, the antibody is an anti-transferrin receptor antibody. See [0014], [0027], and [0037]. However, this description does not support a single embodiment in which the antibody is a Fab fragment of an anti-transferrin receptor antibody, nor does it provide support for the instantly claimed embodiment where the antibody is a Fab fragment of any anti-transferrin antibody.
The specification as filed and the original claims do not provide support for the above underlined limitation in claim 125. The specification teaches some embodiments in which the oligonucleotide is covalently linked to the antibody via a lysine or a cysteine. See [00113]. However, this description does not provide support for the instantly claimed embodiment in which the lysine is of the antibody; and wherein the antibody is a Fab fragment of an anti-transferrin antibody. The specification teaches an embodiment in which a linker is connected to a muscle-targeting agent via conjugation to a lysine residue or a cysteine residue of the muscle-targeting agent. See [00349]-[00350]. The specification indicates that the muscle-targeting agent may be a transferrin receptor antibody. See [00203]. Thus, the specification indicates that a lysine residue of an anti-transferrin receptor antibody may be conjugated to a linker. Yet, the specification is silent regarding a covalent linkage between the lysine residue of a Fab fragment of an anti-transferrin antibody and one or more oligonucleotides, as claimed. Furthermore, the specification does not disclose a sequence of a Fab fragment of an anti-transferrin antibody, as to identify any lysine residues therein. The closest relevant sequences can be found in paragraphs [00182]-[00186], which include sequences to which the anti-transferrin receptor antibody may bind.
Such limitations recited in the instant claims 1, 29, 52, and 125 which did not appear in the specification or original claims, as filed, introduce new concepts and violate the description requirement of the first paragraph of 35 U.S.C 112. Applicant is required to provide sufficient written support for the limitations recited in the instant claims. Applicant can remove the new matter limitations from the claims to obviate this rejection.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
(New rejection necessitated by amendment) Claims 1-6, 10, 19-20, 23, 26, 121-123 and 125-126 are rejected under 35 U.S.C. 103 as being unpatentable over Subramanian WO 2020/028864 (as cited in the IDS filed 03/09/2022) in view of Leanna US 2014/0286968. As set forth above, the instant claims are entitled to the priority date of 12/06/2021, such that Subramanian now constitutes as prior art.
Regarding claim 1, Subramanian teaches a complex comprising a muscle-targeting agent covalently linked to a molecular payload configured for inhibiting expression or activity of DUX4, wherein the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. See claim 1. The muscle-targeting agent is a muscle-targeting antibody that specifically binds to an extracellular epitope of a transferrin receptor. See claims 2-3. The muscle-targeting antibody is in the form of a scFv, Fab fragment, Fab’ fragment, F(ab’)2 fragment or Fv fragment. See claim 14. The molecular payload is an oligonucleotide. See claim 15. The oligonucleotide comprises at least one modified internucleotide linkage that is a phosphorothioate linkage. See claims 28-29. The oligonucleotide is a gapmer oligonucleotide that directs RNAse H-mediated cleavage of the DUX4 mRNA transcript in a cell. See claim 34. Thus, Subramarian teaches a complex comprising a Fab fragment of an antibody that binds to a transferrin receptor (e.g. anti-transferrin receptor antibody) and a gapmer oligonucleotide comprising phosphorothioate linkages. In example 5, Subramarian teaches generating an antisense oligonucleotide that targets a mutant allele of DUX4 covalently linked via a cathepsin cleavable linker to DTX-A-002 (R17 217 (Fab)), an anti-transferrin receptor antibody. See [000291]. The product of the antibody coupling reaction is then subjected to hydrophobic interaction chromatography to purify the muscle-targeting complex. See [000293]. Subramarian teaches antibodies that can be linked to oligonucleotides with different stoichiometries, a property that may be referred to as a drug to antibody ratio (DAR), e.g. one oligonucleotide linked to an antibody is DAR=1. In some embodiments, a mixture of different complexes, each having a different DAR is provided. See [00245].
Subramarian teaches does not explicitly teach (i) contacting the mixture comprising the complex or plurality of complexes and unlinked antibodies with a hydrophobic resin under conditions in which the complex or plurality of complexes but not the unlinked antibodies adsorb to the hydrophobic resin, thus separating the unlinked antibodies from the complex or plurality of complexes adsorbed to the hydrophobic resin.
Subramarian does not explicitly teach (ii) eluting the complex or plurality of complexes from the hydrophobic resin under conditions in which the complex or plurality of complexes dissociate from the hydrophobic resin.
Leanna teaches contacting an antibody drug conjugate (ADC) mixture comprising a drug loaded species of 4 or less (e.g. an unlinked antibody with 0 drug loaded species) and a drug loaded species of 6 or more (e.g. antibody-drug complex) with a hydrophobic resin, wherein the amount of hydrophobic resin contacted with the ADC mixture is sufficient to allow binding of the drug loaded species of 6 or more to the resin but does not allow significant binding of the drug loaded species of 4 or less (e.g. unlinked antibody). See claim 1. Leanna discloses that the term “antibody-drug-conjugate” or ADC refers to a binding protein, such as an antibody binding fragment, chemically linked to one or more chemical drugs that may be therapeutic or cytotoxic agents. Examples of drugs include oligonucleotides. See [0030]. Leanna teaches contacting the ADC mixture with hydrophobic resin so that the specific species of ADCs adsorb to the hydrophobic resin for separation. See paragraphs [0051-0052, 0056]. In order to elute bound ADCs, the salt concentration of the one or more washes can be decreased [0056]. Furthermore, resin may be washed with a plurality of washes having decreasing conductivity to recover ACDs with drug to antibody ratios of interest, such that an elution material is obtained [0062]. In example 2, Leanna teaches preforming hydrophobic interaction chromatography-high-performance liquid chromatography (HIC-HPLC) to separate various ADC species, including an antibody alone/unconjugated (%mAb) and ADCs having a 2 or 4 drug to antibody ratio (DAR) [0177-0181]. Thus, Leanna teaches a method of isolating an ADC complex or plurality of ADC complexes each comprising an antibody and a drug, such as an oligonucleotide, the method comprising: (i) contacting a mixture comprising ADC complexes and alone/unconjugated (i.e. unlinked) antibodies with a hydrophobic resin under conditions (e.g. the amount of hydrophobic resin) in which the ADC complexes but not the unconjugated antibodies adsorb to the hydrophobic resin, thus separating the unlinked antibodies from the ADC complexes adsorbed to the hydrophobic resin, (ii) eluting (e.g. by HPLC and/or a wash) the complexes from the hydrophobic resin under salinity or conductivity conditions in which the complexes dissociate from the hydrophobic resin.
It would have been obvious to a person of ordinary skill in the art prior to the effective filing date of the instantly claimed invention to apply the isolation method of Leanne to the mixture of different complexes taught by Subramarian. Doing so is merely the application of a known technique. One would be motivated to do so because Subramarian suggests using hydrophobic interaction chromatography to purify the muscle-targeting complex; and Leanne teaches HIC-HPLC. There would be a reasonable expectation of success because Leanne demonstrates performing the HIC-HPLC on ADCs with different DARs.
Regarding claim 2, Leanna teaches decreasing conductivity to recover ADCs having drug to antibody ratios (DAR) of interest [0062]. For example, Leanna teaches washing a resin bed to remove (e.g. elute) residual unbound lower DAR species while leaving high DAR species bound to the resin. Specifically, the resin bed is washed with 1 N NaCl (95 mS), then 0.75 N NaCl (71 mS) [0320].
Subramarian and Leanna do not teach mS per centimeter.
It would have been obvious to a person of ordinary skill in the art prior to the effective filing date of the instantly claimed invention to optimize the conductivity per centimeter. Doing so is mere optimization through routine experimentation. One would be motivated to optimize the conductivity per centimeter because Leanna suggests that conductivity affects ADC recovery (e.g. elution). There would be a reasonable expectation of success because Leanna demonstrates contacting a mixture comprising high DAR species (e.g. ADC complexes) and lower DAR species (e.g. unlinked antibodies) with hydrophobic resin under 95 mS and 71 mS conditions, such that the high DAR species but not the low DAR species bind to the resin. MPEP 2144.05(II) indicates that “[w]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
Regarding claim 3, Leanna discloses that the selectivity of the resin for ADCs may be impacted by the ionic strength of the resin mixture. Generally by decreasing the ionic strength of the resin mixture, the hydrophobic resin will be less adsorbent, whereas an increase in the ionic strength of the resin mixture will provide more adsorbent resin. Adsorption of ADCs to hydrophobic resin is favored by high salt concentrations. Salts that may be formulated to influence the strength of the interaction include (NH4)2SO4 (i.e. ammonium sulfate). See paragraph [0066]. Thus, Leanna teaches contacting ADCs with hydrophobic resins under high salt concentrations, wherein the salt may be the anti-chaotropic salt ammonium sulfate.
Regarding claim 4, Leanna suggests that the ionic strength of the ADC may be adjusted prior to, concurrently with, or following the addition of the hydrophobic resin. In general, salt concentrations between about 0.75 (i.e. 750mM) and about 2 M ammonium sulfate are useful [0066]. For example, Leanna teaches preparing a sample of with crude antibody 1-vcMMae (e.g. an ADC with an antibody, valine citrulline linker and MMae drug) with buffer A, which is disclosed as having 1.5 M (NH4)2SO4 ammonium sulfate. See paragraphs [0177-0179]. Thus, Leanna suggests using an ADC mixture comprising 750mM-2000mM ammonium sulfate, e.g. 1500 mM, which overlaps with the instantly claimed at least 500 mM of ammonium sulfate range.
Regarding claim 5, Leanna teaches washing a resin bed numerous times to remove residual unbound ADCs with lower drug antibody ratios while leaving the ADC species with high drug antibody ratios bound to the resin. Specifically, the resin bed is washed with a 1200 mL solution comprising 2M (i.e. 2000 mM) NaCl [0320]. Leanna discloses that the first wash provides about a 10% recovery [0321]. Leanna suggests that in general salt concentrations between about 0.75 and about 2 M ammonium sulfate or between about 1 and 4 NaCl are useful [0066]. Thus, Leanna teaches washing the hydrophobic resin with a solution comprising 2 M salt, which is at least 500 mM; and the washing step of Leanna occurs between an ADC mixture and hydrophobic resin contact step and an ADC elution step.
Subramarian and Leanna do not teach washing the hydrophobic resin with ammonium sulfate.
It would have been obvious to a person of ordinary skill in the art prior to the effective filing date of the instantly claimed invention to replace the NaCl within the wash of Leanna with ammonium sulfate. One would be motivated to do so because Leanna suggests that NH4 sulfates effectively promote ligand-protein interaction in hydrophobic resin [0066]. There would be a reasonable expectation of success because Leanna demonstrates washing hydrophobic resin with a NaCl salt solution, and Leanna suggests that NaCl and ammonium sulfate are interchangeable.
Regarding claim 6, Leanna teaches purifying an ADC solution (e.g. via HIC) then subjecting the purified ADC solution to ultrafiltration/diafiltration and a final buffer exchange [0192]. HIC resin is combined with phosphate buffer and the slurry is filtered and washed with buffer A (e.g. elution solution). The resulting filtrate and rinses are combined and a purified Antibody 1-Val-Cit-MMAE (e.g. ADC complex) is yielded [0194]. Buffer A includes 2M NaCl [0173] and 1.5 M (NH4)2SO4, i.e. ammonium sulfate [0177]. Thus, Leanna teaches applying a Buffer A elution solution comprising 2000mM NaCl and 1500mM ammonium sulfate to the hydrophobic resin to elute ADC complexes.
Subramarian and Leanna do not teach an elution solution comprising up to 200 mM of chloride ions and up to 100 mM of ammonium sulfate to the hydrophobic resin.
It would have been obvious to a person of ordinary skill in the art prior to the effective filing date of the instantly claimed invention to optimize the amount of chloride ions and ammonium sulfate in the buffer A elution solution of Leanna by adjusting the concentrations of NaCl and (NH4)2SO4. Doing so is merely optimizing through routine experimentation. One would be motivated to optimize the amount of chloride ions and ammonium sulfate in the buffer A elution solution because Leanna suggests that by decreasing the ionic strength the hydrophobic resin will be less adsorbent, e.g. more elution (see [0066]). Furthermore, Leanna suggests that salts may be formulated to influence the strength of the interaction between the ADC mixture and the hydrophobic resin [0066]. There would be a reasonable expectation of success because Leanna demonstrates applying buffer A comprising chloride ions and ammonium sulfate to a hydrophobic resin to yield eluted ADC complexes. MPEP 2144.05(II) indicates that differences in concentration generally amount to “routine optimization” and will not support patentability unless there is evidence indicating the claimed feature is critical. “Where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
Regarding claim 10, Leanna teaches performing a hydrophobic interaction chromatography HPLC using an TSKgel Butyl-NPR column (e.g. hydrophobic resin), and a linear gradient from 100% buffer A comprising 1.5 M (NH4)2SO4 (i.e. ammonium sulfate) to 100% buffer B in 12 min [0177]. Buffer B is not disclosed as having any ammonium sulfate. Evidentiary reference Tosoh provides support that TSKgel Butyl-NPR column includes hydrophobic resin. Therefore, Leanna teaches applying a gradually decreasing concentration of ammonium sulfate to the hydrophobic resin to elute the ADC complexes.
Regarding claim 19, Subramarian teaches an oligonucleotide that may comprise one or more modified nucleotides. In some embodiments, a modified nucleotide is a 2’-fluoro, or locked nucleic acid (LNA) nucleotides. See [0015] and claim 43.
Regarding claim 20, Subramarian teaches an oligonucleotide that comprises at least 15 consecutive nucleotides of SEQ ID NO: 45 (GGGCATTTTAATATATCTCTGAACT), which overlaps with the instantly claimed 10-50 nucleotides in length range. See claim 16.
Regarding claim 23, Subramarian teaches a complex comprising a transferrin receptor antibody covalently linked to an oligonucleotide via a val-cit linker. See [000244].
Regarding claim 26, Leanna teaches a hydrophobic resin that may be prepared in or equilibrated to the desired equilibration buffer [0056].
Regarding claim 121, Leanna suggests that the ionic strength of the ADC may be adjusted prior to, concurrently with, or following the addition of the hydrophobic resin. In general, salt concentrations between about 0.75 (i.e. 750mM) and about 2 M ammonium sulfate are useful [0066]. For example, Leanna teaches preparing a sample of with crude antibody 1-vcMMae (e.g. an ADC with an antibody, valine citrulline linker and MMae drug) with buffer A, which is disclosed as having 1.5 M (NH4)2SO4 ammonium sulfate. See paragraphs [0177-0179]. Thus, Leanna suggests using an ADC mixture comprising 750mM-2000mM ammonium sulfate, e.g. 1500 mM, which overlaps with the instantly claimed 500 mM- 1 M of ammonium sulfate range.
Regarding claim 122, Leanna teaches purifying an ADC solution (e.g. via HIC) then subjecting the purified ADC solution to ultrafiltration/diafiltration and a final buffer exchange [0192]. HIC resin is combined with phosphate buffer and the slurry is filtered and washed with buffer A (e.g. elution solution). The resulting filtrate and rinses are combined and a purified Antibody 1-Val-Cit-MMAE (e.g. ADC complex) is yielded [0194]. Buffer A includes 2M NaCl [0173] and 1.5 M (NH4)2SO4, i.e. ammonium sulfate [0177]. Thus, Leanna teaches applying a Buffer A elution solution comprising 2000mM NaCl and 1500mM ammonium sulfate to the hydrophobic resin to elute ADC complexes. Leanna teaches that in order to elute bound ADCs the salt concentration can be decreased. See paragraph [0056]. Moreover, Leanna teaches ionic strength, which refers to the measure of the concentration of ions in a solution. Exemplary salts that may be used to modulate the ionic strength of a solution include sodium chloride. Those skilled in the art appreciate that both the anion and the cation can be varied, as long as sufficient ionic strength is provided without precipitation or other undesired side-effects. See paragraph [0037].
Leanna does not teach an elution solution that comprises up to 25 mM chloride ions.
It would have been obvious to a person of ordinary skill in the art prior to the effective filing date of the instantly claimed invention to optimize the ionic strength of buffer A by adjusting the NaCl (e.g. chloride ions) concentration. One would be motivated to do so because Leanna suggests decreasing salt concentration to elute bound ADC. There would be a reasonable expectation of success because Leanna demonstrates eluting ADCs with buffer A, which includes NaCl. MPEP 2144.05(II) indicates that differences in concentration generally amount to “routine optimization” and will not support patentability unless there is evidence indicating the claimed feature is critical. “Where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
Regarding claim 123, Leanna teaches purifying an ADC solution (e.g. via HIC) then subjecting the purified ADC solution to ultrafiltration/diafiltration and a final buffer exchange [0192]. HIC resin is combined with phosphate buffer and the slurry is filtered and washed with buffer A (e.g. elution solution). See paragraph [00194]. Buffer A is prepared with K2HPO4 and NaCl [0173]. Moreover, Leanna teaches ionic strength, which refers to the measure of the concentration of ions in a solution. Exemplary salts that may be used to modulate the ionic strength of a solution include sodium chloride and phosphoric acid, KH2PO4. Those skilled in the art appreciate that both the anion and the cation can be varied, as long as sufficient ionic strength is provided without precipitation or other undesired side-effects. See paragraph [0037]. Thus, Leanna indicates that ions from NaCl (e.g. Cl, chloride ions) and KH2PO4 (e.g. PO4 , phosphate ions) are present in buffer A because the salts contribute to the ionic strength.
Regarding claim 125, Subramarian teaches a muscle-targeting antibody that is covalently linked to the oligonucleotide via conjugation to a lysine residue or a cysteine residue of the antibody. See claim 57.
Regarding claim 126, Subramarian teaches a linker is connected to a muscle-targeting agent and/or molecular payload by a cycloaddition reaction between an azide and an alkyne to form a triazole, wherein the azide and the alkyne may be located on the muscle-targeting agent, molecular payload, or the linker. In some embodiments, an alkyne may be a cyclic alkyne, e.g., a cyclooctyne. In some embodiments, an alkyne may be bicyclononyne (also known as bicyclo[6. l.0]nonyne or BCN) or substituted bicyclononyne. See [000239].
(New rejection necessitated by amendment) Claim 29 is rejected under 35 U.S.C. 103 as being unpatentable over Subramanian WO 2020/028864 and Nadkarni WO 2017/109619.
Regarding claim 29, Subramanian teaches a complex comprising a muscle-targeting agent covalently linked to a molecular payload configured for inhibiting expression or activity of DUX4, wherein the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. See claim 1. The muscle-targeting agent is a muscle-targeting antibody that specifically binds to an extracellular epitope of a transferrin receptor. See claims 2-3. The muscle-targeting antibody is in the form of a scFv, Fab fragment, Fab’ fragment, F(ab’)2 fragment or Fv fragment. See claim 14. The molecular payload is an oligonucleotide. See claim 15. The oligonucleotide comprises at least one modified internucleotide linkage that is a phosphorothioate linkage. See claims 28-29. The oligonucleotide is a gapmer oligonucleotide that directs RNAse H-mediated cleavage of the DUX4 mRNA transcript in a cell. See claim 34. Subramarian teaches a mixture of different complexes, each having a different DAR is provided. See [00245].
Subramanian does not teach (i) contacting a mixture comprising the complex or plurality of complexes and unlinked oligonucleotides with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complex or plurality of complexes adsorb to the mixed-mode resin, and
Subramanian does not teach (ii) eluting the complex or plurality of complexes from the mixed-mode resin under conditions in which the complex or plurality of complexes dissociate from the mixed-mode resin.
Nadkarni suggests that common chromatographic purification methods present technical difficulties in the separation of aggregated or multimeric species of antibodies and antibody drug conjugates. See the first paragraph on page 2. Nadkarni teaches a method for purifying antibody drug conjugates, where the drug may be selected from a list that includes oligonucleotide. See claim 1 and page 10 lines 7-8, page 11 line 3 and page 15 line 18. Nadkarni teaches contacting an ADC preparation to a hydroxyapatite resin and washing the mixture, such that small molecule impurities like unconjugated free drug are removed from the ADC mixture. ADCs may be eluted from the column after a washing procedure. For elution of the ADC, a higher ionic strength phosphate buffer is used. See the second full paragraph on page 22. Hydroxyapatite resin has functional groups that consist of positively charged calcium ions and negatively charged phosphate groups. See lines 13-18 on page 3. Thus, Nadkarni teaches contacting a mixture comprising ADC complexes and unlinked drugs with mixed-mode hydroxyapatite resin that comprises positively charged metal site and negatively charged ionic sites, under wash conditions in which the complexes adsorb to the mixed-mode resin and eluting the complexes from the mixed-mode hydroxyapatite resin under higher ionic strength conditions in which the ADC complexes dissociate from the resin.
It would have been obvious to a person of ordinary skill in the art prior to the effective filing date of the instantly claimed invention to apply the purification technique of Nadkarni to the mixture of Subramarian. One would be motivated to do so because Nadkarni suggests that common chromatographic methods may present technical difficulties. There would be a reasonable expectation of success because Nadkarni suggests that the method is useful for purifying antibody drug conjugates, wherein the drug may be selected from a list that includes oligonucleotides.
(New rejection necessitated by amendment) Claims 52 and 124 are rejected under 35 U.S.C. 103 as being unpatentable over Subramanian WO 2020/028864 in view of Leanna US 2014/0286968 and Nadkarni WO 2017/109619.
Regarding claim 52, Subramanian teaches a complex comprising a muscle-targeting agent covalently linked to a molecular payload configured for inhibiting expression or activity of DUX4, wherein the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. See claim 1. The muscle-targeting agent is a muscle-targeting antibody that specifically binds to an extracellular epitope of a transferrin receptor. See claims 2-3. The muscle-targeting antibody may be a Fab fragment. See claim 14. The molecular payload is an oligonucleotide that comprises at least one modified internucleotide linkage that is a phosphorothioate linkage. See claims 15 and 28-29. The oligonucleotide is a gapmer. See claim 34. Subramarian teaches a mixture of different complexes, each having a different DAR is provided. See [00245].
Subramanian does not teach (i) contacting a first mixture comprising the complex or plurality of complexes, unlinked antibodies, and unlinked oligonucleotides with a hydrophobic resin under conditions in which the complex or plurality of complexes and the unlinked oligonucleotides but not the unlinked antibodies adsorb to the hydrophobic resin, thus separating the unlinked antibodies from the complex or plurality of complexes and the unlinked oligonucleotides adsorbed to the hydrophobic resin;
Subramanian does not teach (ii) obtaining a second mixture comprising the complex or plurality of complexes and the unlinked oligonucleotides by eluting the complex or plurality of complexes and the unlinked oligonucleotides from the hydrophobic resin under conditions in which the complex or plurality of complexes dissociate from the hydrophobic resin;
Subramanian does not teach (iii) contacting the second mixture obtained in step (ii) with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complex or plurality of complexes adsorb to the mixed-mode resin;
Subramanian does not teach (iv) eluting the complex or plurality of complexes from the mixed-mode resin under conditions in which the complex or plurality of complexes dissociate from the mixed-mode resin.
Leanna teaches purifying ADCs by contacting an ADC mixture with a hydrophobic resin [0051-0052], such that the specific species of ADCs to be separated are adsorbed [0056]. Leanna suggests that by decreasing the ionic strength, the hydrophobic resin will be less adsorbent, whereas an increase in the ionic strength of the resin mixture will provide a more adsorbent resin. Adsorption of ADCs to hydrophobic resin is favored by high salt concentrations [0066]. In example 2, Leanna teaches preforming hydrophobic interaction chromatography-high-performance liquid chromatography (HIC-HPLC) to separate (i.e. elute) various ADC species, including an antibody alone/unconjugated (%mAb) and ADCs having a 2 or 4 drug to antibody ratio (DAR) [0177-0181]. In example 7, Leanna teaches a batch purification using HIC-HPLC. Leanna discloses that the ADCs with a drug to antibody ratio (DAR) of 0 (i.e. unlinked antibodies) elute at 6.4 minutes, as compared to ADCs with a DAR of 1, which elutes at 7.2 minutes. See [0314] and table 11. Thus, Leanna indicates that after 6.4 minutes unlinked antibodies are not adsorbed to the hydrophobic resin, as compared to the ADC complex which is adsorbed to the hydrophobic resin until 7.2 minutes. Leanna discloses that in order to elute bound ADCs the salt concentration can be decreased. See [0056]. In summation, Leanna teaches contacting a mixture comprising ADC complexes and unlinked antibodies with a hydrophobic resin and conditions in which the ADC complex but not the unlinked antibodies are adsorbed to the hydrophobic resin in the HIC-HPLC (relevant to instant part i); and Leanna teaches eluting complexes from hydrophobic resin under decreasing salinity conditions in which the complexes dissociate from the hydrophobic resin, such that a second mixture comprising the ADC complex is obtained (relevant to instant part ii).
Subramanian and Leanna do not teach contacting a mixture comprising unlinked oligonucleotides with hydrophobic resin under conditions in which the unlinked oligonucleotides adsorb to the hydrophobic resin (relevant to i).
Subramanian and Leanna do not teach obtaining a second mixture comprising an unlinked oligonucleotide by eluting the unlinked oligonucleotides from the hydrophobic resin under conditions in which the unlinked oligonucleotide dissociate from the hydrophobic resin (relevant to instant ii) .
Subramanian and Leanna do not teach (iii) contacting the second mixture obtained from step (ii) with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites under conditions in which the complex or plurality of complexes adsorb to the mixed-mode resin.
Subramanian and Leanna do not teach (iv) eluting from the mixed-mode resin under conditions in which the complexes dissociate from the mixed mode resin.
Nadkarni suggests that hydrophobic interaction chromatography (HIC) may present technical difficulties in separating aggregated or multimeric species of antibody drug conjugates; as HIC may induce the formation of aggregates during purification. See the first paragraph on page 2. Nadkarni suggests that hydroxyapatite can be used in combination with other purification techniques, such as hydrophobic interaction chromatography (see paragraph 1 on page 23). For example, steps preceding the hydroxyapatite chromatography may be desirable to reduce the load challenge of the contaminants or impurities (first paragraph page 23). Nadkarni teaches contacting an ADC preparation to a hydroxyapatite resin and washing the mixture, such that small molecule impurities like unconjugated free drug (e.g. unlinked oligonucleotides) are removed from the ADC mixture. ADCs may be eluted from the column after a washing procedure. For elution of the ADC, a higher ionic strength phosphate buffer is used. See the second full paragraph on page 22. Thus, Nadkarni teaches (iii) contacting a mixture comprising ADC complexes and unconjugated drugs (e.g. unlinked oligonucleotides) with mixed-mode hydroxyapatite resin that comprises positively charged metal site and negatively charged ionic sites, under wash conditions in which the ADC complexes adsorb to the mixed-mode resin and (iv) eluting the complexes from the mixed-mode hydroxyapatite resin under higher ionic strength conditions in which the ADC complexes dissociate from the resin.
It would have been obvious to a person of ordinary skill in the art prior to the effective filing date of the instantly claimed invention to apply the separation techniques of Leanna and Nadkarni to the mixture of Subramarian. One would be motivated to apply the hydrophobic interaction chromatography technique of Leanna to the incubation mixture Subramarian because Leanna suggests that the technique can be used to isolate antibody-oligonucleotide conjugates based on the ratio of the antibody to the oligonucleotide drug. There would be a reasonable expectation of success because Leanna discloses that the method is useful for separating drug loaded species of 4 or less from drug loaded species of 6 or more, and Subramarian suggests that the mixture may include various complexes with different DARs. One would be further motivated to apply the mixed-mode purification method of Nadkarni because Nadkarni suggests that common chromatographic methods may present technical difficulties. There would be a reasonable expectation of success because Nadkarni suggests that hydroxyapatite can be used in combination with other purification techniques, such as hydrophobic interaction chromatography.
Regarding claim 124, Leanna teaches purifying an ADC solution (e.g. via HIC) then subjecting the purified ADC solution to ultrafiltration/diafiltration and a final buffer exchange [0192]. HIC resin is combined with phosphate buffer and the slurry is filtered and washed with buffer A (e.g. elution solution). See paragraph [00194]. Buffer A is prepared with K2HPO4 and NaCl [0173]. Moreover, Leanna teaches ionic strength, which refers to the measure of the concentration of ions in a solution. Exemplary salts that may be used to modulate the ionic strength of a solution include sodium chloride and phosphoric acid, KH2PO4. Those skilled in the art appreciate that both the anion and the cation can be varied, as long as sufficient ionic strength is provided without precipitation or other undesired side-effects. See paragraph [0037]. Thus, Leanna indicates that ions from NaCl (e.g. chloride ions) and KH2PO4 (e.g. PO4 ions) are present in buffer A because the salts contribute to the ionic strength.
(New rejection necessitated by amendment) Claims 1-6, 10, 12, 19-20, 23, 26, 28, and 121-123 are rejected under 35 U.S.C. 103 as being unpatentable over Oestergaard (US 2016/0090598), in view of Leanna US 2014/0286968 and Sugo US 2019/0240346, with evidence from “TSKgel Butyl-NPR.”, TOSOH, Accessed 24 July 2024 (hereafter Tosoh). The underlined text below is relevant to the amendment.
Regarding claim 1, Oestergaard teaches a compound comprising one or more modified oligonucleotides and an anti-CD22 antibody, wherein the one or more modified oligonucleotides comprise: 16 linked nucleosides and wherein each internucleoside linkage is a phosphorothioate linkage. See claim 2. Oestergaard defines the term “anti-CD22 antibody” as including antigen binding fragments of full antibody molecules that specifically bind or interact with CD22. See [0129]. Oestergaard discloses that the one or more modified oligonucleotide consists of ISIS 632461. See claim 5. In example 1, Oestergaard teaches synthesizing oligonucleotide ISIS 632461, which is described as a chimeric oligonucleotide “gapmer” 16 nucleotides in length with phosphorothioate internucleoside linkages. See [0342] and table 1. In example 2, Oestergaard teaches synthesizing antibody-antisense oligonucleotide conjugates. ISIS 632461 is cyclooctyne modified and renamed to ISIS No. 691563. Azide labeled anti-CD22 antibodies (e.g. unlined antibodies) are incubated 1:10 or 1:20 with ISIS 691563 (e.g. a mixture of antibodies and gapmers) to form an antibody-antisense oligonucleotide conjugate, anti-CD22-MXD3 (e.g. antibody-gapmer complex), which is the human MAX Dimerization Protein 3 (MXD3) targeting conjugate comprising a CD22 antibody and ISIS 691563. Excess oligonucleotide is removed. See [0345]-[0346]. MXD3 functions as an anti-apoptotic protein and knockdown of MXD3 can be an effective therapeutic strategy for preB ALL cells. See [0362]. Oestergaard teaches optimizing the biological activity of the conjugates by varying the ratio of the anti-CD22 antibody to the MXD3 antisense oligonucleotide ISIS 691563. The optimal conditions are determined to be 1:20 azide labeled anti-CD22; MXD2 antisense oligonucleotide. Thus, Oestergaard teaches a complex comprising an anti-CD22 antibody linked to 20 ISIS 691563 gapmers; and Oestergaard teaches an incubation mixture comprising the complex, unlinked antibodies and unlinked ISIS 691563 gapmers (i.e. the incubation mixture in paragraph [0346]).
Oestergaard does not teach an antibody that is a Fab fragment of an anti-transferrin antibody.
Oestergaard does not teach (i) contacting the mixture comprising the complex or plurality of complexes and unlinked antibodies with a hydrophobic resin under conditions in which the complex or plurality of complexes but not the unlinked antibodies adsorb to the hydrophobic resin, thus separating the unlinked antibodies from the complex or plurality of complexes adsorbed to the hydrophobic resin.
Oestergaard does not teach (ii) eluting the complex or plurality of complexes from the hydrophobic resin under conditions in which the complex or plurality of complexes dissociate from the hydrophobic resin.
Leanna teaches contacting an antibody drug conjugate (ADC) mixture comprising a drug loaded species of 4 or less (e.g. an unlinked antibody with 0 drug loaded species) and a drug loaded species of 6 or more (e.g. antibody-drug complex) with a hydrophobic resin, wherein the amount of hydrophobic resin contacted with the ADC mixture is sufficient to allow binding of the drug loaded species of 6 or more to the resin but does not allow significant binding of the drug loaded species of 4 or less (e.g. unlinked antibody). See claim 1. Leanna discloses that the term “antibody-drug-conjugate” or ADC refers to a binding protein, such as an antibody binding fragment, chemically linked to one or more chemical drugs that may be therapeutic or cytotoxic agents. Examples of drugs include oligonucleotides. See [0030]. Leanna teaches contacting the ADC mixture with hydrophobic resin so that the specific species of ADCs adsorb to the hydrophobic resin for sep