2048DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election without traverse of group II and the species Alzheimer’s and vasculogenic factor Etv2 in the reply filed on 3/11/25 is acknowledged.
Claims 14-16 and 19-28 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 3/11/25.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 11-13, 17, and 18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of delivering polynucleotides encoding nucleic acid sequences that encode genes to skin cells, does not reasonably provide enablement for a method of delivering any polynucleotides encoding any cargo intracellularly into skin cells with the predictable outcome of delivering the cargo to the brain. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Factors to be considered in a determination of lack of enablement include, but are not limited to:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988)
The instant claims are directed to a method for delivering intracellularly into skin cells of the subject any polynucleotide comprising nucleic acid sequences encoding any cargo with the predictable outcome of delivering the cargo to the brain.
The instant claims are directed to delivering intracellularly into skin cells of the subject a polynucleotide comprising nucleic acid sequences encoding any cargo with predictable delivery to the brain. The intracellular delivery can be in vivo or ex vivo. Delivery of cargo into skin cells intracellularly would not necessarily result in delivery to the brain. Notably, if performed ex vivo, the claims do not require any step of delivering the resultant skin cells in vivo.
Although applicant argues that the skin cells would necessarily travel to the brain, a) the method of loading the cargo is not required to occur in vivo and b) applicant’s example is not representative of delivery of any possible cargo to any skin cell on the human body and a predictable outcome of formulation of an exosome that self-delivers to the brain.
The specification does not draw an adequate nexus between delivery of any cargo and the predictable outcome of formulation of a skin-derived exosome and delivery to the brain.
Therefore, the specification is not enabling for the entire claimed scope.
Additionally, the specification is not enabling for delivery of any cargo intracellularly into skin cells of a subject via any means with the predictable outcome of producing a skin-derived exosome, which appears to be necessary for the instant method. Delivery of any cargo intracellularly to skin does not necessarily and predictably a) produce a skin-derived exosome or b) predictably result in brain delivery.
The specification demonstrates a gene expression profile of specific genes that are upregulated or downregulated in Alzheimer’s disease; and demonstrate that mRNA can be transferred from exosomes in culture in vitro in murine primary neuron cultures. However, the specification does not demonstrate delivery of any possible polynucleotide encoding any possible cargo intracellularly into skin cells with the predictable outcome of producing a skin-derived exosome followed by the predictable migration to the brain.
Chen et al. (Cellular and Molecular Bioengineering, Vol. 9, No. 4, 2016, 509–529) teach that cell-derived exosomes can cross the blood-brain barrier model under stroke-like conditions in vitro, but not under normal conditions. Chen et al. teach that this study encourages further development of engineered exosomes as drug delivery vehicles or tracking tools for treating or monitoring neurological diseases. Chen et al. teach that it is likely that a fraction of the exosomes fuse with lysosomes resulting in their digestion (page 526). Chen et al. teach that a different possible fate of internalized exosomes is the fusion of multivesicular bodies with lysosomes to degrade the exosomes/intraluminal vesicles. Furthermore, different pathways of exosome secretion can differ between different cell types (page 526). Therefore, exosomes are known to be able to cross the blood-brain barrier under certain conditions and not others, supporting the unpredictability of any possible skin-derived exosome necessarily and predictably migrating to the brain, crossing the blood-brain barrier, and treating any possible brain disease, disorder, or injury.
Additionally, Duran-Mota et al. (ACS Biomater.Sci.Eng., 2021,7,4347−4361) teach: gene therapy (such as mRNA therapies) has emerged as a viable option to promote wound healing through modulation of gene expression. However, protecting the genetic cargo from degradation and efficient transfection into primary cells remain significant challenges in the push to clinical translation. Another limiting aspect of current therapies is the lack of sustained release of drugs to match the therapeutic window. Herein, we have developed an injectable, biodegradable and cytocompatible hydrogel-based wound dressing that delivers poly(β-aminoester)s (pBAEs) nanoparticles in a sustained manner over a range of therapeutic windows. We also demonstrate that pBAE nanoparticles, successfully used in previous in vivo studies, protect the mRNA load and efficiently transfect human dermal fibroblasts upon sustained release from the hydrogel wound dressing. This prototype wound dressing technology can enable the development of novel gene therapies for the treatment of chronic wounds (abstract).
Duran-Mota et al. is evidence that cargo can be delivered intracellularly into skin cells in the dermis layer of the skin and have action therein rather than migrating to the brain.
Chong et al. (Journal of Controlled Release1, 66, (2013), 211-219) teach: To be efficacious and widely accepted by physicians and patients, therapeutic siRNAs must access the viable skin layers in a stable and functional form, preferably without painful administration. In this study we explore the use of minimally-invasive steel microneedle devices to effectively deliver siRNA into skin. A simple, yet precise microneedle coating method permitted reproducible loading of siRNA onto individual microneedles. Following recovery from the microneedle surface, lamin A/C siRNA retained full activity, as demonstrated by significant reduction in lamin A/C mRNA levels and reduced lamin A/C protein in HaCaT keratinocyte cells (abstract).
Chong et al. is evidence that cargo can be delivered intracellularly into skin cells and have action therein rather than migrating to the brain.
Even with regards to the elected species of gene, Etv2, the specification is not enabling for delivery of Etv2 intracellularly into skin cells predictably resulting in production of a skin-derived exosome and delivery to the brain. Applicant has not demonstrated that intracellular delivery to any possible skin cell of Etv2 predictably results in Etv2 being loaded into an exosome; and does not demonstrate that said exosome necessarily migrates to the brain.
The specification is not enabling for delivery of any cargo to any skin cell of an individual with any possible brain disease, disorder, or injury with the predictable outcome of delivering the cargo to the brain.
The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of intracellularly delivering to skin cells any polynucleotide encoding any cargo and resulting in production of a skin-derived exosome that is delivered to the brain encompassing in vivo effects.
MPEP 2164.01
Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.
Also, MPEP 2164.01(a)
A conclusion of lack of enablement means that, based on the evidence regarding each of
the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed
invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27
USPQ2d 1510, 1513 (Fed. Cir. 1993).
Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether introduction of any polynucleotide encoding any cargo delivered intracellularly to skin cells ex vivo or in vivo by the broadly disclosed methodologies of the instantly claimed invention, would result in successful production of a skin-derived exosome that ultimately migrates to the brain. Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention.
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)).
Response to Arguments
Applicant argues that identified in the specification the presence of a skin-brain-axis and the implication that this could be exploited to deliver cargo to the brain. Enclosed with this Response is a Declaration under 37 C.F.R. § 1.132 by Dr. Daniel Gallego-Perez ("Gallego-Perez Declaration") providing additional evidence that transgenes expressed in the skin of a subject find their way to the brain. Applicants have proposed that this is due to the existence of skin-derived exosomes that are able to cross the blood-brain-barrier. The Office has not provided a reason to suggest that one of ordinary skill in the art would not be able to take advantage of this skin-brain-axis with any cargo capable of being expressed by a transgene with a reasonable expectation of success.
The instant specification, nor the declaration, are enabling for delivery of a polynucleotide encoding any possible cargo (i.e. any siRNA, any transcription factor, etc.) to the skin intracellularly via any means and the predictable outcome of delivery to the brain.
The opinion declaration filed by Daniel Gallego-Perez demonstrates expression in the brain of specific human genes from grafted skin in mice, which is not commensurate in scope with delivering any possible cargo to the brain via intracellular delivery into skin cells ex vivo or in vivo with the predictable result of delivery to the brain.
Although applicant argues that the Office has not provided a reason to suggest that one of ordinary skill in the art would not be able to take advantage of this skin-brain-axis with any cargo capable of being expressed by a transgene with a reasonable expectation of success, the examiner cited art demonstrating that delivery of polynucleotides to skin cells often results in effective action therein within the skin cell rather than predicable migration to the brain, which is known to have delivery challenges.
Although applicant argues that the skin cells would necessarily travel to the brain, a) the method of loading the cargo is not required to occur in vivo and b) applicant’s example is not representative of delivery of any possible cargo to any skin cell on the human body and a predictable outcome of formulation of an exosome that self-delivers to the brain.
Although applicant has argued that the instant claims are based on the discovery that skin naturally dispatches signals to the brain in the form or skin-derived exosomes, applicant has not demonstrated that any cargo delivered into any skin cell on the human body would necessarily dispatch signals to the brain to form a skin-derived exosome and that the exosome would predictably migrate to the brain.
Applicant sets forth that for example, exosomes derived from the skin of Alzheimer's Disease (AD) subjects contain neurotoxic cargo that could potentially be impacting the progression of this disease. This hypothesis is not enabling for delivery of any cargo to any skin cell of an individual with any possible brain disease, disorder, or injury with the predictable outcome of formulation of a skin-derived exosome that migrates to the brain.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 11, 12, 17, and 18 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Gallego-Perez et al. (WO 2018/119091 A1).
The applied reference has a common assignee and inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
Gallego-Perez et al. teach: Disclosed herein are compositions and methods for reprogramming somatic cells into vasculogenic cells and/or endothelial cells both in vitro and in vivo. One embodiment discloses a polynucleotide comprising two or more nucleic acid sequences encoding proteins selected from the group consisting of ETV2, FOXC2, and FLU. In some embodiments, the ETV2, FOXC2, and FLU proteins are mammalian proteins, such as human proteins.
Gallego-Perez et al. teach: Also disclosed a composition comprising a polynucleotide comprising one, two, or more nucleic acid sequences encoding proteins selected from the group consisting of ETV2, FOXC2, and FLU and a miR-200b inhibitor.
Gallego-Perez et al. teach: Another embodiment discloses a method of reprogramming somatic cells into vasculogenic cells and/or endothelial cells, comprising delivering intracellularly into the somatic cells a polynucleotide comprising one, two, or more nucleic acid sequences encoding proteins selected from the group consisting of ETV2, FOXC2, and FLU and a miR-200b inhibitor.
Gallego-Perez et al. teach: A variety of methods are known in the art and suitable for introduction of nucleic acid into a cell, including viral and non-viral mediated techniques. Examples of typical non-viral mediated techniques include, but are not limited to, electroporation, calcium phosphate mediated transfer, nucleofection, sonoporation, heat shock, magnetofection, liposome mediated transfer, microinjection, microprojectile mediated transfer (nanoparticles), cationic polymer mediated transfer (DEAE-dextran, polyethylenimine, polyethylene glycol (PEG) and the like) or cell fusion.
Gallego-Perez et al. teach: In some embodiments, after transfecting target cells with EFF, the cells can then pack the transfected genes (e.g. cDNA) into extracellular vesicles (EVs), which can then induce endothelium in other somatic cells.
Gallego-Perez et al. teach: Exosomes and microvesicles are EVs that differ based on their process of biogenesis and biophysical properties, including size and surface protein markers. Exosomes are homogenous small particles ranging from 40 to 150 nm in size and they are normally derived from the endocytic recycling pathway. In endocytosis, endocytic vesicles form at the plasma membrane and fuse to form early endosomes. These mature and become late endosomes where intraluminal vesicles bud off into an intra-vesicular lumen. Instead of fusing with the lysosome, these multivesicular bodies directly fuse with the plasma membrane and release exosomes into the extracellular space. Exosome biogenesis, protein cargo sorting, and release involve the endosomal sorting complex required for transport (ESCRT complex) and other associated proteins such as Alix and Tsg101 .
Therefore, Gallego-Perez et al. teach that exosomes are a species of the extracellular vesicles utilized to deliver a polynucleotide comprising two or more nucleic acid sequences encoding ETV2.
Gallego-Perez et al. teach: Findings showed that tissue nanotransfection (TNT) can not only be used for topical delivery of reprogramming factors (Fig. 17f), but it can also orchestrate a coordinated response that results in reprogramming stimuli propagation (i.e. epidermis to dermis) beyond the initial transfection boundary (i.e. epidermis) (Fig. 17g-i) possibly via dispatch of extracellular vesicles (EVs) rich in target gene cDNAs/mRNAs (Fig. 17h,i), among other plausible mechanisms. Exposing naive cells to ABM-loaded EVs isolated from TNT-treated skin (Fig 17j-l) established that these EVs can be spontaneously internalized by remote cells and trigger reprogramming (Figs. 17k,l, and 22). Moreover, gene expression analysis indicated that intradermal ABM EV injection triggered changes in the skin consistent with neuronal induction (Fig. 23), as evidenced by increased Tuj1 expression. The neurotrophic effect of skin-derived ABM67 loaded EVs was further confirmed in a middle cerebral artery occlusion (MCAO) stroke mouse model (Fig. 24).
Gallego-Perez et al. teach: Also disclosed is a method of reprogramming somatic cells, such as, but not limited to, skin cells or muscle cells, into vasculogenic cells and/or endothelial cells, comprising delivering intracellularly into the somatic cells a miR-200b inhibitor. For example, the miR-200b inhibitor can be an anti-miR-200b antagomir comprising the nucleic acid sequence UAAUACUGCCUGGUAAUGAUGA (SEQ ID NO: 1), which can be purchased from Dharmacon (catalog # IH-300582-08-0005).
Gallego-Perez et al. teach: In some embodiments, the disclosed compositions and methods are used to create a vasculature that can serve as a scaffolding structure. This scaffolding structure can then be used, for example, to aid in the repair of nerve tissue.
Gallego-Perez et al. teach: Applications of this include peripheral nerve injuries, and pathological/injurious insults to the central nervous system such as traumatic brain injury or stroke. In some embodiments, the created vasculature can be used to nourish composite tissue transplants, or any tissue graft.
Therefore, Gallego-Perez et al. teach delivery of the nucleic acid sequences encoding Etv2 via exosomes to skin cells and the intended use of treatment to the central nervous system such as traumatic brain injury or stroke, which meet the instant limitation of being delivered to the brain.
It is noted that production of the exosome and delivery to the brain is instantly recited as an outcome of delivery of polynucleotides encoding the therapeutic gene and would therefore necessarily flow from the delivery step.
Therefore, the claims are anticipated by Gallego-Perez et al.
Response to Arguments
Applicant argues: Gallego-Perez describes a polynucleotide containing the combination of ETV2, FOXC2, and FLU genes ("EFF") for reprogramming somatic cells into vasculogenic cells. This includes creating vasculature in the central nervous system (brain).
Applicant argues: The instant claims recite that the polynucleotide is delivered intracellularly into skin cells of the subject. This step is broadly taught in Gallego-Perez, but one of ordinary skill in the art would not reasonably conclude that Gallego-Perez taught this method of application for delivery brain. It is noted that Gallego-Perez teaches the instantly recited method step of delivering a nucleic acid sequence encoding Etv2 intracellularly into skin cells and production of exosomes. The remainder of instant claim 11 recites outcomes that necessarily flow from the recited method step. The delivery of the nucleic acid sequence into skin cells would necessarily produce the skin-derived exosome containing the cargo because this isn’t a physical step, but rather an outcome that flows from the method step.
Since Gallego-Perez et al. teaches a method comprising each of the instant method steps, the method would necessarily achieve the recited outcomes, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property.
Although applicant argues that one of ordinary skill in the art would not reasonably conclude that Gallego-Perez taught this method of application for delivery brain, this is not the bar for anticipation. Gallego-Perez is not required to teach applicant’s intended use. However, Gallego-Perez does teach delivery for brain diseases, disorders, or injuries.
Applicant argues: Gallego-Perez does teach that transfected cells, such as skin cells, can produce EVs which can be used to induce endothelium in other remote areas. What Gallego-Perez does not teach or suggest is that these EVs can cross the blood-brain-barrier (BBB). One of skill in the art would reasonably assume that the polynucleotide of Gallego-Perez would need to be administered directly into the brain to have any benefit on neurons therein. However, as explained above, this is an outcome of the instant claims rather than a method step. The recited outcome would necessarily flow from the recited and anticipated method step.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 11-13, 17, and 18 is/are rejected under 35 U.S.C. 103 as being unpatentable over Gallego-Perez et al. (WO 2018/119091 A1), in view of Kelleher et al. (Am J Cardiovasc Dis. 2013 Nov 1;3(4):197–226).
Gallego-Perez et al. teach: Disclosed herein are compositions and methods for reprogramming somatic cells into vasculogenic cells and/or endothelial cells both in vitro and in vivo. One embodiment discloses a polynucleotide comprising two or more nucleic acid sequences encoding proteins selected from the group consisting of ETV2, FOXC2, and FLU. In some embodiments, the ETV2, FOXC2, and FLU proteins are mammalian proteins, such as human proteins.
Gallego-Perez et al. teach: Also disclosed a composition comprising a polynucleotide comprising one, two, or more nucleic acid sequences encoding proteins selected from the group consisting of ETV2, FOXC2, and FLU and a miR-200b inhibitor.
Gallego-Perez et al. teach: Another embodiment discloses a method of reprogramming somatic cells into vasculogenic cells and/or endothelial cells, comprising delivering intracellularly into the somatic cells a polynucleotide comprising one, two, or more nucleic acid sequences encoding proteins selected from the group consisting of ETV2, FOXC2, and FLU and a miR-200b inhibitor
Gallego-Perez et al. teach: A variety of methods are known in the art and suitable for introduction of nucleic acid into a cell, including viral and non-viral mediated techniques. Examples of typical non-viral mediated techniques include, but are not limited to, electroporation, calcium phosphate mediated transfer, nucleofection, sonoporation, heat shock, magnetofection, liposome mediated transfer, microinjection, microprojectile mediated transfer (nanoparticles), cationic polymer mediated transfer (DEAE-dextran, polyethylenimine, polyethylene glycol (PEG) and the like) or cell fusion.
Gallego-Perez et al. teach: In some embodiments, after transfecting target cells with EFF, the cells can then pack the transfected genes (e.g. cDNA) into extracellular vesicles (EVs), which can then induce endothelium in other somatic cells.
Gallego-Perez et al. teach: Exosomes and microvesicles are EVs that differ based on their process of biogenesis and biophysical properties, including size and surface protein markers. Exosomes are homogenous small particles ranging from 40 to 150 nm in size and they are normally derived from the endocytic recycling pathway. In endocytosis, endocytic vesicles form at the plasma membrane and fuse to form early endosomes. These mature and become late endosomes where intraluminal vesicles bud off into an intra-vesicular lumen. Instead of fusing with the lysosome, these multivesicular bodies directly fuse with the plasma membrane and release exosomes into the extracellular space. Exosome biogenesis, protein cargo sorting, and release involve the endosomal sorting complex required for transport (ESCRT complex) and other associated proteins such as Alix and Tsg101 .
Therefore, Gallego-Perez et al. teach that exosomes are a species of the extracellular vesicles utilized to deliver a polynucleotide comprising two or more nucleic acid sequences encoding ETV2.
Gallego-Perez et al. teach: Findings showed that tissue nanotransfection (TNT) can not only be used for topical delivery of reprogramming factors (Fig. 17f), but it can also orchestrate a coordinated response that results in reprogramming stimuli propagation (i.e. epidermis to dermis) beyond the initial transfection boundary (i.e. epidermis) (Fig. 17g-i) possibly via dispatch of extracellular vesicles (EVs) rich in target gene cDNAs/mRNAs (Fig. 17h,i), among other plausible mechanisms. Exposing naive cells to ABM-loaded EVs isolated from TNT-treated skin (Fig 17j-l) established that these EVs can be spontaneously internalized by remote cells and trigger reprogramming (Figs. 17k,l, and 22). Moreover, gene expression analysis indicated that intradermal ABM EV injection triggered changes in the skin consistent with neuronal induction (Fig. 23), as evidenced by increased Tuj1 expression. The neurotrophic effect of skin-derived ABM67 loaded EVs was further confirmed in a middle cerebral artery occlusion (MCAO) stroke mouse model (Fig. 24).
Gallego-Perez et al. teach: Also disclosed is a method of reprogramming somatic cells, such as, but not limited to, skin cells or muscle cells, into vasculogenic cells and/or endothelial cells, comprising delivering intracellularly into the somatic cells a miR-200b inhibitor. For example, the miR-200b inhibitor can be an anti-miR-200b antagomir comprising the nucleic acid sequence UAAUACUGCCUGGUAAUGAUGA (SEQ ID NO: 1), which can be purchased from Dharmacon (catalog # IH-300582-08-0005).
Gallego-Perez et al. teach: In some embodiments, the disclosed compositions and methods are used to create a vasculature that can serve as a scaffolding structure. This scaffolding structure can then be used, for example, to aid in the repair of nerve tissue.
Gallego-Perez et al. teach: Applications of this include peripheral nerve injuries, and pathological/injurious insults to the central nervous system such as traumatic brain injury or stroke. In some embodiments, the created vasculature can be used to nourish composite tissue transplants, or any tissue graft.
Therefore, Gallego-Perez et al. teach delivery of the nucleic acid sequences encoding Etv2 via exosomes to skin cells and the intended use of treatment to the central nervous system such as traumatic brain injury or stroke, which meet the instant limitation of being delivered to the brain.
It is noted that production of the exosome and delivery to the brain is instantly recited as an outcome of delivery of polynucleotides encoding the therapeutic gene and would therefore necessarily flow from the delivery step.
Gallego-Perez et al. do not teach that the subject has Alzheimer’s disease.
However, given the known role of Etv2 in vascular development, it would have been obvious to deliver the composition of Gallego-Perez et al. to the brain to a subject with Alzheimer’s disease because it was known that Alzheimer’s disease has both neurodegenerative and vascular elements, as taught by Kelleher et al.
Response to Arguments
Applicant argues: Neither of these references teach or suggest the skin-brain axis or provide any expectation that skin-derived exosomes would cross the BBB and deliver RNA cargo to the brain.
Gallego-Perez describes a polynucleotide containing the combination of ETV2, FOXC2, and FLU genes ("EFF") for reprogramming somatic cells into vasculogenic cells. This includes creating vasculature in the central nervous system (brain).
It is noted that Gallego-Perez teaches the instantly recited method step of delivering a nucleic acid sequence encoding Etv2 intracellularly into skin cells and production of exosomes. The remainder of instant claim 11 recites outcomes that necessarily flow from the recited method step. The delivery of the nucleic acid sequence into skin cells would necessarily produce the skin-derived exosome containing the cargo because this isn’t a physical step, but rather an outcome that flows from the method step.
Since Gallego-Perez et al. teaches a method comprising each of the instant method steps, the method would necessarily achieve the recited outcomes, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property.
Gallego-Perez is not required to teach applicant’s intended use. However, Gallego-Perez does teach delivery for brain diseases, disorders, or injuries.
Applicant agrees that Gallego-Perez does teach that transfected cells, such as skin cells, can produce EVs which can be used to induce endothelium in other remote areas. Delivery to the brain is an outcome of the instant claims rather than a method step. The recited outcome would necessarily flow from the recited and anticipated method step.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636