DETAILED ACTION
The amendment filed on 07/30/2025 has been entered.
Claims 1-5, 7, 21, 22, and 50 were amended in the claim set filed on 07/30/2025.
Applicant’s election with traverse of species: SEQ ID NO: 1 and cardiovascular disease that is atherosclerosis, in the reply filed on April 03, 2025 is acknowledged.
With regard to the claim amendments, the specie election requirement of a specific miRNA and corresponding SEQ ID No., drawn to claims 2-4 and 7-9 is withdrawn.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Claims 6, 8-18, 23 and 28-49 are canceled in the claim set filed on 07/30/2025.
Claims 51-55 were added in the claim set filed on 07/30/2025. No new matter was added.
Claims 1-5, 7, 19-22, 24-27, and 50-55 in the claim set filed on 07/30/2025 are currently under examination.
Response to the Arguments
Objections to the Drawings and Specification in the previously mailed non-final have been withdrawn in light of applicants Drawings amendments and additional IDS.
As necessitated by amendment to the claim, new grounds of rejection for claims 1-5, 7, 19-22, 24-27 and 54 under 35 U.S.C. 101 are documented below, in this office action on Pg. 4-8.
Applicant’s arguments regarding previous rejection(s) of claim(s) 1, 5, 19-22, 24-27, and 50 under 35 U.S.C. 103 have been fully considered and are persuasive. Applicant’s argument on Pg. 12, states that “Cui, however, does not teach of suggest determining the concentration of hsa miRNA-1 and of the at least one other circulating miRNA(s) selected from hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, hsa-miRNA-132, and any combination, sub-combination, portion or fragment thereof.” The 35 U.S.C. 103 rejections documented in the previously mailed non-final have been withdrawn in light of applicants claim amendments and arguments on Pg. 12-17. However, upon further consideration and search, new grounds of rejection are made as documented below in the 35 U.S.C. 103 rejection in this office action on Pg. 4-30.
The rejections for claims 1-5, 7, 19-22, 24-27, and 50-55 are documented below in this Final Office Action are necessitated by claim amendments filed on 07/30/2025.
Claim Objections
Claim 5 is objected to because of the following informalities:
the amendment deleted the “wherein” (ln 2) that should be present (Claim 5). Appropriate correction is required.
Priority
This application claims priority to International Application No. PCT/EP2020/067980,
filed June 26, 2020, which claims priority to Luxembourg Application No. 101280 filed June 26, 2019.
Acknowledgment is made of applicant' s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified and English copy of LU 101280 has been submitted of the record on Dec. 22, 2021. Accordingly, the priority date of instant claims is determined to be June 26, 2019, the filing date of LU 101280.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 07/30/2025 was filed after the mailing date of the non-final office action on 05/06/2023. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-5, 7, 19-22, 24-27, and 54 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a(n) abstract idea/mental step and natural phenomenon, without significantly more. The claims recite abstract idea/mental steps of comparing and assigning as well as natural phenomena of circulating miRNA. These judicial exceptions are not integrated into a practical application because if there is unchanged expression or no increased risk of cardiovascular disease, no treatment step is required. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claims provide no specific limitations that provide significantly more.
Claim analysis
The instant claim 1 is directed towards “A method for establishing an individual physical activity program for a subject for reducing an individual risk of the subject for developing a cardiovascular disease, comprising the following steps:
(i) determining the concentration of at least one circulating miRNA in at least one fluid sample obtained from the subject at least before and after the subject has conducted physical activity, wherein the at least one circulating miRNA is selected from the group consisting of hsa-miRNA-1, and any portion or fragment thereof; and
(ii) comparing the in step (i) determined concentration(s), wherein the result of this comparison is indicative of whether said subject has an individual risk for developing a cardiovascular disease, if the result of this comparison shows an increase or decrease of the concentration of the at least one circulating miRNA after the subject has conducted physical activity compared to the concentration of the at least one circulating miRNA before the subject has conducted physical activity; and
(iii) establishing the individual physical activity program for the subject based on the result of step (ii).”
The claimed correlation of circulating miRNA with individual risk for developing a cardiovascular disease is a natural phenomenon.
The comparing step is a mental step/abstract idea.
The determining the concentration of at least one circulating miRNA is considered to be an active step requiring the analysis of a sample. The establishing the individual physical activity program is not considered significantly more as there is no correlation as to the specifics of how and why this treatment would be administered in the claims.
Dependent claims set forth further limitations about the SEQ ID No., method of determining circulating miRNA concentration, sample, subject, type of cardiovascular disease, and establishment of individual activity program.
The instant claim 50 is directed towards “A method for treating a subject at risk for developing a cardiovascular disease, comprising steps of:
(i) obtaining fluid samples from the subject at least before and after the subject has conducted physical activity;
(ii) determining the concentrations of at least one circulating miRNA in the fluid samples obtained at least before and after the subject has conducted physical activity, wherein the at least one circulating miRNA is selected from hsa-miRNA-1, hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, hsa-miRNA-132, and any combination, sub-combination, portion or fragment thereof;
(iii) assigning an increased risk for developing a cardiovascular disease to the subject if there is an increase or decrease of the concentration of the at least one circulating miRNA after the subject has conducted physical activity compared to the concentration of the at least one circulating miRNA before the subject has conducted physical activity; and
(iv) treating the subject with an individual physical activity program based on the result of step (iii).”
The claimed correlation of circulating miRNA with individual risk for developing a cardiovascular disease is a natural phenomenon.
The assigning step is a mental step/abstract idea.
The determining the concentration of at least one circulating miRNA is considered to be an active step requiring the analysis of a sample.
The treating the subject with an individual physical activity program is not considered significantly more as there is no correlation as to the specifics of how and why this treatment would be administered in the claims.
The instant claim 54 is directed towards “The method of claim 53, further comprising (c) comparing the concentrations of the at least two circulating miRNAs in the fluid sample obtained before the subject has conducted physical activity to the concentrations of the at least two circulating miRNAs in the fluid sample obtained after the subject has conducted physical activity.”
The comparing step is a mental step/abstract idea.
According to the 2019 Patent Eligibility Guidance an initial two step analysis is required for determining statutory eligibility.
Step 1. Is the claim directed to a process, machine, manufacture, or composition of matter? In the instant case the Step 1 requirement is satisfied as the claims are directed towards a process.
Step 2A Prong one. Does the claim recite a law of nature, a natural phenomenon or an abstract idea? Yes, abstract idea/mental step and natural phenomena. The claimed invention is directed towards a(n) abstract idea/ mental step of comparing the determined concentrations and assigning an increased risk of cardiovascular disease, which also correlates the natural phenomena of circulating miRNA(s) obtained from a subject’s fluid sample to developing cardiovascular disease.
Step 2A prong two. Does the claim recite additional elements that integrate the judicial exception into a practical application? The answer is no.
Step 2B. Does the claim recite additional elements that are significantly more than the judicial exceptions? The answer is no, additional elements that would provide significantly more to the judicial exceptions was not included.
Although the independent claim 1 step (iii) and claim 50 step (iv) recite establishing or treating with an individual physical activity program, which is of great generality being routine and conventional as demonstrated in the prior art rejections documented below. Furthermore, there is an absence of a verified indication of a particular disease or medical condition, or type of treatment claimed.
The specification teaches:
[0027] In one embodiment of the method of the present invention, establishing the individual physical activity program for the subject for reducing the individual risk of the subject for developing a cardiovascular disease comprises that the subject receives an assessment about his or her physical fitness, preferably wherein the assessment is given to the subject by a percent value or by defining a status of fitness as being unchanged, decreased or increased.
[0028] In a preferred embodiment of the method of the present invention, the individual physical activity program is established by altering the duration, intensity, number of repetitions or number of sessions of a physical activity or the overall combination of different physical activities.
The how and why each assessment guides the establishment of a program or treatment is not established in the claims and the details or lack thereof of the program established and/ or used for treatment do not provide more. Thus, the claim does not provide additional steps which are significantly more.
Response to Arguments
Applicant's arguments filed 07/30/2025 do not apply to the new grounds of rejections necessitated by amendment to the claims. Furthermore, Applicant's arguments filed 07/30/2025 (Pg. 11-12) with respect to claims 1, 5, 19-22, 24-27 and 50 have been fully considered but are not persuasive. To clarify some instances argued in the response filed 07/30/2025 see responses to each argument made by Applicant below:
Applicants’ argument: “Applicant respectfully traverses this rejection. As noted herein, claim 1 has been amended to positively recite that in step (i) the concentration of hsa-miRNA-1 and at least one other circulating miRNA that is hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA- 98, hsa-miRNA-125a, and/or hsa-miRNA-132 is determined. Step (ii) is amended to also refer to hsa-miRNA-1 and at least one other circulating miRNA. Step (iii) is amended to recite that establishing the individual physical activity program if there is an increase or decrease of the concentration of hsa-miRNA-1 and of the at least one other circulating miRNA based on the result of step (ii). Claim 50 includes the same amendments that are introduced into claim 1.
Therefore, the alleged judicial exceptions are integrated into a practical application because if there if there is an increase or decrease of the concentration of hsa-miRNA-1 and of the at least one other circulating miRNA based on the result of step (ii), then the individual physical activity program is established for the subject, or the subject is treated with an individual physical activity program.
New claims 51-55 are patent eligible also, because they are directed to a process and a composition of matter (Step 1), but they do not recite a recite a law of nature, a natural phenomenon or an abstract idea (Step 2A).”
Response: Applicant’s arguments have been fully considered and found unpersuasive because applicants amendments do not overcome the lack of patentably matter under U.S.C. 35 101. The previously presented and amended claims recite abstract idea/mental steps of comparing as well as natural phenomena of circulating miRNA. The newly added claim recites an abstract idea/mental steps of comparing. These judicial exceptions are not integrated into a practical application because if there is unchanged expression or no increased risk of cardiovascular disease, no treatment step is required. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claims provide no specific limitations that provide significantly more.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-5, 7, 19-21, 25 and 26 are rejected under 35 U.S.C. 103 as being unpatentable over Cui et al. (“Cui”, (2016). Similar responses of circulating microRNAs to acute high-intensity interval exercise and vigorous-intensity continuous exercise. Frontiers in Physiology, 7, 102) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009).
Cui discloses the ability of exercise to increase some specific miRNAs in the circulation might underlie the subsequently beneficial effects of exercise on tissue function. Additionally, identification of specific molecular biomarkers in the form of miRNAs might be suitable for monitoring training interventions.
Regarding claim 1, Cui teaches a method wherein “Blood samples were collected from the subjects at three time points: prior to acute exercise testing (Rest), immediately after the HIIE trial and after the distance-matched VICE trial (within 1 min of completion of the exercise testing)” (e.g., Pg. 2, col. 2, Plasma sampling). Cui teaches a method wherein “miRNA profiling of 754 different human miRNAs was then performed using a 7900 HT Fast Real-Time PCR System (Applied Biosystems)” (e.g., Pg. 3, col. 1, TaqMan Low Density Array). Cui teaches a method wherein “RT-qPCR was performed using a TaqMan PCR kit and an Applied Biosystems 7300 Sequence Detection System to quantify the abundance of mature miRNAs” (e.g., Pg. 3, col. 1, RNA Extraction and RT-qPCR). Cui teaches a method wherein “The muscle-specific miRNAs levels in the plasma, such as miR-1, … significantly increased in HIIE compared to rest (P < 0.05)” (e.g., Pg. 3, col. 2, Confirmation of the Candidate Circulating miRNAs by RT-qPCR; Figure 2). Thus, Cui teaches a method wherein determining the concentration of hsa-miRNA-1 and of at least one circulating miRNA in at least one fluid sample obtained from the subject at least before and after the subject has conducted physical activity and comparing the in step (i) determined concentration(s).
Regarding claim 1, Cui teaches a method wherein “the level of some cardiac and skeletal muscle-enriched miRNAs in the plasma, which were increased in several prior studies following a full or half-marathon run ... such as miR-1, … were also significantly increased during HIIE and VICE. Both types of training can effectively improve cardiac and skeletal muscle metabolic function (e.g., Pg. 4, Discussion, para. 3). Cui suggests a method wherein the ability of exercise to increase some specific miRNAs in the circulation might underlie the subsequently beneficial effects of exercise on tissue function (e.g., Pg. 7, col. 1, para. 3). Cardiovascular tissue function is interpreted as one of the tissues that can benefit from exercise especially when at risk of cardiovascular disease. Cui suggests “The benefit of exercise can be found in other tissues, which can prevent or effectively treat a multitude of degenerative conditions, including cardiovascular disease, …” (e.g., Pg. 5, col. 1, ln 6-9).
Cui does not teach the limitations of step (i) wherein the at least one other circulating miRNA is selected from the group consisting ofstep (iii) establishing the individual physical activity program for the subject if there is an increase or decrease of the concentration of hsa-miRNA-1 and of the at least one other circulating miRNA based on the result of step (ii).
Regarding the limitations of step (ii) and (iii) as recited in instant claim 1, “(ii)…if the result of this comparison shows an increase or decrease of the concentration of hsa-miRNA-1 and of the at least one circulating miRNA after the subject has conducted physical activity compared to the concentration of hsa-miRNA-1 and of the at least one circulating miRNA before the subject has conducted physical activity; and (iii) establishing the individual physical activity program for the subject if there is an increase or decrease of the concentration of hsa-miRNA-1 and of the at least one other circulating miRNA based on the result of step (ii)” are interpreted as optional limitations dependent on analysis.
Regarding the limitation recited in claim 1 step (i), Harrington discloses “methods, assays and kits identify biomarkers, particularly miRNA and/or protein biomarkers, for assessing the cardiovascular health of a human. In certain embodiments, methods, assays and kits, circulating miRNA and/or protein biomarkers are identified for assessing the cardiovascular health of a human.” (Abstract).
Regarding claim 1, Harrington teaches " a method for assessing the cardiovascular health of a human is provided comprising: a) obtaining a biological sample from a human; b) determining levels of at least 2 miRNA markers selected from miRNAs listed in Table 20 in the biological sample; c) obtaining a dataset comprised of the levels of each miRNA marker; d) inputting the data into an analytical classification process that uses the data to classify the biological sample, wherein the classification is selected from the group consisting of an atherosclerotic cardiovascular disease classification, a healthy classification, a medication exposure classification, a no medication exposure classification; and e) determining a treatment regimen for the human based on the classification in step (d); wherein the cardiovascular health of the human is assessed.” (Para. 5). Harrington teaches method wherein “quantitation of at least 1, at least 2, at least 3, at least 4, at least 5 miRNA markers selected from the miRNAs listed in Table 1” (Para. 157). Harrington also teaches Table 1 comprising: "hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU 337 MIMAT0000416 “(Pg. 53, Table 1); “hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG 255 MIMAT0000080“(Pg. 52, Table 1); “hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU 350 MIMAT0000079” (Pg. 54, Table 1); “hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU 408 MIMAT0000095” (Pg. 55, Table 1); and “hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG 423- MIMAT0004510” (Pg. 55, Table 1). Thus, Cui and Harrington teach a method wherein the at least one other circulating miRNA is selected from the group consisting of hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98,hsa-miRNA-125a, hsa-miRNA-132, and any combination, sub-combination, portion or fragment thereof.
Regarding the limitation recited in claim 1 step (iii), Colby discloses methods for generating genetic profiles or analyses. Included are methods for conducting comprehensive, dynamic genetic analysis. Also provided are methods for determining genetic health scores for specific phenotypes, such as diseases, disorders, traits, and conditions, as well as for organ systems, for certain medical specialties, and for overall health (Abstract).
Regarding claim 1, Colby teaches a method wherein “Individuals who are trying to achieve a specific end-point, such as … decreased risk of cardiovascular disease, … may also benefit from a genetically-tailored exercise regimen” (e.g., Para. 866). Colby teaches a method for analysis of genetic variants related to predicted phenotypes related to specific types of athletes, athletic predisposition, and athletic performance …This includes helpful information to discern a specific physical exercise regimen for most efficient physical exercise as well as an exercise regimen and/or workout that is most likely to produce the greatest returns. (e.g., Para. 867). Thus, Cui, Harrington and Colby teach a method wherein establishing the individual physical activity program for the subject based on the result of step (ii).
Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of evaluating circulating cardioprotective miRNA in response to exercise, wherein the concentration of hsa-miRNA-1 and at least one other circulating miRNA is determined as taught by Cui to incorporate the method wherein the other miRNA is hsa-miR-24 and/ or hsa-miR-96 as taught by Harrington and method of genetic analysis used to discern a specific and most efficient physical exercise regimen as taught by Colby and provide reasonable expectation of establishing an individual physical activity program for a subject for reducing an individual risk of the subject for developing a cardiovascular disease. Doing so would aid in personalization of cardiovascular disease risk diagnosis and therapy.
The teachings of Cui, Harrington and Colby are documented above in the rejection of claim 1 under 35 U.S.C. 103. Claims 2-5, 7, 19-21 and 25-26 depends on claim 1. Claim 21, depends on claim 19, which depends on claim 1.
Regarding claims 2-4, Harrington teaches determining concentrations of hsa-miR-1, hsa-miR-24 and/or hsa-miR-96 as described above in claim 1. Thus, Cui, Harrington and Colby teach a method wherein step (i) comprises determining the concentration of hsa-miRNA-1 and 2, 3, 4, 5, or all 6, or all 7 of the other circulating miRNAs selected from the group consisting of hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, hsa-miRNA-132, and any combination, sub-combination, portion or fragment thereof; wherein step (i) comprises determining the concentration of hsa-miRNA-1 and any of the other circulating miRNAs selected from the group consisting of hsa-miRNA-132, hsa-miRNA-143, hsa-miRNA-24, hsa-miRNA-96, and any combination, sub-combination, portion or fragment thereof; and wherein step (i) comprises determining the concentration of hsa-miRNA-1 and any of the other circulating miRNAs selected from the group consisting of hsa-miRNA-24, hsa-miRNA-96, and any combination, sub-combination, portion or fragment thereof.
Regarding claim 5, Harrington teaches Table 1 comprising: "hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU 337 MIMAT0000416 “(Pg. 53, Table 1), which correlates to SEQ ID No. 1. Thus, Cui, Harrington and Colby teaches a method wherein hsa-miRNA-1 comprises or consists of the nucleotide sequence according to SEQ ID NO: 1 and/or SEQ ID NO: 2.
Regarding claim 7, Harrington teaches Table 1 comprising: “hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG 255 MIMAT0000080“(Pg. 52, Table 1)”, which correlates to SEQ ID No. 3, and “hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU 350 MIMAT0000079” (Pg. 54, Table 1), which correlates to SEQ ID No. 4. Harrington also teaches Table 1 comprising: “hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU 408 MIMAT0000095” (Pg. 55, Table 1), which correlates to SEQ ID. No 6 and “hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG 423 MIMAT0004510” (Pg. 55, Table 1), which correlates to SEQ ID. No. 5. Thus, Cui, Harrington and Colby teach a method wherein hsa-miRNA-24 comprises or consists of the nucleotide sequence according to SEQ ID NO: 3 and/or SEQ ID NO: 4; wherein hsa-miRNA-96 comprises or consists of the nucleotide sequence according to SEQ ID NO: 5 and/or SEQ ID NO: 6; wherein hsa-miRNA-143 comprises or consists of the nucleotide sequence according to SEQ ID NO: 7 and/or SEQ ID NO: 8; wherein hsa-miRNA-98 comprises or consists of the nucleotide sequence according to SEQ ID NO: 9 and/or SEQ ID NO: 10; wherein hsa-miRNA-125a comprises or consists of the nucleotide sequence according to SEQ ID NO: 11 and/or SEQ ID NO: 12; wherein hsa-miRNA-132 comprises or consists of the nucleotide sequence according to SEQ ID NO: 13 and/or SEQ ID NO: 14; or any combination thereof.
Regarding claims 19 and 21, Harrington teaches a method where “atherosclerotic cardiovascular disease classification”(Para. 5). Thus, Thus, Cui, Harrington and Colby teach a method wherein the cardiovascular disease is selected from the group consisting of arteriosclerosis.
Regarding claim 20, Harrington teaches a method wherein “antibodies that bind to a marker set of interest. A variety of different array formats are known in the art, with a wide variety of different probe structures, substrate compositions and attachment technologies. Representative array or kit compositions of interest include or consist of reagents for quantitation of at least 2, at least 3, at least 4, at least 5 or more miRNA markers alone or in combination with protein markers.” (Para. 157). Thus, Thus, Cui, Harrington and Colby teach a method wherein the concentration of the at least one circulating miRNA is determined with an immunoassay technique, optionally by use of a monoclonal antibody for the detection of DNA/RNA dimers.
Regarding claim 25, Cui teaches a method wherein “Blood samples were collected from the subjects” (e.g., Pg. 2, col. 2, Plasma sampling). Thus, Cui, Harrington and Colby teach a method wherein the at least one fluid sample is a blood sample, a sample of blood components, a saliva sample, a tear sample, a urine sample, a sweat sample or a lymph sample.
Regarding claim 26, Cui teaches a method wherein “The aim of this study is to investigate whether or not high intensity interval exercise is superior to vigorous-intensity continuous exercise (VICE), which is contributing to develop effective fitness assessment (e.g., Pg. 2, Introduction, para. 3; Figure 2). Thus, Cui, Harrington and Colby teach a method wherein establishing the individual physical activity program for the subject for reducing the individual risk of the subject for developing a cardiovascular disease comprises that the subject receives an assessment about his or her fitness, optionally wherein the assessment is given to the subject by a percent value or by defining a status of fitness as being unchanged, decreased or increased.
Response to Arguments
Applicant' s arguments filed 07/30/2025 (Pg.12-13) with respect to claim 1-5, 7, 19-21, 25 and 26 have been considered but are either moot because the arguments filed 07/30/2025 do not apply to the new grounds of rejections or not persuasive. To clarify some instances argued in the response filed 07/30/20205 see responses to each argument made by Applicant below:
Applicants’ argument: “Colby is not directed to analysis of miRNA, starting with Cui one of skill in the art would not have a clear reason to look to Colby to arrive at the currently claimed subject matter.” (Pg. 13)
Response: In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Furthermore, Colby teaches “molecule (such as microRNA) that interacts with the genetic sequence containing, or located near, the genetic variant.” (Para. 646).
Claim 22 is rejected under 35 U.S.C. 103 as being unpatentable over Cui et al. (“Cui”, (2016). Similar responses of circulating microRNAs to acute high-intensity interval exercise and vigorous-intensity continuous exercise. Frontiers in Physiology, 7, 102) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009), as applied to claim 1 above, and further in view of Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563).
The teachings of Cui, Harrington and Colby are documented above in the rejection of claims 1-5, 7, 19-21, 25 and 26 under 35 U.S.C. 103. Claim 22 depends on claim 1.
Regarding amended claim 22, the limitations “wherein the sample obtained from the subject before the subject has conducted physical activity is obtained at least 4 weeks before the subject conducts physical activity or wherein the sample obtained from the subject before the subject has conducted physical activity is obtained at least 24 hours before the subject conducts physical activity or wherein the at least one fluid sample is further obtained from the subject, while the subject conducts physical activity” of the claim are considered to claim one or optionally more of the limitations recited in the claim.
Regarding claim 22, Cui teaches a method wherein “Blood samples were collected from the subjects at three time points: prior to acute exercise testing (Rest), immediately after the HIIE trial and after the distance-matched VICE trial (within 1 min of completion of the exercise testing)“ (e.g., Pg. 2, col. 2, Plasma sampling).
Cui, Harrington and Colby do not explicitly teach a method wherein the sample obtained from the subject before the subject has conducted physical activity is obtained at least 4 weeks before the subject conducts physical activity or wherein the sample obtained from the subject before the subject has conducted physical activity is obtained at least 24 hours before the subject conducts physical activity or wherein the at least one fluid sample is further obtained from the subject, while the subject conducts physical activity.
Mooren discloses a potential role for muscle- and heart-specific miRs in cardiovascular adaptation processes after endurance exercise. Moreover, the specific correlation of miR-1, -133a, and -206 to performance parameters indicated their potential role as biomarkers of aerobic capacity (Abstract).
Regarding claim 22, Mooren teaches a method wherein “resting blood samples were taken 2 days before the marathon” (e.g., Pg. H558, Blood Sampling). Thus, Cui, Harrington, Colby and Mooren teach a method wherein the sample obtained from the subject before the subject has conducted physical activity is obtained at least 24 hours before the subject conducts physical activity.
Therefore, it would be prima facia obvious to one of ordinary skill in the art before the effective filing date to modify the method of evaluating circulating cardioprotective miRNA(s) in response to exercise and analyzing an individual’s genetic profile to discern a specific exercise regimen as taught by Cui, Harrington and Colby to further comprise a method wherein the sample obtained from the subject before the subject has conducted physical activity is obtained at least 24 hours before as taught by Mooren in order to yield a predictable result of miRNA quantification. It would be obvious to the ordinary artisan to include a baseline sample taken at least 24 hours before physical activity to the method of evaluating circulating cardioprotective miRNAs in response to exercise and analyzing an individual’s genetic profile to discern a specific exercise regimen of Cui, Harrington and Colby, as Mooren teaches a reasonable expectation of subjects not preferring to give a sample immediately before physical activity.
Response to Arguments
Applicant' s arguments filed 07/30/2025 (Pg.15-16) with respect to claim 22 have been considered but are either moot because the arguments filed 07/30/2025 do not apply to the new grounds of rejections or not persuasive. Please see response to arguments documented above in the rejection of claims 1-5, 7, 19-21, 25 and 26 under 35 U.S.C. 103
Claims 24 and 27 is rejected under 35 U.S.C. 103 as being unpatentable over Cui et al. (“Cui”, (2016). Similar responses of circulating microRNAs to acute high-intensity interval exercise and vigorous-intensity continuous exercise. Frontiers in Physiology, 7, 102) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009), as applied to claim 1 above, and further in view of Schmitz et al. (“Schmitz”, (2017). Dose-response of high-intensity training (HIT) on atheroprotective miRNA-126 levels. Frontiers in Physiology, 8, 349.).
The teachings of Cui, Harrington and Colby are documented above in the rejection of claims 1-5, 7, 19-21, 25 and 26 under 35 U.S.C. 103.
Cui, Harrington and Colby do not explicitly teach a method wherein the concentration of the at least one circulating miRNA is determined in a regular time schedule, optionally wherein the regular time schedule comprises 2 days to 52 weeks or one week to 10 years (Claim 24) and/ or (a the individual physical activity program is established as high-intensity interval training, as moderate-intensity training, as low-intensity training or as isometric training (b) the individual physical activity program is established by altering the duration, intensity, number of repetitions or number of sessions of the physical activity, or both (a) and (b) (Claim 27).
Schmitz discloses MicroRNA-126 (miR-126) exerts beneficial effects on vascular integrity, angiogenesis, and atherosclerotic plaque stability. The purpose of this investigation was to analyze the dose-response relationship of high-intensity interval training (HIIT) on miR-126-3p and -5p levels (Aim).
Regarding claim 24, Schmitz teaches a method wherein “three different groups with a 4-week training intervention performing three exercise sessions/week”(e.g., Pg. 3, Training interventions, para. 1). Schmitz teaches a method wherein “Blood sampling for miRNA and lactate determination in the LIT group was performed before and after a 25 min low-intensity run ... HIIT and proHIIT pre- and post-exercise sampling …” (e.g., Pg. 3, Testing, para. 1).Schmitz teaches a method wherein “miRNA levels at follow-up were analyzed directly after the last run” (Table 2, Legend ln 3-4). Thus, Cui, Harrington, Colby and Schmitz suggest a method wherein the concentration of the at least one circulating miRNA is determined in a regular time schedule, optionally wherein the regular time schedule comprises 2 days to 52 weeks or one week to 10 years.
Regarding claim 27, Schmitz teaches a method wherein “1. High-intensity interval training (HIIT): HIIT participants were instructed to run at maximum speed for 4×30 s (all-out) with 30 s of active recovery periods at warm-up speed between bouts. 2. Progressive high-intensity interval training (proHIIT): proHIIT participants started at 4 × 30 s (all-out), increasing by one extra interval each week to a final set of 7 × 30 s (all-out) with 30 s of active recovery periods at warm-up speed between bouts. 3. Low-intensity training (LIT, control group): The LIT group was used as control group and performed a continuous run at 74.75% of HRmax (147 ± 12 b·min−1) for 25 min” (e.g., Pg. 3, Training Interventions, Para. 1-numbering 1-3). Thus, Cui, Harrington, Colby and Schmitz teach a method wherein (the individual physical activity program is established as high-intensity interval training, as moderate-intensity training, as low-intensity training or as isometric training, (b) the individual physical activity program is established by altering the duration, intensity, number of repetitions or number of sessions of the physical activity, or both (a) and (b).
Therefore, it would be prima facia obvious to one of ordinary skill in the art before the effective filing date to modify the method of evaluating circulating cardioprotective miRNA(s) in response to exercise and analyzing an individual’s genetic profile to discern a specific exercise regimen as suggested by Cui, Harrington and Colby to further comprise sampling and determining miRNA concentration on a regular time schedule as taught by Schmitz in order to yield a predictable result of various data time points to assess changes in miRNA concentration over time. It would be obvious to the ordinary artisan to include regular time points that miRNA concentration is determined to the method of evaluating circulating cardioprotective miRNAs in response to exercise and analyzing an individual’s genetic profile to discern a specific exercise regimen of Cui, Harrington and Colby, as Schmitz teaches a reasonable more accurate assessment of changes in miRNA levels as a direct response to the physical activity of an individual.
Response to Arguments
Applicant' s arguments filed 07/30/2025 (Pg.16-17) with respect to claims 24 and 27 have been considered but are either moot because the arguments filed 07/30/2025 do not apply to the new grounds of rejections or not persuasive. Please see response to arguments documented above in the rejection of claims 1-5, 7, 19-21, 25 and 26 under 35 U.S.C. 103.
Claim 50 is rejected under 35 U.S.C. 103 as being unpatentable over Cui et al. (“Cui”, (2016). Similar responses of circulating microRNAs to acute high-intensity interval exercise and vigorous-intensity continuous exercise. Frontiers in Physiology, 7, 102) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009).
Cui discloses the ability of exercise to increase some specific miRNAs in the circulation might underlie the subsequently beneficial effects of exercise on tissue function. Additionally, identification of specific molecular biomarkers in the form of miRNAs might be suitable for monitoring training interventions.
Regarding claim 50, Cui teaches a method wherein “Blood samples were collected from the subjects at three time points: prior to acute exercise testing (Rest), immediately after the HIIE trial and after the distance-matched VICE trial (within 1 min of completion of the exercise testing)” (e.g., Pg. 2, col. 2, Plasma sampling). Thus, Cui teaches a method comprising (i) obtaining fluid samples from the subject at least before and after the subject has conducted physical activity.
Cui teaches a method wherein “miRNA profiling of 754 different human miRNAs was then performed using a 7900 HT Fast Real-Time PCR System (Applied Biosystems)” (e.g., Pg. 3, col. 1, TaqMan Low Density Array). Cui teaches a method wherein “RT-qPCR was performed using a TaqMan PCR kit and an Applied Biosystems 7300 Sequence Detection System to quantify the abundance of mature miRNAs” (e.g., Pg. 3, col. 1, RNA Extraction and RT-qPCR). Cui teaches a method wherein “The muscle-specific miRNAs levels in the plasma, such as miR-1, … significantly increased in HIIE compared to rest (P < 0.05)” (e.g., Pg. 3, col. 2, Confirmation of the Candidate Circulating miRNAs by RT-qPCR; Figure 2). Thus, Cui teaches a method comprising (ii) determining the concentrations of has-miRNA-1 and at least one circulating miRNA in the fluid samples obtained at least before and after the subject has conducted physical activity.
Cui teaches a method wherein “the level of some cardiac and skeletal muscle-enriched miRNAs in the plasma, which were increased in several prior studies following a full or half-marathon run ... such as miR-1, … were also significantly increased during HIIE and VICE. Both types of training can effectively improve cardiac and skeletal muscle metabolic function (e.g., Pg. 4, Discussion, para. 3). Cui suggests a method wherein the ability of exercise to increase some specific miRNAs in the circulation might underlie the subsequently beneficial effects of exercise on tissue function (e.g., Pg. 7, col. 1, para. 3). Cardiovascular tissue function interpreted as one of the tissues that can benefit from exercise especially when at risk of cardiovascular disease. Cui suggests “The benefit of exercise can be found in other tissues, which can prevent or effectively treat a multitude of degenerative conditions, including cardiovascular disease, …” (e.g., Pg. 5, col. 1, ln 6-9). Thus, Cui suggests a method comprising (iii) assigning an increased risk for developing a cardiovascular disease to the subject if there is an increase or decrease of the concentration of has-miRNA-1and the at least one other circulating miRNA after the subject has conducted physical activity compared to the concentration of the at least one circulating miRNA before the subject has conducted physical activity and (iv) treating the subject at risk for developing cardiovascular disease with a physical activity program.
Regarding claim 50, Cui does not explicitly teach (ii)…wherein the at least one other circulating miRNA is selected from hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, hsa-miRNA-132, and any combination, sub-combination, portion or fragment thereof; and (iv) treating the subject with an individual physical activity program if there is an increase or decrease of the concentration of hsa-miRNA-1 and of the at least one other circulating miRNA based on the result of step (iii).
Regarding the limitation recited in claim 50 step (ii), Harrington discloses “methods, assays and kits identify biomarkers, particularly miRNA and/or protein biomarkers, for assessing the cardiovascular health of a human. In certain embodiments, methods, assays and kits, circulating miRNA and/or protein biomarkers are identified for assessing the cardiovascular health of a human.” (Abstract).
Regarding claim 50, Harrington teaches "a method for assessing the cardiovascular health of a human is provided comprising: a) obtaining a biological sample from a human; b) determining levels of at least 2 miRNA markers selected from miRNAs listed in Table 20 in the biological sample; c) obtaining a dataset comprised of the levels of each miRNA marker; d) inputting the data into an analytical classification process that uses the data to classify the biological sample, wherein the classification is selected from the group consisting of an atherosclerotic cardiovascular disease classification, a healthy classification, a medication exposure classification, a no medication exposure classification; and e) determining a treatment regimen for the human based on the classification in step (d); wherein the cardiovascular health of the human is assessed.” (Para. 5). Harrington teaches method wherein “quantitation of at least 1, at least 2, at least 3, at least 4, at least 5 miRNA markers selected from the miRNAs listed in Table 1” (Para. 157). Harrington also teaches Table 1 comprising: "hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU 337 MIMAT0000416 “(Pg. 53, Table 1); “hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG 255 MIMAT0000080“(Pg. 52, Table 1); “hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU 350 MIMAT0000079” (Pg. 54, Table 1); “hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU 408 MIMAT0000095” (Pg. 55, Table 1); and “hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG 423- MIMAT0004510” (Pg. 55, Table 1). Thus, Cui and Harrington teach a method wherein the at least one other circulating miRNA is selected from the group consisting of
Regarding the limitation recited in claim 50 step (iv), Colby discloses methods for generating genetic profiles or analyses. Included are methods for conducting comprehensive, dynamic genetic analysis. Also provided are methods for determining genetic health scores for specific phenotypes, such as diseases, disorders, traits, and conditions, as well as for organ systems, for certain medical specialties, and for overall health (Abstract).
Regarding claim 50, Colby teaches a method wherein “Individuals who are trying to achieve a specific end-point, such as … decreased risk of cardiovascular disease… may also benefit from a genetically-tailored exercise regimen” (e.g., Para. 866). Colby teaches a method for analysis of genetic variants related to predicted phenotypes related to specific types of athletes, athletic predisposition, and athletic performance…This includes helpful information to discern a specific physical exercise regimen for most efficient physical exercise as well as an exercise regimen and/or workout that is most likely to produce the greatest returns. (e.g., Para. 867). Thus, Cui, Harrington and Colby teach a method comprising (iv) treating the subject with an individual physical activity program based on the result of step (iii).
Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of evaluating circulating cardioprotective miRNAs in response to exercise wherein the concentration of hsa-miRNA-1 and at least one other circulating miRNA is determined as taught by Cui to incorporate the method wherein the other miRNA is hsa-miR-24 and/ or hsa-miR-96 as taught by Harrington and method of genetic analysis used to discern a specific and most efficient physical exercise regimen as taught by Colby and provide reasonable expectation of a method for treating an individual at risk of cardiovascular disease with an individual physical activity program. Doing so would aid in personalization of cardiovascular disease risk diagnosis and treatment by physical activity program.
Response to Arguments
Applicant' s arguments filed 07/30/2025 (Pg.12-13) with respect to claim 50 have been considered but are either moot because the arguments filed 07/30/2025 do not apply to the new grounds of rejections or not persuasive. Additionally, In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Claim 51-55 are rejected under 35 U.S.C. 103 as being unpatentable over Cui et al. (“Cui”, (2016). Similar responses of circulating microRNAs to acute high-intensity interval exercise and vigorous-intensity continuous exercise. Frontiers in Physiology, 7, 102) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009).
Cui discloses the ability of exercise to increase some specific miRNAs in the circulation might underlie the subsequently beneficial effects of exercise on tissue function. Additionally, identification of specific molecular biomarkers in the form of miRNAs might be suitable for monitoring training interventions.
Regarding claim 51, Cui teaches a method wherein “Blood samples were collected from the subjects” (e.g., Pg. 2, col. 2, Plasma sampling). Thus, Cui teaches method comprising (a) obtaining a fluid sample from a subject.
Regarding claims 51, Cui teaches a method wherein “miRNA profiling of 754 different human miRNAs was then performed using a 7900 HT Fast Real-Time PCR System (Applied Biosystems)” (e.g., Pg. 3, col. 1, TaqMan Low Density Array). Cui teaches a method wherein “RT-qPCR was performed using a TaqMan PCR kit and an Applied Biosystems 7300 Sequence Detection System to quantify the abundance of mature miRNAs” (e.g., Pg. 3, col. 1, RNA Extraction and RT-qPCR). Cui teaches a method wherein “The muscle-specific miRNAs levels in the plasma, such as miR-1, … significantly increased in HIIE compared to rest (P < 0.05)” (e.g., Pg. 3, col. 2, Confirmation of the Candidate Circulating miRNAs by RT-qPCR; Figure 2). Cui teaches a method wherein “the level of some cardiac and skeletal muscle-enriched miRNAs in the plasma, which were increased in several prior studies following a full or half-marathon run ... such as miR-1, … were also significantly increased during HIIE and VICE. (e.g., Pg. 4, Discussion, para. 3).Thus, Cui teaches a method comprising (b) detecting whether hsa-miRNA-1 and at least one other circulating miRNAs are present in the fluid sample by contacting the sample with at least two