DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application 17/625,308 filed on 01/06/2022 is a 371 national phase of PCT/ JP2020/026755 filed on 07/08/2020, and claims the benefit of Japanese Application No. 2019-126940, filed on 07/08/2019.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386 (c) is acknowledged. Receipt of certified copies of papers required by 37 CFR 1.55 is acknowledged. It is noted that foreign priority is not perfected as no English translation was provided for the foreign priority document received on 01/26/2022. In order to perfect the foreign priority claim, please provide a certified English copy.
In the absence of a translated copy, the priority date of claim 1 and its dependents is determined to be 07/08/2020, the filing date of the national phase PCT/ JP2020/026755 application.
Status of Claims
Applicant’s amendments to claims filed 06/30/2025 in response to the Non-Final Rejection mailed 03/28/2025 are acknowledged.
Claims 1, 7, and 12 are amended.
Claims 2-5 have been canceled.
Claims 1 and 6-13 are under examination.
Response to Remarks filed 06/30/2025
The amendments and arguments presented in the papers filed 06/30/2025
Deficiencies in the sequence disclosure cited in the Office Action dated 03/28/2025 have been remedied and those objections are withdrawn in view of the replacement Sequence Listing and amendments to the specification.
The objections to the specification regarding the use of trade names or marks are withdrawn in view of the amendments to the specification.
The objection to claim 3 is withdrawn because the claim in question is canceled.
d) The 35 USC 112(b) indefiniteness rejections of claims 1-13 have been withdrawn in view of the amendments to claims 1, 7, and 12, and cancellation of claims 2-5.
e) The rejection of claims 1-13 under 35 U.S.C. 102 as being unpatentable over Gold et al. (US6124449, on IDS dated 04/07/2022) is withdrawn in view of the amendments to the claims.
New and modified grounds of rejection necessitated by amendment are detailed below and this action is made FINAL.
Nucleotide and/or Amino Acid Sequence Disclosures- New
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2).
However, SEQ ID NO:53 and SEQ ID NO:54 in the Sequence Listing dated 07/07/2025 are not the same sequence as the SEQ ID NO:53 and SEQ ID NO:54 sequence provided in in the specification or claim 1.
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Claim Objections - New
Claim 1 part (b) recites “wherein X, N, R, S, K, and V are selected in a combination that forms four sets of 2 to 5 consecutive G bases”. There is no N in the claimed sequence (SEQ ID NO: 54). Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 6 and 8-12 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim recites “(a) a nucleotide sequence consisting of the following formula (III):formula (III): UAAXGGRNGGSGARACUUGKGVNRGG (SEQ ID NO: 53) wherein X is a bond or GU; N is any base; R is A or G: S is C or G: K is G or U: and V is A,C, or G, wherein X, N, R, S, K, and V are selected in a combination that forms four sets of 2 to 5 consecutive G bases, (b) a nucleotide sequence consisting of the following formula (III'):formula (III'): UAAXGGRBGGSGARACUUGKGVBRGG (SEQ ID NO: 54) wherein X is a bond or GU; R is A or G: S is C or G: K is G or U; V is A, C, or G: and B is C, G, or U, wherein X, N, R, S, K, and V are selected in a combination that forms four sets of 2 to 5 consecutive G bases”.
The limitations “X is a bond or GU” and “wherein X, N, R, S, K, and V are selected in a combination that forms four sets of 2 to 5 consecutive G bases” render the length of claimed “a nucleotide sequence consisting of the following formula (III): UAAXGGRNGGSGARACUU GKGVNRGG (SEQ ID NO: 53)” and “a nucleotide sequence consisting of the following formula (III'):formula (III'): UAAXGGRBGGSGARACUUGKGVBRGG (SEQ ID NO: 54)’ unclear because “consisting of” is a closed language that permits only a fixed length of SEQ ID NO: 53 and a fixed length of SEQ ID NO: 54. Furthermore, it is unclear what constitutes “a set of 2 to 5 consecutive G bases”. As an example, when both R and N are nucleotide G in SEQ ID NO:53, it is unclear how many “sets of 2 to 5 consecutive G bases” are there in the sequence --- GGGGGG ---?
As a related issue discussed in the preceding paragraph, it is also unclear regarding the relationship between the limitation “which aptamer is 25 to 200 nucleotides in length, comprises four sets of 2 to 5 consecutive G bases” recited in the preamble of claim 1 and the limitation “a nucleotide sequence consisting of the following formula (III): (SEQ ID NO:53) ---- wherein X, N, R, S, K, and V are selected in a combination that forms four sets of 2 to 5 consecutive G bases” recited in limitation (a) of claim 1. Accordingly, claim 1 as written, the limitation “four sets of 2 to 5 consecutive G bases” is presented simultaneously in the context of both an open language (comprising recited in line 2 of claim 1) and closed language (consisting recited in lines 4-5 of limitations (a) and (b) of claim 1) in claim 1. The absence of proper correlation between preamble and body of claim 1 renders the claim indefinite.
Claims 6 and 8-12 recite the limitation “the aptamer according to claim 1”.
Claim Rejections - 35 USC § 112(a) – Written Description- Updated
Claims 7 and 13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor at the time the application was filed, had possession of the claimed invention.
Claim 7 is drawn to an aptamer that binds to TGF-β1, comprising (a) the nucleotide sequence of SEQ ID NO:4-6, 9, 11, 13, 17-22, 26-29, 31, or (b) the nucleotide sequence of the above-mentioned (a), wherein one to five nucleotides are substituted, deleted, or added. The claim reads on a massive genus of sequences. There is a lack of guidance/support in the claims and/or specification as to what features of claimed nucleotide sequences must be present to bind to TGF-β1. No clear limitations are provided for the number of modifications (one to five substituted, deleted, or added nucleotides) in the sequence, or location of modifications in the sequence. No guidance is provided regarding what changes can be made and still have the intended function of binding TGF-β1.
The instant specification does not provide sufficient written description for all of the claimed sequences or what genus of sequences meet the criteria of binding TGF-β1. In the absence of structural features necessary for binding, it is assumed that the binding of TGF-β1 is inherent to the claimed sequences of claim 7. However, claim 7 encompasses all sequences of (a), 17 sequences with lengths of 33, 51, 65, 66, 80, and 90 nucleotides that have no clear consensus sequence as shown below.
PNG
media_image1.png
356
950
media_image1.png
Greyscale
Alternately claim 7 encompasses the 17 sequences of (a) with further substitution, deletion or addition of 1-5 nucleotides per sequence which greatly expands the pool of potential sequences. In the absence of structural features necessary for binding, it is assumed that the binding of TGF-β1 is inherent to the claimed sequences of claim 7.
However, claim 7 encompasses all possible sequences of (a) or (b). The specification discloses only specific species of sequences (including SEQ ID NOs: 4-6,9, 11, 13, 17-22, 26-29 or 31) that possess the ability to bind to TGF-β1.
The specification states that the inventors “investigated diligently to solve the problem described above and succeeded in producing aptamers that specifically bind to TGF-β1, and shown that the aptamers inhibit TGF-β1 activity (para 10). This indicates that not all possible sequences are capable of binding to TGF-β1. Thus, applicant could not have been in possession of the genus of aptamers of claim 7 that comprises any nucleotide sequence of one to five substitutions, deletions, or additions to SEQ ID NOs: 4-6, 9, 11, 13, 17-22, 26-29 or 31 with the ability to bind to TGF-β1. Applicant does not provide sufficient guidance (structure or other properties) for selecting from among all possible sequences of claim 7 for the ability to bind TGF-β1.
To provide evidence of possession of a claimed genus, the specification must provide sufficient distinguishing/identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof.
Regarding claim 13, the claim further requires that the aptamer inhibits binding between TGF-β1 and a TGF-β1 receptor. Applicant additionally fails to disclose structure or other properties that would indicate possession of the claimed genus of aptamers that inhibits binding between TGF-β1 and a TGF-β1 receptor.
Response to arguments
The arguments and amendments have been fully considered but are not persuasive.
The applicant’s amendments fail to overcome the written description rejection as described above.
Claim Interpretation - Updated
Claim 1 requires that the aptamer binds to TGF-β1 but provides no structural limitations beyond those in the claim. The binding of TGF-β1 is interpreted as inherent to the aptamer of claim 1.
Claim 1 recites the limitation “An aptamer that binds to TGF- 1, which aptamer is 25 to 200 nucleotides in length, comprises four sets of 2 to 5 consecutive G bases, and comprises” options (a), (b), or (c). Each of (a), (b) and (c) recite an individual SEQ ID NO: as well as variable nucleotides. Under the broadest reasonable interpretation, the aptamer is considered to comprise core elements shared across all sequences. The examiner considered SEQ ID NO: 34 and two variants each of SEQ ID NOs: 53 and 54. Alignment software could not accommodate the variable “X is a bond or GU” so a version with each option was considered in determining shared core sequences.
PNG
media_image2.png
138
360
media_image2.png
Greyscale
PNG
media_image3.png
140
364
media_image3.png
Greyscale
Further, a nucleic acid comprising “a nucleotide sequence consisting of the following formula (III) --- (SEQ ID NO:53)” encompasses various length of nucleotide sequences that is in direct contradiction to “consisting of” being a closed language requiring the claimed SEQ ID NO: 53 and SEQ ID NO: 54 being a fixed length. Claim 1 as written, formula III (SEQ ID NO: 53) and formula III’ (SEQ ID NO: 54) encompass variations in the length of SEQ ID NO: 53 and SEQ ID NO: 54 based on the limitations “X is a bond or GU” and “X, N, R, S, K, and V are selected in a combination that forms four sets of 2 to 5 consecutive G bases”. More elaboration has been provided in the rejection under 112(b) documented above.
Claim 7 recites the limitation of “an aptamer that binds to TGF-b1, comprising (a) the nucleotide sequence of SEQ ID NO: 4 - 6, 9, 11, 13, 17 - 22, 26 - 29 or 31, or (b) the nucleotide sequence of the above-mentioned (a), wherein one to five nucleotides are substituted, deleted, or added”. As explained below in this Office Action the full set of claimed sequences, even disregarding substitutions, deletions or additions, do not share a common core sequence that might indicate structural limitations required for TGF-β1. Under the broadest reasonable interpretation any sequence that comprises a common shared sequence of multiple claimed SEQ ID NOs wherein one to five nucleotides are substituted, deleted, or added is considered to be encompassed by the claims.
Claim 8 recites “a nucleotide length of not more than 55” but does not specify what nucleotide sequence is limited, or if the overall length is intended to be limited. The claim is broadly interpreted as any consecutive nucleotide length of less than 55.
Claim 9 requires that the aptamer inhibits binding between TGF-β1 and a TGF-β1 receptor, but provides no structural limitations beyond those in the claim or the independent claim 1. The binding of TGF-β1 is interpreted as inherent to the aptamer of claim 1.
Claim 10 recites a “functional substance”. The functional substance is interpreted to include any of the functional substances listed in the specification (para 68).
Claim 13 requires that the aptamer inhibits binding between TGF-β1 and a TGF-β1 receptor, but provides no structural limitations beyond those in the claim or the independent claim 7. The binding of TGF-β1 is interpreted as inherent to the aptamer of claim 7
Claim Rejections - 35 USC § 103 - new
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1 and 6-13 is/are rejected under 35 U.S.C. 103 as being unpatentable over Gold et al. (US6124449, on IDS dated 04/07/2022).
These are new rejections necessitated by the claim amendments filed on 06/30/2025.
Regarding claim 1, Gold teaches the identification and preparation of high-affinity nucleic acid ligands to TGFβ, including RNA ligands identified by the SELEX method (i.e. aptamers) (abstract and claim 1). Gold teaches ligands that are 69-71 nucleotides in length and comprise four sets of 2 to 5 consecutive G bases (Fig. 7).
Gold teaches SEQ ID NO: 106 (Fig. 7) which comprises 4 sets of 2 to 5 consecutive G bases indicated in bold: gggaggacgaugcggUUAAGGGCGUCAACACCGCUAUUACAACUUUCGCUUCCcagacgacucgcccga,
which includes the matching portions of formula (III) shown below:
PNG
media_image4.png
130
710
media_image4.png
Greyscale
Matching (starred) sequences between SEQ ID NO: 53 of the instant claim and SEQ ID NO: 106 of Gold are encompassed by core sequences of the claimed SEQ ID NOs as shown below:
PNG
media_image2.png
138
360
media_image2.png
Greyscale
Gold further teaches the library of ligands of Table 3 that are capable binding specifically to TGF-β1 as well as ligands to TGFβ that are substantially homologous to any of the given ligands and that have substantially the same ability to bind TGFβ or have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind TGFβ and inhibit the function of TGFβ (col. 6, lines 17-27).
It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention that the sequences of Gold, including SEQ ID NO: 106 are encompassed by the instant claim. The claims are at least obvious variants that could be selected by design choice. The SELEX method of identifying ligands that bind to targets including TGF-β1 were well known and routine before the effective filing data (col. 8, lines 17-29) The method comprised selecting ligands (aptamers) with high affinity (col. 9, lines 5-18). As shown in Gold the method can produce a large number of ligands that are capable of binding specifically to TGF-β1 (col. 6, lines 2-5 and Table 3) that can be selected from. The claimed sequences of the claim could be selected as an obvious variant using the method of Gold. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art.
Regarding claim 6, Gold teaches RNA ligands for TGFβ containing 2'-F- modifications. (col 1, lines 38-39).
Regarding claim 7, Gold teaches SEQ ID NO:94 (Fig. 7) which satisfies the requirement of the 1 to 5 nucleotides substituted, deleted, or added within a common shared sequence of the claimed SEQ ID NOs. See alignments below. Core sequences identified in the sequences of Claim 7 are indicated by color in an alignment of the SEQ ID Nos of claim 7.
PNG
media_image5.png
252
665
media_image5.png
Greyscale
Matching blocks are indicated in the alignment of SEQ ID NO: 29 to SEQ ID NO:94 of Gold.
PNG
media_image6.png
161
940
media_image6.png
Greyscale
The identified core sequences of SEQ ID NO: 29 align with Gold SEQ ID NO:94 with fewer than 5 nucleotides substituted, deleted, or added.
Gold further teaches the library of ligands of Table 3 that are capable binding specifically to TGF-β1 as well as ligands to TGFβ that are substantially homologous to any of the given ligands and that have substantially the same ability to bind TGFβ or have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind TGFβ and inhibit the function of TGFβ (col. 6, lines 17-27).
It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention that the sequences of Gold, including SEQ ID NO: 106 are encompassed by the instant claim. The claims are at least obvious variants that could be selected by design choice. The SELEX method of identifying ligands that bind to targets including TGF-β1 were well known and routine before the effective filing data (col. 8, lines 17-29) The method comprised selecting ligands (aptamers) with high affinity (col. 9, lines 5-18). As shown in Gold the method can produce a large number of ligands that are capable of binding specifically to TGF-β1 (col. 6, lines 2-5 and Table 3) that can be selected from. The claimed sequences of the claim could be selected as an obvious variant using the method of Gold. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art.
Regarding claim 8, Gold teaches that nucleic acid ligands, including SEQ ID NO. 106 were identified from degenerate libraries containing 20, 30 or 40 random positions (col. 12, lines 24-29 and Table 1). The random nucleotides were flanked by 5’ and 3’ constant regions (col 14, lines 62-64). Gold teaches the sequence of SEQ ID NO. 106 excluding the fixed regions is 38 nucleotides long (UUAAGGGCGUCAACACCGCUAUUACAACUUUCGCUUCC, Table 3, p. 26).
Regarding claim 9, Gold teaches RNA ligands that inhibit the interaction of TGFβ with its receptor (abstract).
Regarding claim 10, Gold teaches a complex comprising one or more nucleic acid ligands to TGFβ covalently linked with a non-immunogenic, high molecular weight compound or lipophilic compound (col 9, lines 55-58). Gold further teaches additional functional groups including polyethylene glycol (col 10, lines 8-10), liposomes (col 10, line 58), and labeling tags (col 12, lines2-4),
Regarding claim 11, Gold teaches combining selected nucleic acid ligands with other compounds in a diagnostic or therapeutic complex (col. 9, lines 29-32). Gold further teaches nucleic acid ligands to TGFβ are useful as pharmaceuticals (col. 13, lines 60-62) for treating TGFβ-mediated pathological conditions (col. 13, lines 63-64).
Regarding claim 12, Gold teaches that the nucleic acid ligands (aptamers) to TGFβ described herein may specifically be used for identification of the TGFβ protein (col 12, lines 6-8). Gold teaches adapting nucleic acid ligands
for diagnostic purposes to allow the user to identify the presence of a given target at a particular locale or concentration (col. 11, lines 61-67). The ability to form binding pairs with the target would trigger a positive signal for diagnostic purposes (i.e. detect the presence of TGFβ) (col. 11, line 67 to col. 12, lines 1-2). Gold teaches that the nucleic acid ligands may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art (col. 11, lines 61-64).Gold further teaches binding between a nucleic acid ligand and target is assayed by contacting the ligands to the target (col. 7, line 50). In a diagnostic method this would require contacting a sample specifically suspected of containing TGFβ, in order to “identify the presence of a given target at a particular locale (col. 11, lines 61-67).
Regarding claim 13, Gold teaches RNA ligands that inhibit the interaction of TGFβ with its receptor (abstract).
Response to Arguments against Claim Rejection - 35 U.S. C § 102
Because claims 2-5 have been canceled, Applicant addresses the anticipation rejection with respect to claims 1 and 6-13. These arguments are responded to here.
The response asserts that the aptamer of the present invention as defined by claim 1 (and claims 6 and 8-12 dependent thereon) comprises a nucleotide sequence consisting of formula (III), (III'), or (III"). The response further asserts that SEQ ID NO: 106 of Gold et al. does not include a nucleotide sequence consisting of formula (III), (III'), or (III’’) and does not anticipate the pending claims (p. 15 of 16).
The response in support of this argument also asserts that the nucleotide following ARACUU is in formulas (III) and (III') of the pending claims but is U in SEQ ID NO: 106 of Gold et al. Similarly, the nucleotide following UAAGGGHG is G in formula (III") of the pending claims but is U in SEQ ID NO: 106 of Gold et al. Furthermore, in the present invention as defined by claim 1 (and claims 6 and 8-12 dependent thereon), the ARACUU motif is located between the second and third set of G bases, whereas, in SEQ ID NO: 106 of Gold et al., the ARACUU motif is located after the fourth set of G bases. (p. 15 of 16).
Applicant's arguments relevant to the new grounds of rejection under 35 U.S.C. 103 documented in this Final Office action have been fully considered but they are not persuasive.
In response to applicant’s argument that SEQ ID NO: 106 of Gold does not comprise a nucleotide sequence consisting of formula (III), (III'), or (III"), examiner notes that language “comprising a nucleotide sequence” encompasses nucleic acids that comprise the full length of a sequence or any portion of the sequence. For purposes of examination, the required sequence has been interpreted under the broadest reasonable interpretation as a sequence incorporating conserved nucleotides across the sequences of claim 1.
One of ordinary skill in the art would have been capable of using the method of Gold to arrive at the instantly claimed aptamers. The aptamers of the instant application are obvious variants of aptamers found using the method of Gold.
The response asserts that the aptamer of the present invention as defined by claim 7 (and its dependent claim 13) comprises a nucleotide sequence of one of SEQ ID NO: 4-6, 9, 11, 13, 17-22, 26-29, and 31 or a variant thereof in which 1-5 nucleotides are substituted, deleted, or added. SEQ ID NO: 106 of Gold et al. does not comprise such a nucleotide sequence (p. 15 of 16).
Applicant's arguments have been fully considered but they are not persuasive.
In response to applicant’s argument, the examiner’s written description rejection is provided above. As written the claim reads on a massive genus of sequences. For purposes of examination, the claim has been interpreted to encompass any sequence that comprises a common shared sequence of the claimed SEQ ID NOs wherein one to five nucleotides are substituted, deleted, or added in the shared sequence. One of ordinary skill in the art would have been capable of using the method of Gold to arrive at the instantly claimed aptamers which encompasses any binding affinity to TGF-b1, and various underlying molecular mechanisms thereof directly or indirectly modulating TGF-b1 medicated signal transduction. The aptamers of the instant application are obvious variants of aptamers found using the method of Gold.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA GRAY whose telephone number is (571)272-0116. The examiner can normally be reached Monday-Friday 8-5 with second Fridays off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, WINSTON SHEN can be reached at (571)272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JESSICA GRAY/Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682