DETAILED CORRESPONDENCE
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This action is in response to the papers filed January 16, 2026. Currently, claims 1, 4, 6-11, 14-15, 19, 21-22, 34, 36-38, 41-42, 47-48 are pending.
All arguments have been thoroughly reviewed but are deemed non-persuasive for the reasons which follow.
This action is FINAL.
Any objections and rejections not reiterated below are hereby withdrawn.
Election/Restrictions
Applicant's election of Group I in the paper filed May 14, 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.03(a)).
Claims 25-28 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim.
The requirement is still deemed proper and is therefore made FINAL.
Priority
This application claims priority to
PNG
media_image1.png
62
550
media_image1.png
Greyscale
Drawings
The drawings are acceptable.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Newly amended Claims 1, 4, 6-11, 14-15, 19, 21, 47-48 are rejected under 35 U.S.C. 103 as being unpatentable over Courtney et al. (J. of Clinical Microbiology, Vol. 42, No. 7, pages 3164-3168, July 2004) in view of Rikihisa et al. (US Patent 6436399) and Untergasser et al. (Primer3Plus, new capabilities and interfaces, Nucleic Acids Research, 2012, Vol. 40, No. 15, 2012) and further in view of Zhao et al. (Experimental Parasitology, Vol. 201, pages 21-25, April 25, 2019).
Courtney teaches a method for detection of Anaplasma phagocytophilum that detects the msp2 gene. Courtney teaches human anaplasmosis was formerly known as human granulocytic ehrlichiosis. Courtney teaches amplifying a 77bp fragment using primer sequences specific for the A. phagocytophilum msp2 gene. Courtney teaches primer sequences specific for the A. phagocytophilum msp2 gene were identified as ApMSP2f (5ATGGAAGGTAGTGTTGGTTATGGTATT) and ApMSP2r (5-TTGGTCTT GAAGCGCTCGTA) to generate a 77-bp fragment by using a TaqMan probe identified as ApMSP2p-HEX (5-TGGTGCCAGGGTTGAGCTTGAGATTG) and labeled at the 5’ and 3’ ends with hexachloro-6-carboxy-fluorescein (HEX) and TAMRA, respectively. These primers/probes are embedded within SEQ ID NO: 1 of the instant application. Thus, amplification with ApMSP2f and ApMSP2r would amplify a fragment of SEQ ID NO: 1. Courtney teaches the amplification products are detected using the TaqMan probe (page 3165, col. 1).
Courtney does not teach amplifying using an isothermal reaction, that is not LAMP, where the msp2 gene comprising SEQ ID NO: 1 or a fragment of 80-120bp length or primers comprising SEQ ID NO: 2-7.
Zhao teaches RPA assays for Anaplasma phagocytophilum is rapid and sensitive isothermal detection method. Zhao teaches the assay is performed at a constant temperature and the assay had a very small detection limit (abstract). RPA is easy to implement and have rapid results along with high specificity and sensitivity. Zhao teaches the assay will be especially useful in resource-limited areas where access to laboratory equipment is limited. Zhao teaches primers may be optimized using TwistAmp Basic kit (section 2.5). Zhao further teaches the RPA parameters may be optimized (section 2.6). Zhao teaches the assay was performed at a constant temperature of 38C. Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention to have analyze the msp2 gene, as taught by Courtney with RPA, as taught by Zhao because RPA is highly advantageous because RPA does not need expensive equipment, is easy to operate, rapid, highly sensitive, specific and these advantages should assist A. phagocytophilum detection in resource limited areas.
With respect to amplifying particular regions of known genes such as msp2, modifying primers to known regions was obvious. It would have been prima facie obvious prior to the effective filing date of the claimed invention for one having ordinary skill in the art apply familiar primer design parameters to yield the primers of SEQ ID NO: 2-7 with a reasonable expectation of success. The full length Anaplasma phagocytophilum msp2 gene sequence was known in the art.
The prior art teaches the 1278bp msp2 gene sequences in Rikihisa et al. A skilled artisan would have applied familiar primer design parameters programmed into familiar, freely available primer design tools in order to yield primers to try such as SEQ ID NOS: 2-7, which are within SEQ ID NO: 1, the msp2 gene. The instant specification teaches the whole genome sequence of A. phagocytophilum was downloaded from NCBI database (accession number NC_007797.1)(see page 25 , para 97 of the specification). The specification further teaches the well known primer3 software (version 0.4.0)(Untergasser 2012) was used to design forward and reverse primers. To this end, a skilled artisan at the time of filing would have designed primers and probes to known sequences (such as the sequences disclosed in the above references) with a high expectation of success. To design such primers constituted routine and conventional optimization at the time of filing. See In re Aller, 220 F.2d 454, at 456 (CCAP 1955) (“where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.”). Numerous references describe how to design and optimize primers and probes for PCR applications. For example, Untergasser teaches how to design primers and probes from known sequences using known online primer/probe design programs for use in PCR assays. Untergasser teaches how to use Primer3Plus online program to design primers and probes to known sequences (Untergasser at pgs. W71-74). In other words, Untergasser provide specific guidance and parameters to optimize primer, probe and PCR assay design to yield optimal results; thus, designing PCR assays for particular applications constitutes well-known routine optimization. Well-known Primer3 computer program can design primers and probes for PCR applications. In addition, selection of specific oligonucleotides for specific Tm represents routine optimization with regard to sequence, length and composition of the oligonucleotide. Such optimization parameters are explicitly recognized in Untergasser. As noted in In re Aller, 105 USPQ 233 at 235, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the primer selection performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
The ordinary artisan would have had a reasonable expectation of success that such primers generated using known sequences as taught by in Rikihisa and disclosed in the specification to detect the same A. phagocytophilum because the claimed primers and probes are functional equivalents of the sequences taught by Courtney. The ordinary artisan would have been motivated to generate a number of said primers to the same sequence to provide flexibility and optimize experimentation (see Untergasser). Selection of specific oligonucleotides for specific Tm represents routine optimization with regard to sequence, length and composition of the oligonucleotide. Such optimization parameters are explicitly recognized in Untergasser. As noted in In re Aller, 105 USPQ 233 at 235, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the primer selection performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
In sum, the claimed primers are prima facie obvious because there was clear motivation to design PCR primers to detect the same A. phagocytophilum sequence; and designing and optimizing such primers constitutes a well-known, routine and conventional technique, the same techniques used in the instant specification which would yield the claimed primers with a reasonable expectation of success.
Applicants should submit secondary evidence of non-obviousness in line with MPEP §§ 716.01-716.02 (e.g. unexpected results evidence).
Claims 34, 36, 41-42 are rejected under 35 U.S.C. 103 as being unpatentable over Courtney et al. (J. of Clinical Microbiology, Vol. 42, No. 7, pages 3164-3168, July 2004) in view of Rikihisa et al. (US Patent 6436399) and Untergasser et al. (Primer3Plus, new capabilities and interfaces, Nucleic Acids Research, 2012, Vol. 40, No. 15, 2012) and further in view of Zhao et al. (Experimental Parasitology, Vol. 201, pages 21-25, April 25, 2019) as applied to Claims 1, 4, 6-11, 14-15, 19, 21 above in view of Bakken et al. (Annals of the NY Academy of Sciences, Vol. 1078, No. 1, pages 236-247, Oct 2006).
Neither Courtney nor Rikihisa and Untergasser nor Zhao teach treating humans with doxycycline who have A. phagocytophilum.
However, Bakken et al. teaches treatment with doxycycline usually results in rapid improvement and cure. Bakken teaches that because of the potential for serious or even fatal infection, it is recommended that all patients who have suspected or documented HGA should be treated with oral or intravenous doxycycline.
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention to have treated patients found to have A. phagocytohilum, using the method of Courtney, according to the teachings of Bakken. Bakken teaches the importance to treat patients with A. phagocytohilum to prevent serious or fatal infection.
Claims 1, 4, 6, 9, 11, 14, 19, 21-22, 34, 37-38, 41-42, 46-48 are rejected under 35 U.S.C. 103 as being unpatentable over dos Santos et al. (Vet. And Animal Science, Vol. 7, No. 100055, March 20, 2019) in view of Rikihisa et al. (US Patent 6436399) and Untergasser et al. (Primer3Plus, new capabilities and interfaces, Nucleic Acids Research, 2012, Vol. 40, No. 15, 2012) and in view of Zhao et al. (Experimental Parasitology, Vol. 201, pages 21-25, April 25, 2019).
dos Santos teaches analysis of Anaplasma phagocytophilum in horses from Rio de Janeriro, Brazil. dos Santos teaches determining the presence and frequency of A.phagocytophilum in horses through serological and molecular methods. dos Santos teaches whole blood samples from 98 horses were obtained and analyzed using TaqMan PCR system to amplify 122bp fragment of msp2 gene. Dos Santos teaches the 903F (5′-AGTTTGACT GGAACA CACCTGATC-3′) and 1024R (5′-CTCGTAACCAATCTCAAGCT CAAC-3′) primer set and a fluorescent hydrolysis probe, 939p- (5′-TTA AGGACAACATGCTTGTAGCT ATGGAAGGCA-3′) were used. These primers and probes are located within SEQ ID NO: 1 of the instant application. Specifically, the forward primer overlaps with nucleotides 1-7 of SEQ ID NO: 1. dos Santos teaches the amplification products are detected using the TaqMan probe (page 3, col. 1).
dos Santos does not teach amplifying using an isothermal reaction, that is not LAMP, where the msp2 gene comprising SEQ ID NO: 1 or a fragment of 80-120bp length or primers comprising SEQ ID NO: 2-7.
However, Zhao teaches RPA assays for Anaplasma phagocytophilum is rapid and sensitive isothermal detection method. Zhao teaches the assay is performed at a constant temperature and the assay had a very small detection limit (abstract). RPA is easy to implement and have rapid results along with high specificity and sensitivity. Zhao teaches the assay will be especially useful in resource-limited areas where access to laboratory equipment is limited. Zhao teaches primers may be optimized using TwistAmp Basic kit (section 2.5). Zhao teaches the assay was performed at a constant temperature of 38C. Zhao further teaches the RPA parameters may be optimized (section 2.6). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention to have analyze the msp2 gene, as taught by Courtney with RPA, as taught by Zhao because RPA is highly advantageous because RPA does not need expensive equipment, is easy to operate, rapid, highly sensitive, specific and these advantages should assist A. phagocytophilum detection in resource limited areas.
Further, modifying primers to known regions was obvious. It would have been prima facie obvious prior to the effective filing date of the claimed invention for one having ordinary skill in the art apply familiar primer design parameters to yield the primers of SEQ ID NO: 2-7 with a reasonable expectation of success. The full length Anaplasma phagocytophilum msp2 gene sequence was known in the art.
The prior art teaches the 1278bp msp2 gene sequences in Rikihisa et al. A skilled artisan would have applied familiar primer design parameters programmed into familiar, freely available primer design tools in order to yield primers to try such as SEQ ID NOS: 2-7, which are within SEQ ID NO: 1, the msp2 gene. The instant specification teaches the whole genome sequence of A. phagocytophium was downloaded from NCBI database (accession number NC_007797.1)(see page 25 , para 97 of the specification). The specification further teaches the well known primer3 software (version 0.4.0)(Untergasser 2012) was used to design forward and reverse primers. To this end, a skilled artisan at the time of filing would have designed primers and probes to known sequences (such as the sequences disclosed in the above references) with a high expectation of success. To design such primers constituted routine and conventional optimization at the time of filing. See In re Aller, 220 F.2d 454, at 456 (CCAP 1955) (“where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.”). Numerous references describe how to design and optimize primers and probes for PCR applications. For example, Untergasser teaches how to design primers and probes from known sequences using known online primer/probe design programs for use in PCR assays. Untergasser teaches how to use Primer3Plus online program to design primers and probes to known sequences (Untergasser at pgs. W71-74). In other words, Untergasser provide specific guidance and parameters to optimize primer, probe and PCR assay design to yield optimal results; thus, designing PCR assays for particular applications constitutes well-known routine optimization. Well-known Primer3 computer program can design primers and probes for PCR applications. In addition, selection of specific oligonucleotides for specific Tm represents routine optimization with regard to sequence, length and composition of the oligonucleotide. Such optimization parameters are explicitly recognized in Untergasser. As noted in In re Aller, 105 USPQ 233 at 235, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the primer selection performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
SEQ ID NO: 1
SEQ ID NO: 2
43-72
SEQ ID NO: 3
54-83
SEQ ID NO: 4
67-96
SEQ ID NO: 5
113-142
SEQ ID NO: 6
141-170
SEQ ID NO: 7
137-166
SEQ ID NO: 1
903F
-17-7
1024R
67-90
The ordinary artisan would have had a reasonable expectation of success that such primers generated using known sequences as taught by in Rikihisa and disclosed in the specification to detect the same A. phagocytophilum because the claimed primers and probes are functional equivalents of the sequences taught by dos Santos. The ordinary artisan would have been motivated to generate a number of said primers to the same sequence to provide flexibility and optimize experimentation (see Untergasser). Selection of specific oligonucleotides for specific Tm represents routine optimization with regard to sequence, length and composition of the oligonucleotide. Such optimization parameters are explicitly recognized in Untergasser. As noted in In re Aller, 105 USPQ 233 at 235, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the primer selection performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
In sum, the claimed primers are prima facie obvious because there was clear motivation to design PCR primers to detect the same A. phagocytohilum sequence; and designing and optimizing such primers constitutes a well-known, routine and conventional technique, the same techniques used in the instant specification which would yield the claimed primers with a reasonable expectation of success.
Applicants should submit secondary evidence of non-obviousness in line with MPEP §§ 716.01-716.02 (e.g. unexpected results evidence).
Claims 34, 37-38, 41-42 are rejected under 35 U.S.C. 103 as being unpatentable over dos Santos et al. (Vet. And Animal Science, Vol. 7, No. 100055, March 20, 2019) in view of Rikihisa et al. (US Patent 6436399) and Untergasser et al. (Primer3Plus, new capabilities and interfaces, Nucleic Acids Research, 2012, Vol. 40, No. 15, 2012) as applied to Claims 1, 4, 6-11, 14-15, 19, 21 in view of Lewis et al. (J. of Equine Vet Science, Vol. 29, NO. 3, pages 160-166, 2009).
Neither dos Santos nor Rikihisa nor Untergasser nor Zhao teach treating horses with doxycycline who have A. phagocytophilum.
However, Lewis et al.. teaches treatment of Equine Granulocytic anaplasmosis in horses with doxycycline.
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention to have treated horses found to have A. phagocytophilum, using the method of dos Santos, according to the teachings of Lewis. Lewis teaches treatment of horses with doxycycline who have A. phagocytophilum to resolve clinical signs.
Claims 1, 4, 6-11, 14-15, 19, 21, 23, 47-48 are rejected under 35 U.S.C. 103 as being unpatentable over Pan et al. (J. of Clinical Microbiology, Vol. 49, No. 12, pages 4117-4120, December 2011) in view of Rikihisa et al. (US Patent 6436399) and Untergasser et al. (Primer3Plus, new capabilities and interfaces, Nucleic Acids Research, 2012, Vol. 40, No. 15, 2012) and in view of Zhao et al. (Experimental Parasitology, Vol. 201, pages 21-25, April 25, 2019).
Pan et al. teaches a rapid, simple, and sensitive detection of Anaplasma phagocytophilum by loop-mediated isothermal amplification of the msp2 gene. Pan teaches amplifying the msp2 gene and detection of amplification products indicates the presence of A. phagocytophilum in the sample. Figure 1 illustrates the names and locations of the target sequences used as primers for the expression site of msp2 LAMP. The primers B1, B2 and probe of LB overlap SEQ ID NO: 1 within the region of SEQ ID NO: 4 and 7. Pan teaches primers were designed for the msp2 gene using PrimerExplorer V4 software (page 4118, col. 1). The LAMP reactions are performed and products were detected by electrophoresis on agarose gels (page 4118, col. 2).
Pan does not teach amplifying using an isothermal reaction, that is not LAMP, where the msp2 gene comprising SEQ ID NO: 1 or a fragment of 80-120bp length or primers comprising SEQ ID NO: 2-7.
Zhao teaches RPA assays for Anaplasma phagocytophilum is rapid and sensitive isothermal detection method. Zhao teaches the assay is performed at a constant temperature and the assay had a very small detection limit (abstract). RPA is easy to implement and have rapid results along with high specificity and sensitivity. Zhao teaches the assay will be especially useful in resource-limited areas where access to laboratory equipment is limited. Zhao teaches primers may be optimized using TwistAmp Basic kit (section 2.5). Zhao teaches the assay was performed at a constant temperature of 38C. Zhao further teaches the RPA parameters may be optimized (section 2.6). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention to have analyze the msp2 gene, as taught by Courtney with RPA, as taught by Zhao because RPA is highly advantageous because RPA does not need expensive equipment, is easy to operate, rapid, highly sensitive, specific and these advantages should assist A. phagocytophilum detection in resource limited areas.
Further, modifying primers to known regions was obvious. It would have been prima facie obvious prior to the effective filing date of the claimed invention for one having ordinary skill in the art apply familiar primer design parameters to yield the primers of SEQ ID NO: 2-7 with a reasonable expectation of success. The full length Anaplasma phagocytophilum msp2 gene sequence was known in the art.
The prior art teaches the 1278bp msp2 gene sequences in Rikihisa et al. A skilled artisan would have applied familiar primer design parameters programmed into familiar, freely available primer design tools in order to yield primers to try such as SEQ ID NOS: 2-7, which are within SEQ ID NO: 1, the msp2 gene. The instant specification teaches the whole genome sequence of A. phagocytophilum was downloaded from NCBI database (accession number NC_007797.1)(see page 25 , para 97 of the specification). The specification further teaches the well known primer3 software (version 0.4.0)(Untergasser 2012) was used to design forward and reverse primers. To this end, a skilled artisan at the time of filing would have designed primers and probes to known sequences (such as the sequences disclosed in the above references) with a high expectation of success. To design such primers constituted routine and conventional optimization at the time of filing. See In re Aller, 220 F.2d 454, at 456 (CCAP 1955) (“where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.”). Numerous references describe how to design and optimize primers and probes for PCR applications. For example, Untergasser teaches how to design primers and probes from known sequences using known online primer/probe design programs for use in PCR assays. Untergasser teaches how to use Primer3Plus online program to design primers and probes to known sequences (Untergasser at pgs. W71-74). In other words, Untergasser provide specific guidance and parameters to optimize primer, probe and PCR assay design to yield optimal results; thus, designing PCR assays for particular applications constitutes well-known routine optimization. Well-known Primer3 computer program can design primers and probes for PCR applications. In addition, selection of specific oligonucleotides for specific Tm represents routine optimization with regard to sequence, length and composition of the oligonucleotide. Such optimization parameters are explicitly recognized in Untergasser. As noted in In re Aller, 105 USPQ 233 at 235, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the primer selection performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
The ordinary artisan would have had a reasonable expectation of success that such primers generated using known sequences as taught by in Rikihisa and disclosed in the specification to detect the same A. phagocytophilum because the claimed primers and probes are functional equivalents of the sequences taught by Pan. The ordinary artisan would have been motivated to generate a number of said primers to the same sequence to provide flexibility and optimize experimentation (see Untergasser). Selection of specific oligonucleotides for specific Tm represents routine optimization with regard to sequence, length and composition of the oligonucleotide. Such optimization parameters are explicitly recognized in Untergasser. As noted in In re Aller, 105 USPQ 233 at 235, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the primer selection performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
In sum, the claimed primers are prima facie obvious because there was clear motivation to design PCR primers to detect the same A. phagocytohilum sequence; and designing and optimizing such primers constitutes a well-known, routine and conventional technique, the same techniques used in the instant specification which would yield the claimed primers with a reasonable expectation of success.
Applicants should submit secondary evidence of non-obviousness in line with MPEP §§ 716.01-716.02 (e.g. unexpected results evidence).
Response to Arguments
The response traverses the rejection. The response asserts Pan teaches “other types of assays as being not useful and not practical”. The response asserts the ordinary artisan would not have been motivated to have used an isothermal amplification that is not LAMP. This argument has been considered but is not convincing because the assays Pan identifies as sophisticated and expensive are nester PCR and real-time PCR. Pan does not teach all isothermal methods are not useful or not practical. Like LAMP, the ordinary artisan would have been motivated to have used RPA because Zho teaches the method is easy to implement and has rapid results along with high specificity and sensitivity. Zhao teaches the assay will be especially useful in resource-limited areas where access to laboratory equipment is limited. Thus for the reasons above and those already of record, the rejection is maintained.
Conclusion
No claims allowable over the art.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JEANINE ANNE GOLDBERG whose telephone number is (571)272-0743. The examiner can normally be reached Monday-Friday 6am-3:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng (Winston) Shen can be reached on (571) 272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEANINE A GOLDBERG/Primary Examiner, Art Unit 1682
February 4, 2026