Prosecution Insights
Last updated: October 01, 2026
Application No. 17/625,687

LIPID-MODIFIED OLIGONUCLEOTIDES AND METHODS OF USING THE SAME

Non-Final OA §103§112§DP
Filed
Jan 07, 2022
Priority
Jul 08, 2019 — provisional 62/871,702 +2 more
Examiner
YU, TIAN NMN
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Regents of the University of California
OA Round
3 (Non-Final)
55%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
76%
With Interview

Examiner Intelligence

Grants 55% of resolved cases
55%
Career Allowance Rate
49 granted / 89 resolved
-4.9% vs TC avg
Strong +20% interview lift
Without
With
+20.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
71 currently pending
Career history
151
Total Applications
across all art units

Statute-Specific Performance

§101
10.4%
-29.6% vs TC avg
§103
31.6%
-8.4% vs TC avg
§102
18.2%
-21.8% vs TC avg
§112
29.7%
-10.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 89 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed on May 26, 2026 in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on February 26, 2026 has been entered. Status of Claims / Response to Amendment This office action is in response to an amendment filed on February 26, 2026. Claims 1-2, 4, 6, 9-12, 18-19, 23, 26, 28, 30-31, 52, 78-80, 83-84 and 96-97 were previously pending. Applicant amended claims 52, 78-79, 83-84; cancelled claims 1-2, 4, 6, 9-12, 18-19 and 80; claims 98-104 are newly added. Claims 23, 26, 28, 30-31, 52, 78-79, 83-84 and 96-104 are currently pending, with claims 23, 26, 28 and 30-31 withdrawn. Claims 52, 78-79, 83-84 and 96-104 are under examination. Applicant's claim amendments overcame the following rejections: Rejection of Claims 52 and 96 under 35 U.S.C. 112(b); Rejection of Claims 78-80, 83-84 and 97 in claim 78 under 35 U.S.C. 112(b); Rejection of Claims 83-84 under 35 U.S.C. 112(b); Rejection of Claim 80 under 35 U.S.C. 112(d) ; Rejection of Claims 52 and 96 under 35 U.S.C. 112(a); Provisional rejection of Claim 78 on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 5 of copending Application No. 18/762,349; Provisional rejection of Claim 78 on the ground of nonstatutory double patenting as being unpatentable over claims 12, 17 and 20 of copending Application No. 17/057,569. Declaration Under 37 CFR 1.130: Applicant filed declaration under 37 CFR 1.130 (a) on 02/26/2026, which have been fully considered and found sufficient to disqualify McGinnis as prior art. In particular, paragraph 5 of the declaration includes an unequivocal statement that the subject matter disclosed in McGinnis was obtained directly or indirectly from the joint inventors Zev J. Gartner, David M. Patterson, Eric D. Chow, and Christopher S. McGinnis. Accordingly, the prior rejections of claims 52, 78-80, 83-84 and 96-97 under 35 U.S.C. 103 as being unpatentable over McGinnis, as evidenced by Satija; Ocqueteau, and Weber is hereby withdrawn. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. This office action contains new grounds for rejection necessitated by amendment. Priority The priority date of the instant claims 52, 78-79, 83-84 and 96-104 is 07/08/2019, filling date of the US provisional application NO. 62/871,702. Claim Interpretation -- Updated In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111. For the purpose of applying prior art, both independent claims 52 and 78 recite the term "lipid-conjugated DNA oligonucleotide," which is not expressly defined in the application's disclosure. The specification provides definition for related term "lipid-modified oligonucleotide" as follows: "The term "lipid-modified oligonucleotide", "lipid-DNA", "hydrophobic-anchored oligonucleotide" and similar terms are to be broadly construed to include any oligonucleotide or polynucleotide that is attached by any means to a hydrophobic, lipophilic, or amphiphilic region that can be inserted into a membrane, regardless of whether the "lipid-modified oligonucleotide" ,"lipid-DNA", "hydrophobic-anchored oligonucleotide", or portion thereof is actually inserted into a membrane. "(page 13) Thus, under BRI and consistent with the specification, the term "lipid-conjugated DNA oligonucleotide" is interpreted to have the same meaning as the term "lipid-modified oligonucleotide," defined above. For the purpose of applying prior art, both independent claims 52 and 78 recite DNA oligonucleotides comprising “lipid moiety,” which is a term not expressly defined in the specification. Thus, under BRI and based on the commonly understood meaning by one of ordinary skill in the art, the term "lipid moiety" is interpreted to encompass any element naturally occurring or synthetic that are generally hydrophobic in nature (See Fahy 1, introduction; see also Gartner 2, [0136]). This interpretation is consistent with the instant specification's description of "lipid moiety" (see page 36, lines 4-7 for example). For the purpose of applying prior art, both independent claims 52 and 78 recite DNA oligonucleotides comprising “barcode region, ” which is not expressed defined in the application's disclosure. The specification provides the following relevant description regarding barcode region: "Barcode Regions The barcode oligonucleotides comprise the second primer region operably linked ( e.g., covalently linked) to a barcode region which in turn is operably linked (e.g., covalently linked) to a capture sequence (described below), the barcode region comprising an oligonucleotide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33,34,35,36, 37,38,39,40,41,42,43,44,45,46,47,48,49, 50, 51,52,53, 54, 55, 56,57, 20 58, 59,60,61,62,63,64,65,66,67,68,69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,81, 82,83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 or more nucleotide bases. The oligonucleotide can be DNA, RNA, or modified or synthetic DNA or RNA. " (page 41)[emphasis added] Thus, under BRI, the term "barcode region" without any additional modifier, is interpreted to encompass any oligonucleotide sequences that are at least 2 nucleotide bases long. For the purpose of applying art, both independent claims 52 and 78 recite DNA oligonucleotides comprising "capture sequence," which is not expressly defined in the application's disclosure. The specification provides the following relevant description regarding capture sequence: "In some embodiments, the barcode oligonucleotides comprise the second primer region operably linked (e.g., covalently linked) to the barcode region which in tum is operably linked (e.g., covalently linked) to a capture sequence (described below), the capture sequence comprising an oligonucleotide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50, 51, 52,53,54, 55, 56,57, 58, 59,60,61, 62,63,64,65,66,67,68,69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 or more nucleotide bases. The oligonucleotide can be DNA, RNA, or modified or synthetic DNA or RNA. " (page 42-43)[emphasis added] Thus, under BRI, the term "capture sequence" without any additional modifier, is interpreted to encompass any oligonucleotide sequences that are at least 2 nucleotide bases long. For the purpose of applying prior art, claim 52 recites the term "isolating" in "isolating or identifying nucleic acid from the one or a plurality of cells according to the plurality of oligonucleotides." The application's disclosure does not expressly define the term, but describes isolating as encompassing detection of oligonucleotide barcodes by methods such as sequencing, which may not involve physical isolation of nucleic acids: "In some embodiments, the step of isolating the nucleic acid of the one or plurality of cells of the disclosed method comprises isolating the one or plurality of cells based upon the presence of one or plurality of labeling oligonucleotides, wherein the presence of the one or plurality of labeling oligonucleotides is determined by detection of one of more unique nucleotide sequences corresponding to the one or plurality of labeling oligonucleotides. " (page 6) "The disclosure relates to a method of preparing a library of oligonucleotides expressed by a single cell or multiple cells in isolation, the method of generating the library comprising sequencing RNA or DNA from the one or multiple cells after the one or multiple cells are exposed to one or a plurality of lipid-modified oligonucleotides disclosed herein. In some embodiments, endogenous nucleotides from one or a plurality of cells can be isolated and/or identified by correlating a known signal or frequency of a probe bound to the lipid-modified oligonucleotide to the cell upon which the oligonucleotide was bound. The signal or frequency of the probe can be paired with the source of the endogenous DNA and/or RNA." (page 65) [emphasis added] Therefore, under BRI and in light of the specification, the term "isolating" in this claimed phrase here is interpreted to encompasses barcode sequence detection-based approaches (e.g., detecting specific barcode sequences in sequencing reads to identify transcripts from a specific source labeled by the barcode) that do not necessarily require physical separation. Claims 98 and 102 recite "at least about 75% sequence identity to SEQ ID NO: …" The term "about" is defined in the specification as follows: "The term “about” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods." (page 13, lines 1-4) Thus, under BRI "about" is interpreted as +/- 20% of the claimed value, as this is the broadest range for a numerical value according to the express definition in the disclosure. Accordingly, “at least about 75%” is interpreted to mean at least 75% * (1-20%), which is at least 60%. Claim Objections Claims 52, 78-79, 83-84 and 96-104 are objected to because of the following informalities: In claim 52, lines 3-4 should read: "(a) partitioning each one of a plurality of one or more cells from the sample [[or]]of the tissue" for consistency with the amended preamble. In claim 52, lines 15-16 should read: "(f) correlating the expression profile from each one of the one or more cells to the spatial position of the one or more cells within the sample " for consistency with the amended preamble. Claims 96, 98-100 depend from claim 52 and are objected to for the same reasons. In claim 78, lines 5-9 should read: "(b) exposing the plurality of cells with a plurality of lipid-conjugated DNA oligonucleotides comprising a first lipid moiety, a barcode region, and a capture sequence to embed the lipid-conjugated DNA oligonucleotides within cell membrane of the plurality of cells, wherein the barcode region of each the plurality of lipid-conjugated DNA oligonucleotides is unique for each of the one of plurality of vessels in which the plurality of cells are exposed" for consistency with amended part (a). In claim 78, lines 12-14 should read: "(d) correlating the sequenced nucleic acids from the plurality of cells to the spatial position of the plurality of cells within the tissue according to the barcode region contained in each of the sequenced nucleic acids," for consistency with amended part (a). Claims 79, 83-84, 97 and 101-104 depend from claim 78 and are objected to for the same reasons. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide sequences appearing in the claims 100 and 104 are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Furthermore, the sequence in claims 100 and 104 are not included in sequence listing. Claim Rejections - 35 USC § 112(a) – New Grounds The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 100 and 104 are rejected under 35 U.S.C. 112(a) as failing to comply with the written description requirement. The claims contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 100 and 104 both recite a sequence having 8 N residues and 30 A residues: 5'- CCTTGGCACCCGAGAATTCCANNNNNNNNA30-3' This sequence lacks written description support because the specification and Sequence Listing do not provide support for the claimed sequence. The closest disclosed sequence is SEQ ID NO: 3, which has 6 N residues and 32 A residues. Thus, the sequence in claims 100 and 104 is not SEQ ID NO: 3. Nowhere in the application’s disclosure nor the Sequence Listing discloses the specific nucleotide sequence claimed in claims 100 and 104. Accordingly, claims 100 and 104 lacks written description support under 35 U.S.C. 112(a). In addition, the amendment filed on February 26, 2026 is objected to because it introduces new matter. Specifically, the newly added claims 100 and 104 include oligonucleotide sequence comprising "5'- CCTTGGCACCCGAGAATTCCANNNNNNNNA30-3'" which is not described in the application as originally filed. New matter is required to be cancelled. Claim Rejections - 35 USC § 103 -- New Grounds In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 78-79 and 83-84 are rejected under 35 U.S.C. 103 as being unpatentable over Satija (Satija et al. Spatial reconstruction of single-cell gene expression data. Nat Biotechnol 33, 495–502 (2015). doi.org/10.1038/nbt.3192; cited in past Office Actions), in view of Stoeckius (Stoeckius, et al. Cell Hashing with barcoded antibodies enables multiplexing and doublet detection for single cell genomics. Genome Biol 19, 224 (2018). doi.org/10.1186/s13059-018-1603-1; cited in past Office Actions); and Weber (Weber, Robert J., et al. "Efficient targeting of fatty-acid modified oligonucleotides to live cell membranes through stepwise assembly." Biomacromolecules 15.12 (2014): 4621-4626; cited in past Office Actions), as evidenced by Islam (Islam et al. Characterization of the single-cell transcriptional landscape by highly multiplex RNA-seq. Genome Res. 2011 Jul;21(7):1160-7. doi: 10.1101/gr.110882.110. Epub 2011 May 4. PMID: 21543516; PMCID: PMC3129258; cited in past Office Actions). Regarding claim 78, the claimed invention is an obvious combination of known spatial single-cell analysis methods disclosed in Satija and known cell-labeling approaches using lipid-conjugated oligonucleotides disclosed in Stoeckius and Weber. Satija teaches spatial localization methods comprising single cell RNA sequencing with data analysis approach to accurately perform spatial mapping of single cells from dissociated zebrafish embryos and generate a transcriptome-wide map of spatial patterning (entire document, abstract for example). Regarding specific limitations in claim 78, Satija teaches a method of identifying a spatial expression pattern of a nucleic acid within a tissue of a subject (Abstract), the method comprising: partitioning a plurality of cells from a sample corresponding to a region of the tissue into a plurality of vessels (Fig 2C). Satija teaches applying a single-cell RNA-Seq method based on the SMART template switching method, citing Islam. Satija as evidenced by Islam teaches exposing the cells with a DNA oligonucleotide (Fig. 2C; page 497, left-hand col, para 2, lines 5-7, “template-switch oligonucleotide,” citing Islam as Ref 4; see also exposing step in Islam page 1166, left-hand col, para 5 to right-hand col, para 1), comprising a barcode region (see page 505, left-hand col, line 16, "TSO (5′-AGACGTGTGCTCTTCCGATCTNNNNNrGrGrG-3′; page 497, left-hand col, para 2, lines 5-7, random molecular tag) , wherein the barcode region of the DNA oligonucleotide is unique for each of the one of plurality of vessels in which the plurality of cells are exposed (Islam page 1166, right-hand col, lines 4-6). Satija teaches sequencing nucleic acids captured by a capture sequence (page 497, right-hand col, lines 1-5, 5’ sequencing; see also Fig 2C; for capture sequence, Satija cites Islam in page 497, left-hand col, para 2, ref 4; see in Islam page 1166, left-hand col, para 5, template switch oligo sequence “rGrGrG” in “STRT-V2-n”)”; see also Islam Figure 1 showing the "GGG" capture sequence captures the cDNA-RNA complex in reverse transcription) of the DNA oligonucleotide; and correlating the sequenced nucleic acids from the plurality of cells to the spatial position of the plurality of cells within the tissue according to the barcode region contained in each of the sequenced nucleic acids (page 505, right-hand col, para 5-6; Figure 3). While Satija teaches a spatial analysis method using DNA oligonucleotides comprising capture sequence and barcode region (discussed above), it does not specifically teach using a lipid-conjugated DNA oligonucleotide for cell labeling. However, this feature would have been obvious in view of Stoeckius and Weber. Stoeckius (citing Satija as Ref#31) teaches single cell sequencing methods, referred to as Cell Hashing, where oligo-tagged antibodies against ubiquitously expressed surface proteins uniquely label cells from distinct samples, which can be subsequently pooled. By sequencing these tags alongside the cellular transcriptome, each cell can be assigned to its original sample, robustly identify cross-sample multiplets, and “super-load” commercial droplet-based systems for significant cost reduction (entire document; see Abstract and Fig. 1 for examples). Therefore, Stoeckius’s labeling approach allows the cells to remain intact, which enables pooling and processing of a large quantity of differently labeled cells, thus increasing throughput and processing efficacy, at reduced costs. Regarding specific limitations in claim 78, Stoeckius teaches single cell barcoding oligonucleotide comprising: a barcode region (page 9, left-hand col, para 2: “Hashtag oligo: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTxxxxxxxxxxxxBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A” “xxxxxxxxxxxx” indicates barcode), and a capture sequence (page 9, left-hand col, para 2: “Hashtag oligo” poly A tails). Stoeckius discloses that the specific cell labeling with antibodies-conjugated oligos have limitations: when a cell type of interest does not express these virtually ubiquitous surface proteins, it would result in failure to successfully label and demultiplex these cells (page 8). In view of these limitations of labeling using antibody-conjugated oligos, Stoeckius suggests alternative reagents for attaching an oligo to a cell, including lipid membrane intercalating oligos, or lipid conjugated oligos. And notes the improvements will further enable multiplexing strategies to generalize to diverse experiments regardless of species, tissue, or technology (page 8, right-hand col, lines 8-26): "We however caution that there can be instances when a cell type of interest does not express these virtually ubiquitous surface proteins, which would result in failure to successfully label and demultiplex these cells. With the increasing interest in single nucleus sequencing [23, 24], an additional set of hashing reagents directed against nuclear proteins would further generalize this approach. Beyond antibody/epitope interactions, cell or nucleus hashing could also be performed using alternative means of attaching an oligo to a cell or nucleus, including aptamers [25] or direct chemical conjugation of oligos to cells or nuclei. Indeed, recently described approaches accomplish similar goals through transient transfection of oligos [26], direct oligo to cell conjugation based on NHS chemistry [27], lipid membrane intercalating oligos [28], and viral integration-based genomic barcoding [30]. These improvements will further enable multiplexing strategies to generalize to diverse experiments regardless of species, tissue, or technology." (page 8, right-hand col, lines 8-26) [emphasis added] Therefore, Stoeckius suggests an improvement to the existing single-cell analysis methods such as in Satija, specifically, labeling intact cells with lipid conjugated oligos to increase throughput and processing efficacy, at reduced costs, while further enabling multiplexing. Cell labeling using lipid-conjugated oligonucleotides is a known technique in the life science arts. Weber specifically teaches methods to make and use lipid-conjugated DNA oligonucleotides for cell labeling with "improved efficiency and stability," with the additional benefit of having streamlined synthesis (entire document, see conclusion on page 5 and Scheme 1 for examples). Regarding claim 78, Weber teaches, in great detail, steps for DNA labeling of cells, including specific experiment conditions such as incubation time that allows for the lipid-conjugated DNA oligonucleotides to embed into cell membrane (page 2, right-hand col, para 1, lines 8-9). PNG media_image1.png 414 488 media_image1.png Greyscale Accordingly, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to combine the spatial analysis approach using single-cell RNA sequencing taught by Satija with the approach for intact cell labeling with lipid-conjugated DNA oligonucleotides, as taught by Stoeckius and Weber. Satija teaches a method for using single-cell RNA sequencing data to infer spatial information of cells in situ using barcodes. Stoeckius improves single-cell sequencing workflows by suggesting the use of lipid conjugated, barcoded oligos to label intact cells, enabling pooling for higher throughput processing at reduced costs, and multiplexing. The sequencing reads can then be demultiplexed using the barcodes. Weber provides detailed teaching for lipid-conjugated DNA oligos. Weber specifically teaches improved methods for labeling cells with lipid-conjugated DNA oligos, which does not depend from cell surface protein expression and indiscriminately incorporate into cell membranes, thus overcoming the limitations of antibody-conjugated oligos. Weber also provides streamlined synthesis methods for lipid-conjugated DNA oligos, further supporting their use. Combing these teachings would result in a single-cell sequencing method for spatial analysis that utilizes an oligonucleotide with a single-molecule barcode for spatial analysis as disclosed in Satija, while also labeling cells with a cell or sample-containing vessel level barcode using lipid conjugated, barcoded oligos taught and suggested by Stoeckius and Weber. The skilled artisan would have been motivated to combine these teachings to leverage the potential benefits suggested by Stoeckius and Weber. The combination would have yielded a predictable result of an improved method for single-cell RNA sequencing with spatial analysis, using lipid-conjugated DNA oligo for cell labeling, thereby incorporating the benefits of higher throughput, reduced costs, and broader applicability to various cell types. The person of ordinary skill would have had a reasonable expectation of success in combining these teachings, as they are technically compatible. Both Satija and Stoeckius teach performing single-cell RNA sequencing and data analysis, in fact, Stoeckius cites Satija in its Single-cell RNA processing methods (Page 9, right-hand col, para 3, Ref 31), demonstrating compatibility between the methods. Additionally, Stoeckius suggests cell labeling using lipid-conjugated oligos (discussed above), and Weber teaches methods for making and using lipid-conjugated oligos for cell labeling, thus these teachings are complementary. B) Regarding claim 79, it is obvious in view of the combined teachings of Satija, Stoeckius, and Weber. Weber teaches a first lipid-conjugated DNA oligonucleotide (scheme 1, anchor strand) comprising the first lipid moiety, a first hybridization region and a first primer region; a capture sequence; a second lipid-conjugated DNA oligonucleotide (scheme 1, co-anchor strand) comprising a second lipid moiety, a second hybridization region, wherein the second hybridization region is the reverse complement of the first primer region (scheme 1). Stoeckius teaches that its single cell barcoding oligonucleotide comprising: a barcode region (page 9, left-hand col, para 2: “Hashtag oligo: GTGACTGGAGTTCAGACGTGTGCT CTTCCGATCTxxxxxxxxxxxxBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A” “xxxxxxxxxxxx” indicates barcode) and a capture sequence (page 9, left-hand col, para 2: “Hashtag oligo” poly tails). Accordingly, the oligonucleotides as claimed in claim 79 would have been a predictable, obvious modification in view of the combined teachings, for the same reason discussed above for claim 78. Regarding claims 83-84, Weber specifically teaches the structures in Formula I and II as anchor and co-anchor oligo strands in Scheme 1. Claim 97 is rejected under 35 U.S.C. 103 as being unpatentable over Satija, in view of Stoeckius with Weber, as applied to claims 78-79 above and further in view of Ranu (Ranu et al. individual cells by barcode in pooled sequence libraries. Nucleic Acids Res. 2019 Jan 10;47(1):e4. doi: 10.1093/nar/gky856. PMID: 30256981; PMCID: PMC6326790). Regarding claim 97, Stoeckius teaches that its single cell barcoding oligonucleotide comprising: a barcode region comprising 13 nucleotides and a capture sequence comprising 24 nucleotides (page 9, left-hand col, para 2: “Hashtag oligo: GTGACTGGAGTTCAGACGTGTGCT CTTCCGATCTxxxxxxxxxxxxBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A” “xxxxxxxxxxxx” indicates barcode; poly A tail comprises 24 nucleotides). While Stoeckius does not explicitly teach a barcode region comprising at least 18 nucleotides, this feature would have been obvious, as the length of a barcode is a known result-effective variable subject to optimization. As taught by Ranu, increasing barcode length also increases its complexity, thereby enables more stringent sequence filtering procedure to exclude erroneous reads (page 5, left-hand col, lines 2-6). Accordingly, a person of ordinary skill in the art would have found it obvious to increase the barcode length from 13 to 18, to enable more stringent sequence-filtering procedures and reduce read-errors. Double Patenting- Obvious Type -- New Grounds of Rejections The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 78-79 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 5 and 7 of copending Application No. 18/762,349 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over the claims (claims - 07/02/2024) of the '349 application. Instant claim 78 recites: A method of identifying a spatial expression pattern of a nucleic acid within a tissue of a subject, the method comprising: (a) partitioning a plurality of cells from a sample corresponding to a region of the tissue into a plurality of vessels (‘349 Application, claim 1); (b) exposing the one or plurality of cells with a plurality of lipid-conjugated DNA oligonucleotides comprising a first lipid moiety, a barcode region, and a capture sequence to embed the lipid-conjugated DNA oligonucleotides within cell membrane of the one or plurality of cells, wherein the barcode region of each the plurality of lipid-conjugated DNA oligonucleotides is unique for each of the one of plurality of vessels in which the one or plurality of cells are exposed (‘349 Application, claim 1 and 5); (c) sequencing nucleic acids captured by the capture sequence of the lipid-conjugated DNA oligonucleotides (‘349 Application, claim 1); and (d) correlating the sequenced nucleic acids from the one or plurality of cells to the spatial position of the one or plurality of cells within the tissue according to the barcode region contained in each of the sequenced nucleic acids (‘349 Application, claim 1 and 5). The co-pending application claims partitioning cells corresponding to a region of the same into a vessel. This is an obvious variant of the method in instant claim 78, which requires partitioning cells into a plurality of vessels. A skilled artisan would have found it obvious to partition cells into more than one vessels by sample region, in order to analyze cells from multiple sample regions. Therefore, instant claim 78 is obvious over claims 1 and 5 of the ‘349 application. Therefore, instant claim 79 is obvious over claim 7 of the ‘349 application. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Subject Matter Not Taught/Suggested in Prior Art No references were found teaching or suggesting claims 52 and 101/78, and their dependent claims, but they are objected to in this Office Action for reasons given above. The claims would be allowable if rewritten to overcome the objections and/or rejections under 35 U.S.C. 112 set forth in this Office action and to include all of the limitations of base claims. Claims 52 and 101 recite analogous spatial analysis methods. Both claims require: partitioning cell(s) into vessels3 and uniquely barcoding the cell(s) in each vessel4 using a set of three oligonucleotides, two of which hybridize to the first oligonucleotide, wherein two of the three oligonucleotides are lipid-conjugated. The claimed combination of elements, specifically first partitioning the cells into vessels and then applying a vessel-specific barcode to the partitioned cells using the three oligonucleotides as claimed, is not taught or suggested by the prior art. Additional references have been considered. While Krummel 5 and Weber 6 appear to teach and suggest the claimed lipid-conjugated oligonucleotide construct for labeling cells, they do not teach or suggest the claimed methods as a whole, particularly the required order of first partitioning the cell(s) into vessels and then applying vessel-specific barcodes to the partitioned cells. Krummel teaches methods of barcoding cells with unique oligonucleotide constructs that are lipid conjugated (FIG 1A; [0045] –[0047] foundation construct comprising an anchoring moiety comprising a lipid instead of antibody; see also in claim 6; Fig. 1C; [0020], coding segments comprising single stranded overhangs complementary to sequences 01). Cells within a specific region of a tissue can be uniquely tagged in situ based on their position, such as by selective light activation ([00083-0084]). The tissue can then be dissociated into single cells, and single-cell analysis can be performed while preserving positional-tag information for each cell. Thus, the spatial information of the cells within the tissue can be obtained (abstract). Krummel specifically teaches an oligonucleotide construct for labeling cells with a positional barcode, comprising a lipid-conjugated DNA oligonucleotide partially hybridized to a barcoding oligonucleotide(FIG 1A; [0045] –[0047] foundation construct comprising an anchoring moiety comprising a lipid instead of antibody; see also in claim 6; Fig. 1C; [0020], coding segments comprising single stranded overhangs complementary to sequences 01). Although Krummel teaches oligonucleotide constructs having a single lipid anchor for cell surface labeling and does not expressly teach another lipid-conjugated oligonucleotide, this feature would have been obvious in view of Weber. Weber teaches that, instead of labeling a cell surface with a single lipid-conjugated oligonucleotide, using two lipid-conjugated strands that hybridize to each other improves labeling stability and labeling efficiency (Abstract; page 4625, right-hand col, lines 1-3). Accordingly, a skilled artisan would have found it obvious to modify to foundation construct of Krummel, which comprises a single-stranded oligonucleotide having a single lipid anchor, to include a hybridized oligonucleotide duplex having two lipid anchors as taught by Weber, for improved labeling efficiency and stability. This modification would have predictably yielded an oligonucleotide construct in which the foundation construct comprises a anchor strand and a shorter co-anchor strand, as disclosed in Weber, where the anchor strand is hybridized to the co-anchor strand and also comprises a single-stranded overhand region that hybridizes to additional coding segment, as disclosed in Krummel. However, the combined teachings of Krummel and Weber differ from the claimed method in how barcoding is performed. The combined teachings do not teach the claimed order of first partitioning the cells into vessels and then applying a vessel-specific barcode to the cells. Instead, Krummel teaches applying the barcode to intact tissue first, followed by dissociating the cells and partitioning them into vessels. This labeling approach has clear advantages, including supporting imaging analysis and highly precise selective single-cell labeling using selective illumination ([0067]; [0075];[0079]; [0099]). The real time ability to tag subpopulations of cells in selected states enables acquisition of data that is not possible in bulk labeling methods ([0098]). Therefore, although Krummel and Weber may suggest the claimed oligonucleotide structure, the prior art does not provide a reason to modify Krummel's in situ tissue labeling workflow into the claimed vessel-specific post-partitioning barcoding workflow. Doing so would remove the advantages of Krummel's method, including selective in siu labeling and preservation of spatial information before dissociation. Thus the claimed combination is not taught or suggested by the prior art. Conclusion Claims 52, 78-79, 83-84 and 96-104 are objected to; claims 78-79 and 83-84, 97, 100 and 104 are rejected. No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TIAN NMN YU/Examiner , Art Unit 1681 1 Fahy et al. A comprehensive classification system for lipids. J Lipid Res. 2005 May;46(5):839-61. doi: 10.1194/jlr.E400004-JLR200. Epub 2005 Feb 16; cited in prior office action 2 Gartner (US20140294782A1 - Reprogramming of Cellular Adhesion; Published on 2014-10-02; cited in prior office action) 3 (see in claim 52, part (a) ; see in claim 78, part (a)) 4 (see in claim 52, "(b) exposing the one or plurality of cells corresponding to a region of the sample with a plurality of oligonucleotides to incorporate the plurality of oligonucleotides into the one or plurality of cells" and " a third DNA oligonucleotide comprising… a barcode region… the barcode region is unique to the one of a plurality of vessels"; see in claim 78, "(b) exposing the one or plurality of cells with a plurality of lipid-conjugated DNA oligonucleotides comprising … a barcode region… wherein the barcode region of each the plurality of lipid-conjugated DNA oligonucleotides is unique for each of the one of plurality of vessels in which the one or plurality of cells are exposed") 5 Krummel (WO2019226631A1- Single cell mapping and transcriptome analysis; effective filling date: May 21, 2018) 6 Weber (Weber, Robert J., et al. "Efficient targeting of fatty-acid modified oligonucleotides to live cell membranes through stepwise assembly." Biomacromolecules 15.12 (2014): 4621-4626.)
Read full office action

Prosecution Timeline

Show 3 earlier events
Oct 28, 2025
Response Filed
Nov 26, 2025
Final Rejection mailed — §103, §112, §DP
Feb 26, 2026
Response after Non-Final Action
Feb 26, 2026
Response after Non-Final Action
May 26, 2026
Request for Continued Examination
May 26, 2026
Response after Non-Final Action
May 27, 2026
Response after Non-Final Action
Jul 14, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703882
METHODS OF SEQUENCING ANTIBODY CHAINS FROM HYBRIDOMAS AND KITS FOR PRACTICING SAME
6y 2m to grant Granted Aug 11, 2026
Patent 12698536
ROTAVIRUS GENOTYPE DETECTION METHOD, AND GENE AMPLIFICATION PRIMER SET USED IN SAME
4y 9m to grant Granted Aug 04, 2026
Patent 12686891
SILICA-BASED CHROMATOGRAPHIC PROCESSES FOR ISOLATING NUCLEIC ACID-PROTEIN COMPLEXES AND DETECTING TARGET NUCLEIC ACIDS
3y 1m to grant Granted Jul 21, 2026
Patent 12662702
SEQUENCING POLYNUCLEOTIDES USING NANOPORES
3y 9m to grant Granted Jun 23, 2026
Patent 12644150
MEMBRANE-BASED, IN-GEL LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) SYSTEM AND METHOD FOR DETECTING MICROBES
4y 7m to grant Granted Jun 02, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
55%
Grant Probability
76%
With Interview (+20.4%)
3y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 89 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month