DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's responses filed on 02/10/2026 and 07/10/2026 have been entered.
Election/Restrictions
Applicant's election with traverse of Group I (Claims 51, 56-64 and 73), drawn to a method of detecting two or more miRNAs in a healthy subject in the reply filed on 07/10/2026 is acknowledged. The traversal is on the ground(s) that “Applicant respectfully points out that Groups I and II also require the technical feature of obtaining a fluid sample from a healthy subject, which is another commonality. Harrington fails to teach or reasonably suggest detecting hsa-miRNA-1, and at least one of hsa- miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132 from a fluid sample of a healthy subject, and that Groups I and II maintain a special technical feature over Harrington.” This is not found persuasive because Groups I and II lack unity of invention because even though the inventions of these
groups require the technical feature of detecting hsa-miRNA-1, and at least one other circulating
miRNAs selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98,
hsa-miRNA-125a, and hsa-miRNA-132 this technical feature is not a special technical feature as it does not make a contribution over the prior art in view of Harrington et al. ("Harrington", Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) as Harrington suggests the technical feature. Furthermore, the technical feature is also obvious over Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012), Prasad et al. (“Prasad”; US Patent App. Pub. No. US 20110086348 A1, April 14, 2011) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009) as documented in the 35 U.S.C. 103 rejection of the non-final office action below. In this manner, the skilled person would arrive at the technical feature with a reasonable expectation of success. Thus, the technical feature is not a special technical feature. Furthermore, the two inventions have the capability of varying limitations further in a distinct manner.
The requirement is still deemed proper and is therefore made FINAL.
Claims Status
Claims 51 and 56-73 are pending in the claim set filed on 07/10/2026.
Claims 65-72 are withdrawn.
Claims 50 and 52-55 are canceled in the claim set filed on 02/10/2026
Claims 56-72 were added in the claim set filed on 02/10/2026 and claim 73 was added in the claim set filed on 07/10/2026.
Claims 51, 56-64 and 73 are currently under examination.
Priority
This application claims priority to International Application No. PCT/EP2020/067980,
filed June 26, 2020, which claims priority to Luxembourg Application No. 101280 filed June 26, 2019.
Acknowledgment is made of applicant' s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified and English copy of LU 101280 has been submitted of the record on Dec. 22, 2021. Accordingly, the priority date of instant claims is determined to be June 26, 2019, the filing date of LU 101280.
Claim Objections
Claim 73 is objected to because of the following informalities: “to the subject”(ln 8) should be amended to “in the subject” Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 51, 56-64 and 73 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 51 is indefinite over the limitation “healthy subject” (ln 3). It is unclear as to what is considered a healthy subject. The referenced paragraph 110 of the specification recites “The term "healthy", as used within the present invention, refers to physical conditions that allow the performance of a physical activity or exercise as defined above”. The specification also recites “physical activity includes exercise as well as other activities, which involve bodily movement and are done as part of playing, working, active transportation or recreational activities” (Para. 82). In absence of a clear definition, the recited “healthy subject” appears to encompass any subject that can perform bodily movement. Claims 56-64 and 73 depend on claim 51.
Claim 59 is indefinite over the limitation “physical activity”(ln 2). It is unclear as to what is considered physical activity. The specification recites “physical activity includes exercise as well as other activities, which involve bodily movement and are done as part of playing, working, active transportation or recreational activities” (Para. 82). In absence of a clear definition, the recited “physical activity ” appears to encompass any bodily movement. Claims 60-62 depend on claim 59.
Claim 73 is indefinite over the limitation “and step (d) treating the subject of (d)” (ln 8). It is unclear as to whom the “subject of (d)” is considered to be since the limitation is recited within step (d).
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 73 is rejected under 35 U.S.C. 101 because the claimed invention is directed towards abstract ideas related to mental processes, a law of nature related to the correlation of naturally circulating miRNAs concentration change to individual risk for developing a cardiovascular disease, and routine and conventional steps of detecting circulating miRNAs and determining the concentrations of the at least two circulating miRNAs without significantly more. The claim(s) recite(s) abstract ideas and a law of nature. This judicial exception is not integrated into a practical application because no additional elements integrate the judicial exceptions into a practical application. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because no additional elements are considered significantly more than the judicial exceptions.
Claim analysis
The instant claim 73 is directed towards: The method of claim 51, wherein step (a) comprises obtaining fluid samples from the subject at least before and after the subject has conducted physical activity, and the method further comprises step (c) determining that hsa-miRNA-1 has a concentration that is different between the fluid samples, and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples, wherein the at least one other circulating miRNA is selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132, and which represents an increased risk for developing a cardiovascular disease to the subject; and step (d) treating the subject of (d) with an individual physical activity program.
The correlation of differing concentrations of naturally occurring hsa-miRNA-1 and at least one other naturally circulating miRNA selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132 in subject samples obtained before and after physical activity is conducted to an increased risk for developing a cardiovascular disease to the subject is considered a law of nature.
The determining that hsa-miRNA-1 has a concentration that is different between the fluid samples and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples are considered abstract ideas (mental processes) related to organizing or analyzing information in a way that can be performed mentally or is analogous to human mental work and are considered to be active steps requiring the analysis of a samples. Additionally, the detecting miRNAs recited in claim 51 is also considered active steps. The active step(s) are routine and conventional as demonstrated by the 35 USC § 103 rejections stated below.
According to the 2019 Patent Eligibility Guidance an initial two step analysis is required for determining statutory eligibility.
Step 1. Is the claim directed to a process, machine, manufacture, or composition of matter? In the instant case, the Step 1 requirement is satisfied as the claims are directed towards a process.
Step 2A Prong one. Does the claim recite a law of nature, a natural phenomenon or an abstract idea? Yes, abstract ideas and law of nature.
With regard to claim 73, the claim recites “The method of claim 51, wherein step (a) comprises obtaining fluid samples from the subject at least before and after the subject has conducted physical activity, and the method further comprises step (c) determining that hsa-miRNA-1 has a concentration that is different between the fluid samples, and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples, wherein the at least one other circulating miRNA is selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132, and which represents an increased risk for developing a cardiovascular disease to the subject; and step (d) treating the subject of (d) with an individual physical activity program.”
The correlation of differing concentrations of naturally occurring miRNA in subject samples obtained before and after physical activity to an increased risk for developing a cardiovascular disease to the subject is considered a law of nature because it describes a consequence of natural processes in the human body, e.g. circulating miRNAs are naturally expressed and naturally vary in various functions processed by the body and is thus a law of nature.
The determining that hsa-miRNA-1 has a concentration that is different between the fluid samples and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples are considered abstract ideas (mental processes) related to organizing or analyzing information in a way that can be performed mentally or is analogous to human mental work.
Step 2A prong two. Does the claim recite additional elements that integrate the judicial exception into a practical application? No, there are no additional steps that integrate the claims into a practical application.
Step 2B. Does the claim recite additional elements that are significantly more than the judicial exceptions? No, there are no additional elements that are significantly more than the judicial exceptions. Although step (d) of claim 73 recites “treating the subject of (d) with an individual physical activity program”, which is of great generality being routine and conventional as demonstrated in the prior art rejections documented below and is not a particular treatment.
Furthermore, the claim requires the routine and conventional active steps of determining that hsa-miRNA-1 has a concentration that is different between the fluid samples and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples similar to that of Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563), Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012), Prasad et al. (“Prasad”; US Patent App. Pub. No. US 20110086348 A1, April 14, 2011) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009) as documented in the 103 rejection below. Thus, the claim does not provide additional steps which are significantly more.
Response to Arguments
Applicant's arguments filed 02/10/2026 do not apply to the new grounds of rejections necessitated by amendment to the claims filed 02/10/2026 and 07/10/2026. To clarify some instances argued in the response filed 02/10/2026 see responses to each argument made by Applicant below:
Applicants' argument: “new claim 65 positively detects differences in concentrations in the recited miRNAs in the first and second fluid samples and positively treats the subject having identified differences in miRNAs concentrations, so a treatment step is required, and for at least this reason the claim is patent eligible.” (Pg. 7)
Response: Although claim 65 is not within the elected invention examined in this non-final office action, claim 73 of the elected invention comprises a similar limitations. Applicant' s arguments have been fully considered and found unpersuasive in regards to claim 73, because applicants amendments do not overcome the lack of patentably matter under U.S.C. 35 101. The newly added claim 73 recites abstract ideas requiring abstract ideas related to mental processes, a law of nature related to the correlation of naturally circulating miRNAs concentration change to individual risk for developing a cardiovascular disease, and routine and conventional steps of detecting circulating miRNAs and determining the concentrations of the at least two circulating miRNAs without significantly more. The claim(s) recite(s) abstract ideas and a law of nature. The judicial exceptions are not integrated into a practical application because the claim limitations do not appear to improve the current technology or technical field beyond well-understood, routine, conventional activity. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claims provide no specific limitations that provide significantly more. Although claim 73 step (d) recites treating the subject of (d) with an individual physical activity program, the treatment is of great generality being routine and conventional as demonstrated in the prior art rejections documented below and is not a particular treatment.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 51, 56-60 and 64 are rejected under 35 U.S.C. 103 as being unpatentable over Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012).
Claim interpretation(s): Regarding claim 51, “healthy subject” is interpreted as any subject that can perform bodily movement.
Mooren discloses a potential role for muscle- and heart-specific miRs in cardiovascular adaptation processes after endurance exercise. Moreover, the specific correlation of miR-1, -133a, and -206 to performance parameters indicated their potential role as biomarkers of aerobic capacity (Abstract, last two sentences).
Regarding claim 51, Mooren teaches a method comprising “Resting blood samples were taken 2 days before the marathon because the athletes” (Pg. H558, Blood sampling). Mooren teaches a method comprising “A panel of miRs was investigated, which have been recently related either to skeletal/heart muscle (miR-1, -133a, -206, -499, and -208b)… To quantify the abundance of mature miRs, standard quantitative (“real time”) polymerase chain reaction (qRT-PCR) was performed. For that, cDNA of the … miRs was synthesized with miR-specific RT primers” (Pg. H558, Quantification of miRs.). Thus, Mooren suggests a method for detecting two or more miRNAs in a healthy subject, comprising (a) obtaining a fluid sample from a healthy subject, and (b) detecting hsa-miRNA-1, and at least one other circulating miRNA in the fluid sample by contacting the sample with at least two nucleic acids that are complementary to said circulating miRNAs.
Mooren also suggests "As low cardiorespiratory fitness is a powerful predictor of morbidity and cardiovascular mortality, there is a great need to understand how the exercise stimulus is turned into fitness. The investigation of the role of miRs seems to be a promising approach to improve our understanding… Further longitudinal studies, however, are required to confirm these actual approaches. It seems worthwhile to include additional miRs, tissue biopsies, and exercise/ training regimes to get more detailed and differentiated insights
into this topic. But it can be expected to be helpful on our way into the era of individualized, optimized, and therefore more efficacious health recommendations and preventive training
programs" (Pg. H561 (last sent)-H562, para.1, Discussion).
However, Mooren does not explicitly teach the limitation detecting … at least one other circulating miRNAs selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a,and hsa-miRNA-132.
Harrington discloses “methods, assays and kits identify biomarkers, particularly miRNA and/or protein biomarkers, for assessing the cardiovascular health of a human. In certain embodiments, methods, assays and kits, circulating miRNA and/or protein biomarkers are identified for assessing the cardiovascular health of a human.” (Abstract).
Regarding claim 51, Harrington teaches method wherein “quantitation of at least 1, at least 2, at least 3, at least 4, at least 5 miRNA markers selected from the miRNAs listed in Table 1” (Para. 157). Harrington also teaches Table 1 comprising: "hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU 337 MIMAT0000416 “(Pg. 53, Table 1); “hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU 408 MIMAT0000095” (Pg. 55, Table 1); and “hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG 423- MIMAT0004510” (Pg. 55, Table 1).
Thus, Mooren and Harrington suggest a method detecting hsa-miRNA-1, and at least one other circulating miRNAs selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132, and the limitations of claim 51.
Mooren and Harrington are both considered to be analogous to the claimed invention because they are in the same field of miRNA detection of regulatory cardiovascular biomarkers. Mooren suggested investigation cardiorespitory fitness and the role of miRs in cardiovascular development including additional miRs, tissue biopsies, and exercise/ training regimes to get more detailed and differentiated insights into this topic, which would be expected to be helpful towards individualized, optimized, and therefore more efficacious health recommendations and preventive training programs" (Pg. H561 (last sent)-H562, para.1, Discussion). Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of a) obtaining a fluid sample from a healthy subject, and (b) detecting hsa-miRNA-1, and at least one other circulating miRNA in the fluid sample as suggested by Mooren to incorporate the method of detecting at least one other circulating miRNAs selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132 as suggested by Harrington and provide a method for detecting two or more miRNAs in a healthy subject according to the limitations of claim 51. These claim elements were known in the art and one of skill in the art could have combined these elements by known methods with no change in their respective functions, and the combination would have yielded the predictable outcome according to the limitations of claim 51. Doing so would allow for assessment of cardiovascular health using miRNAs.
The teachings of Mooren and Harrington are documented above in the rejection of claim 51 under 35 U.S.C. 103. Claims 56, 59, 64 and 73 depend on claim 51.Claim 58 depends on claim 57, which depends on claim 56, which depends on claim 51. Claim 62 depends on claim 61, which depends on claim 60. Claims 60 and 63 depend on claim 59, which depends on claim 51.
Regarding claim 56-58, Harrington teaches method wherein “quantitation of at least 1, at least 2, at least 3, at least 4, at least 5 miRNA markers selected from the miRNAs listed in Table 1” (Para. 157). Harrington teaches a method wherein “hsa-miR-143 UGAGAUGAAGCACUGUAGCUC 187 MIMAT0000435” (Pg. 50, Table 1); “hsa-miR-143* GGUGCAGUGCUGCAUCUCUGGU 555 MIMAT0004599” (Pg. 57, Table 1); “hsa-miR-132 UAACAGUCUACAGCCAUGGUCG 127 MIMAT0000426” (Pg. 49, Table 1) and “hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU 537 MIMAT0004594” (Pg. 57, Table 1);. Thus, Mooren and Harrington suggest a method wherein the at least one other circulating miRNAs detected is or are hsa-miRNA-143, hsa-miRNA-132, or both hsa-miRNA-143 and hsa-miRNA-132.
Regarding claim 57-58, Harrington teaches a method wherein “hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG 184 MIMAT0004497” (Pg. 50, Table 1); “hsa-miR-24
UGGCUCAGUUCAGCAGGAACAG 255 GCUGGUUUCAUAUGGUGGUUUAGA 256 MIMAT0000080” (Pg. 52, Table 1). “hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU 623 MIMAT0000096” (Pg. 59, Table 1); “hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 332 MIMAT0000443” (Pg. 53, Table 1). Thus, Mooren and Harrington suggest a method wherein the at least one other circulating miRNAs detected are hsa-miRNA-143, hsa-miRNA-132, and one or more of hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-98, or hsa-miRNA-125a; and wherein the at least one other circulating miRNAs detected are hsa-miRNA-143, hsa-miRNA-132, hsa-miRNA-24, hsa-miRNA-96, hsa-miRNA-98, and hsa-miRNA-125a.
Regarding claim 59-60, Mooren teaches a method comprising “Resting blood samples were taken 2 days before the marathon because the athletes” (Pg. H558, Blood sampling). Mooren also teaches a method comprising “Additional samples were taken after and 24 h after the run” (Pg. H558). Thus, Mooren and Harrington suggest a method wherein step (a) comprises obtaining fluid samples from the subject at least before and after the subject has conducted physical activity; and further comprising (c) determining the concentrations of the at least two circulating miRNAs in the fluid sample obtained before the subject has conducted physical activity and after the subject has conducted physical activity.
Regarding claim 64, Harrington teaches a method wherein “methods, assays and kits for assessing the cardiovascular health of a human…methods, assays and kits identify circulating micro ribonucleic acid (miRNA) biomarkers … for assessing the cardiovascular health of a human” (Para. 24). Thus, Mooren and Harrington suggest a method wherein the healthy subject has a risk of developing a cardiovascular disease.
Response to Arguments
Applicant's arguments filed 02/10/2026 do not apply to the new grounds of rejections necessitated by amendment to the claims filed 02/10/2026 and 07/10/2026. To clarify some instances argued in the response filed 02/10/2026 see responses to each argument made by Applicant below:
Applicants' argument: “Harrington does not describe a "healthy" subject but rather just the opposite - an unhealthy subject who has myocardial infarctions (Mis) or unstable angina.” (Pg. 7)
Response: In response to applicant's argument that stated above, the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). Mooren does describe a healthy subject. Furthermore, it is unclear as to what is considered a healthy subject.
Claim 61 are rejected under 35 U.S.C. 103 as being unpatentable over Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) as applied to claims 51, 56-60 and 64 above, and further in view of Prasad et al. (“Prasad”; US Patent App. Pub. No. US 20110086348 A1, April 14, 2011).
The teachings of Mooren and Harrington are documented above in the rejection of claims 51, 56-60 and 64 under 35 U.S.C. 103. Claim 61 depends on claim 60, which depends on claim 59, which depend on claim 51. However, Mooren and Harrington do not explicitly teach the limitations of claim 61.
Prasad discloses “A method for assessing heart disease in a subject includes generating an expression profile of at least two or more miRNAs in a sample from the subject.” (Abstract)
Regarding claim 61, Prasad teaches a method wherein “a down-regulated expression level of at least one miRNA comprising hsa-mir-001” (Para. 8). Prasad teaches a method wherein “The miRNA levels measured in the biological sample, which can be used to generate an expression profile, can include any miRNA whose altered expression is associated with cardiovascular disease. Examples of miRNA whose altered expression is associated with heart disease can include those identified below in TABLE 1.” (Para. 30). Prasad teaches a method wherein “UGGCUCAGUUCAGCAGGAACAG SEQ ID NO: 15 hsa-mir-24 MIMAT0000080” ; “UGAGGUAGUAAGUUGUAUUGUU SEQ ID NO: 30 hsa-mir-98 MIMAT0000096”; “UCCCUGAGACCCUUUAACCUGUGA SEQ ID NO: 39 hsa-mir-125a MIMAT0000443” ; and “UGAGAUGAAGCACUGUAGCUC SEQ ID NO: 45 hsa-mir-143 MIMAT0000435” Table 1. Thus, Mooren, Harrington and Prasad suggest a method wherein the concentrations of the at least two circulating miRNAs in the fluid sample obtained before the subject has conducted physical activity are different than the concentrations of the at least two circulating miRNAs in the fluid sample obtained after the subject has conducted physical activity.
Mooren, Harrington and Prasad are considered to be analogous to the claimed invention because they are in the same field of assessing heart disease. Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the methods of detecting two or more miRNAs in a healthy subject from a sample obtained before the subject has conducted physical activity and after the subject has conducted physical activity as suggested by Mooren and Harrington to incorporate the method wherein the concentrations of the at least two circulating miRNAs are altered as suggested by Prasad and provide a method wherein the concentrations of the at least two circulating miRNAs in the fluid sample obtained before the subject has conducted physical activity are different than the concentrations of the at least two circulating miRNAs in the fluid sample obtained after the subject has conducted physical activity. These claim elements were known in the art and one of skill in the art could have combined these elements by known methods with no change in their respective functions, and the combination would have yielded the predictable outcome according to the limitations of claim 61. Doing so would allow for regulatory assessment of altered miR expression associated with disease in healthy subjects.
Response to Arguments
Applicant's arguments filed 02/10/2026 do not apply to the new grounds of rejections necessitated by amendment to the claims filed 02/10/2026 and 07/10/2026. Arguments against Harrington are not persuasive as discussed above.
Claim 62 are rejected under 35 U.S.C. 103 as being unpatentable over Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) and Prasad et al. (“Prasad”; US Patent App. Pub. No. US 20110086348 A1, April 14, 2011) as applied to claim 61 above, and further in view of Spinale et al. (“Spinale”; US Patent App. Pub. No. US 20130289141 A1, October 31, 2013).
The teachings of Mooren, Harrington and Prasad are documented above in the rejection of claim 61 under 35 U.S.C. 103. Claim 62 depends on claim 61, which depends on claim 60, which depends on claim 59, which depend on claim 51. However, Mooren, Harrington and Prasad do not explicitly teach the limitations of claim 62.
Spinale disclosed are methods and materials for assessing cardiac disease, including cardiac failure, cardiac hypertrophy, thoracic aortic aneurysm, left ventricular remodeling using microRNA levels. The level of microRNAs can be measured in a body fluid, such as plasma and serum, or in cardiac tissue. (Abstract)
Regarding claim 62, Spinale teaches a method wherein “In some forms the methods can indicate the risk … of thoracic aortic aneurysm in the subject. In some forms, the one or more target microRNAs can comprise miR-1… wherein a level or amount of miR-1... less than the level or amount in control … indicates the risk …of thoracic aortic aneurysm in the subject” (Para. 10). Spinale also teaches a method wherein “In some forms, the one or more target microRNAs comprises …miR-125a-5p, miR-143 … miR-24… For… miR-125a-5p, miR-143… miR-24… a level or amount less than the level or amount in control … is correlated with the risk… of thoracic aortic aneurysm in the subject”. Thus, Mooren, Harrington, Prasad and Spinale suggest a method wherein the concentrations of the at least two circulating miRNAs in the fluid sample obtained before the subject has conducted physical activity are greater than the concentrations of the at least two circulating miRNAs in the fluid sample obtained after the subject has conducted physical activity.
Mooren, Harrington, Prasad an Spinale are considered to be analogous to the claimed invention because they are in the same field of assessing heart disease. Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the methods of detecting two or more miRNAs in a healthy subject from a sample obtained before the subject has conducted physical activity and after the subject has conducted physical activity, wherein the concentrations of the at least two circulating miRNAs are altered as suggested by Mooren, Harrington and Prasad to incorporate the method wherein the concentrations of the at least two circulating miRNAs in the fluid sample are less than the control sample as suggested by Spinale and provide a method wherein the concentrations of the at least two circulating miRNAs in the fluid sample obtained before the subject has conducted physical activity are greater than the concentrations of the at least two circulating miRNAs in the fluid sample obtained after the subject has conducted physical activity. These claim elements were known in the art and one of skill in the art could have combined these elements by known methods with no change in their respective functions, and the combination would have yielded the predictable outcome according to the limitations of claim 62. Doing so would allow for regulatory assessment of altered miR expression associated with the risk of a cardiac disease (e.g., thoracic aortic aneurysm).
Response to Arguments
Applicant's arguments filed 02/10/2026 do not apply to the new grounds of rejections necessitated by amendment to the claims filed 02/10/2026 and 07/10/2026.
Claim 63 is rejected under 35 U.S.C. 103 as being unpatentable over Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) as applied to claims 51, 56-60 and 64 above, and further in view of Schmitz et al. (“Schmitz”, (2017). Dose-response of high-intensity training (HIT) on atheroprotective miRNA-126 levels. Frontiers in Physiology, 8, 349.).
The teachings of Mooren and Harrington are documented above in the rejection of claims 51, 56-60 and 64 under 35 U.S.C. 103. Claim 63 depends on claim 59, which depend on claim 51.
Regarding claim 63, Mooren further teaches a method wherein “Exercise altered the plasma levels of miRs implicated in angiogenesis, skeletal, and cardiac muscle adaptation in an intensity-, type-, and duration-dependent manner” (Pg. H557). Mooren teaches a method wherein “Athletes performed the marathon distance in a mean time of 215± 30 min” (Pg. H560).
However, Mooren and Harrington do not explicitly teach the limitations of claim 63.
Schmitz discloses MicroRNA-126 (miR-126) exerts beneficial effects on vascular integrity, angiogenesis, and atherosclerotic plaque stability. The purpose of this investigation was to analyze the dose-response relationship of high-intensity interval training (HIIT) on miR-126-3p and -5p levels (Aim).
Regarding claim 63, Schmitz teaches a method wherein “Blood sampling for miRNA and lactate determination in the LIT group was performed before and after a 25 min low-intensity run ... HIIT and proHIIT pre- and post-exercise sampling …” (e.g., Pg. 3, Testing, para. 1). Schmitz teaches a method wherein “participants documented exercise sessions in individual training logs (HIIT/proHIIT, rating of perceived exertion [RPE] on 15-grade Borg scale; Borg, 1982; LIT, HR).” (Pg. 3)
Thus, Mooren, Harrington and Schmitz suggest a method wherein the physical activity comprises: a moderate-intensity exercise characterized by a physiological strain wherein 50 - 75 % of a maximal heart rate in the subject and/or an exertion level in the range of 10-14 on the Borg Scale is achieved; and/or a high-intensity exercise characterized by a physiological strain wherein above 75 % of a maximal heart rate in the subject and/or an exertion level in the range of 15-20 on the Borg Scale is achieved.
Mooren, Harrington and Schmitz are considered to be analogous to the claimed invention because they are in the same field of assessing heart disease. Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the methods of detecting two or more miRNAs in a healthy subject from a sample obtained before the subject has conducted physical activity and after the subject has conducted physical activity as suggested by Mooren and Harrington to incorporate the method wherein the physical activity comprises: a high-intensity exercise characterized by a physiological strain wherein above 75 % of a maximal heart rate in the subject and/or an exertion level in the range of 15-20 on the Borg Scale is achieved as suggested by Schmitz and provide a method wherein the concentrations of the at least two circulating miRNAs in the fluid sample obtained before and after the subject has conducted physical activity comprising a high-intensity exercise characterized by a physiological strain wherein above 75 % of a maximal heart rate in the subject and/or an exertion level in the range of 15-20 on the Borg Scale is achieved. These claim elements were known in the art and one of skill in the art could have combined these elements by known methods with no change in their respective functions, and the combination would have yielded the predictable outcome according to the limitations of claim 63. Doing so would allow for regulatory assessment of miR expression associated with cardiovascular disease in healthy subjects before and after high-intensity exercise.
Response to Arguments
Applicant's arguments filed 02/10/2026 do not apply to the new grounds of rejections necessitated by amendment to the claims filed 02/10/2026 and 07/10/2026.
Claim 73 is rejected under 35 U.S.C. 103 as being unpatentable over Mooren et al. (“Mooren”, (2014). Circulating microRNAs as potential biomarkers of aerobic exercise capacity. American Journal of Physiology-Heart and Circulatory Physiology, 306(4), H557-H563) in view of Harrington et al. (“Harrington”, Patent App. Pub. No. AU 2010328019 A2, June 28, 2012) as applied to claims 51, 56-60 and 64 above, and further in view of Prasad et al. (“Prasad”; US Patent App. Pub. No. US 20110086348 A1, April 14, 2011) and Colby et al. (“Colby”, US Patent App. Pub. No. US 20090299645 A1, Dec. 03, 2009).
The teachings of Mooren and Harrington are documented above in the rejection of claims 51, 56-60 and 64 under 35 U.S.C. 103. Claim 73 depends on claim 51.
Regarding claim 73, Mooren teaches a method comprising “Resting blood samples were taken 2 days before the marathon” and “Additional samples were taken after and 24 h after the run” (Pg. H558, Blood sampling). Mooren teaches a method comprising “A panel of miRs was investigated, which have been recently related either to skeletal/heart muscle (miR-1, -133a, -206, -499, and -208b)… To quantify the abundance of mature miRs, standard quantitative (“real time”) polymerase chain reaction (qRT-PCR) was performed. For that, cDNA of the … miRs was synthesized with miR-specific RT primers” (Pg. H558, Quantification of miRs). Figure 1A depicts the different concentrations of miR-1 relative to cel-39 (control) in samples taken at before the marathon compared to after or 24 hr after. (Figure 1) Figure 1B and 1C depict different concentrations of other circulating miRNA in samples taken at before the marathon compared to after or 24 hr after. (Figure 1) Thus, Mooren and Harrington suggests a method wherein step (a) comprises obtaining fluid samples from the subject at least before and after the subject has conducted physical activity, and the method further comprises step (c) determining that hsa-miRNA-1 has a concentration that is different between the fluid samples, and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples.
Mooren also suggests "As low cardiorespiratory fitness is a powerful predictor of morbidity and cardiovascular mortality, there is a great need to understand how the exercise stimulus is turned into fitness. The investigation of the role of miRs seems to be a promising approach to improve our understanding… Further longitudinal studies, however, are required to confirm these actual approaches. It seems worthwhile to include additional miRs, tissue biopsies, and exercise/ training regimes to get more detailed and differentiated insights
into this topic. But it can be expected to be helpful on our way into the era of individualized, optimized, and therefore more efficacious health recommendations and preventive training
programs" (Pg. H561 (last sent)-H562, para.1, Discussion).
Harrington teaches a method wherein “methods, assays and kits for assessing the cardiovascular health of a human…methods, assays and kits identify circulating micro ribonucleic acid (miRNA) biomarkers … for assessing the cardiovascular health of a human” (Para. 24). Harrington teaches method wherein “quantitation of at least 1, at least 2, at least 3, at least 4, at least 5 miRNA markers selected from the miRNAs listed in Table 1” (Para. 157).
However, Mooren and Harrington do not explicitly teach the limitation Claim 73 wherein i) determining that at least one other circulating miRNA has a concentration that is different between the fluid samples, wherein the at least one other circulating miRNA is selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132, ii) which represents an increased risk for developing a cardiovascular disease to the subject; and iii) step (d) treating the subject of (d) with an individual physical activity program.
Regarding limitations i-ii) Prasad discloses “A method for assessing heart disease in a subject includes generating an expression profile of at least two or more miRNAs in a sample from the subject.” (Abstract)
Regarding claim 73, Prasad teaches a method wherein “a down-regulated expression level of at least one miRNA comprising hsa-mir-001” (Para. 8). Prasad teaches a method wherein “The miRNA levels measured in the biological sample, which can be used to generate an expression profile, can include any miRNA whose altered expression is associated with cardiovascular disease. Examples of miRNA whose altered expression is associated with heart disease can include those identified below in TABLE 1.” (Para. 30). Prasad teaches a method wherein “UGGCUCAGUUCAGCAGGAACAG SEQ ID NO: 15 hsa-mir-24 MIMAT0000080” ; “UGAGGUAGUAAGUUGUAUUGUU SEQ ID NO: 30 hsa-mir-98 MIMAT0000096”; “UCCCUGAGACCCUUUAACCUGUGA SEQ ID NO: 39 hsa-mir-125a MIMAT0000443” ; and “UGAGAUGAAGCACUGUAGCUC SEQ ID NO: 45 hsa-mir-143 MIMAT0000435” (Table 1).
Regarding limitation iii), Colby discloses methods for generating genetic profiles or analyses. Included are methods for conducting comprehensive, dynamic genetic analysis. Also provided are methods for determining genetic health scores for specific phenotypes, such as diseases, disorders, traits, and conditions, as well as for organ systems, for certain medical specialties, and for overall health (Abstract).
Regarding claim 73, Colby teaches a method wherein “Individuals who are trying to achieve a specific end-point, such as … decreased risk of cardiovascular disease, … may also benefit from a genetically-tailored exercise regimen” (e.g., Para. 866). Colby teaches a method for analysis of genetic variants related to predicted phenotypes related to specific types of athletes, athletic predisposition, and athletic performance …This includes helpful information to discern a specific physical exercise regimen for most efficient physical exercise as well as an exercise regimen and/or workout that is most likely to produce the greatest returns. (e.g., Para. 867).
Thus, Mooren, Harrington, Prasad and Colby suggest a method wherein step (a) comprises obtaining fluid samples from the subject at least before and after the subject has conducted physical activity, and the method further comprises step (c) determining that hsa-miRNA-1 has a concentration that is different between the fluid samples, and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples, wherein the at least one other circulating miRNA is selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132, and which represents an increased risk for developing a cardiovascular disease to the subject; and step (d) treating the subject of (d) with an individual physical activity program.
Mooren, Harrington, Prasad and Colby are considered to be analogous to the claimed invention because they are in the same field of assessing heart disease. Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to have modified the methods of detecting two or more miRNAs in a healthy subject from a sample obtained before the subject has conducted physical activity and after the subject has conducted physical activity, wherein the method further comprises step (c) determining that hsa-miRNA-1 has a concentration that is different between the fluid samples, and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples as suggested by Mooren and Harrington to incorporate the method of determining that at least one other circulating miRNA has a concentration that is different between the fluid samples, wherein the at least one other circulating miRNA is selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132, and which represents an increased risk for developing a cardiovascular disease to the subject as suggested by Prasad and to incorporate the method of treating the subject with an individual physical activity program as suggested by Spinale and provide a method wherein step (a) comprises obtaining fluid samples from the subject at least before and after the subject has conducted physical activity, and the method further comprises step (c) determining that hsa-miRNA-1 has a concentration that is different between the fluid samples, and determining that at least one other circulating miRNA has a concentration that is different between the fluid samples, wherein the at least one other circulating miRNA is selected from the group consisting of hsa-miRNA-96, hsa-miRNA-143, hsa-miRNA-98, hsa-miRNA-125a, and hsa-miRNA-132, and which represents an increased risk for developing a cardiovascular disease to the subject; and step (d) treating the subject of (d) with an individual physical activity program. These claim elements were known in the art and one of skill in the art could have combined these elements by known methods with no change in their respective functions, and the combination would have yielded the predictable outcome according to the limitations of claim 73. Doing so would allow for regulatory assessment of altered miR expression associated with the risk of a cardiovascular disease in healthy subjects and a tailored treatment based on the risk assessment of a cardiovascular disease.
Response to Arguments
Applicant's arguments filed 02/10/2026 do not apply to the new grounds of rejections necessitated by amendment to the claims filed 02/10/2026 and 07/10/2026.
Conclusion
In view of the amendments and added claims, new grounds of rejections and above responses to arguments, no claims are in condition for allowance.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KENDRA R VANN-OJUEKAIYE whose telephone number is (571)270-7529. The examiner can normally be reached M-F 9:00 AM- 5:00 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KENDRA R VANN-OJUEKAIYE/Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Prosecution Insights