DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment/Status of Claims
Receipt of Arguments/Remarks filed on 07/09/2026 is acknowledged. Claims 1-6,14,18 and 22-23 stand cancelled. Claims 7-9 and 19-21 were amended. Claims 7-13,15-17 and 19-21 and 24-30 are pending and under examination.
New Rejection Necessitated by Amendment
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description Rejection
Claims 26-28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 26-28 recite “An in vitro method for inhibiting the expression of Janus kinase 1 (JAK1) or Janus Kinase 3 (JAK3) in a cell, the method comprising: (a) introducing into the cell in vitro the double-stranded (ds) ribonucleic acid (RNA), said dsRNA consisting of a sense strand and an antisense strand of claim 24 wherein: the sense strand consists of the nucleotide sequence SEQ ID NO: 5 and the antisense strand consists of the nucleotide sequence SEQ ID NO: 6; and (b) maintaining the cell produced in the introducing (a) for a period of time sufficient to achieve degradation of the mRNA of a JAK1 or JAK3 gene, thereby inhibiting the expression of JAK1 or JAK3 in the cell”.
However, the instant specification discloses that the dsRNA that reduces the expression of human Janus Kinase 1 (JAK1) gene in which the sense strand comprises SEQ ID NO: 5 and the antisense strand comprises SEQ ID NO: 6 (page 5 lines 29-32). In addition, the Tables on page 11 of the instant specification show that the sequences that target JAK3 are the sense strand of SEQ ID NO: 1 and antisense strand of SEQ ID NO: 2, and the sense strand of SEQ ID NO: 3 and the antisense strand of SEQ ID NO: 4, while the sequences that target JAK1 are the sense strand of SEQ ID NO: 5 and antisense strand of SEQ ID NO: 6 and the sense strand of SEQ ID NO: 7 and the antisense strand of SEQ ID NO: 8.
Therefore, as claims 26-28 only recite using the dsRNA consisting of SEQ ID NO: 5 and 6 , the dsRNA would not be able to inhibit the expression of JAK3 as recited in claims 26-28, and therefore the specification does not provide written support for the dsRNA consisting of the sense strand consisting of SEQ ID NO: 5 and the antisense strand consisting of SEQ ID NO: 6 as being able to perform the function of achieving degradation of the mRNA of JAK3 gene, thereby inhibiting the expression of JAK3 in the cell.
Maintained Rejections
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 7,8,16,17,20 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. (US 20140065153, Pub. 6 Mar 2014) as evidenced by NCBI Reference Sequence: NM_00215 (Homo sapiens Janus kinase 3, transcript variant 1, mRNA), publicly available 01 April 1999.
Regarding claims 7,16,17,20 and 21, Christiano et al. teach an siRNA that specifically targets the Jak3 gene, and is any one of the sequences listed in Table 3 (paragraph 0006). Christiano et al. recite a method of inducing hair growth in a subject comprising administering to the subject an effective amount of a Jak inhibitor, and wherein the inhibitor is an siRNA directed to a Jak3 gene and is any one of the sequences listed in Table 3 (claim 13). Christiano et al. teach that siRNA comprises a double-stranded structure containing about 15 to about 50 base pairs, for example about 21 to about 25 base pairs, and having a nucleotide sequence identical or nearly identical to an expressed targe gene or RNA within the cell, and comprises a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (paragraph 0210). Christiano et al. teach sequence information related to Jak3 is accessible in public databases by GenBank Accession number NM_00215 for nucleic acid (paragraph 0150).
Below are the siRNA sequences for Jak3 of Table 3 on page 40 of Christiano et al.:
PNG
media_image1.png
312
255
media_image1.png
Greyscale
Christiano et al. do not teach the sense strand of the siRNA comprises the nucleotide sequence of SEQ ID NO: 3 and the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4, and does not explicitly teach the strands are of identical length.
However, Christiano et al. teach a Jak3 siRNA sequence of “CGATCTTCGAGGAGAGACA” as seen above in Table 3, which is 19 nucleotides in length and therefore the antisense strand which would have the corresponding antisense sequence to the above sequence. Christiano et al. teach the mRNA sequence of Jak3 was publicly available before the effective filing date in paragraph 0150 as GenBank Accession number NM_00215. A nucleotide blast of the sense sequence of instant SEQ ID NO: 3 shows that nucleotides 2554-2574 of JAK3 transcript variant 1 of NCBI Sequence ID NM_00215 aligns with all 21 nucleotides of the sense strand of instant SEQ ID NO: 3.
PNG
media_image2.png
225
562
media_image2.png
Greyscale
A nucleotide blast of the Jak3 siRNA sequence CGATCTTCGAGGAGAGACA of Christiano in Table 3 aligns with nucleotides 2494-2512 of JAK3 transcript variant 1 of NCBI Sequence ID NM_000215.
PNG
media_image3.png
218
569
media_image3.png
Greyscale
Therefore, it can be seen that the region of Jak3 targeted by the siRNA of Christiano et al. is very close to the region of Jak3 that instant SEQ ID NO: 3 aligns with, therefore providing motivation for targeting this region of Jak3.
Regarding claim 8, Christiano et al. teach pharmaceutical compositions for use in accordance with the invention can be formulated in a conventional manner using one or more physiologically acceptable carriers (paragraph 0280), and an inhibitor of the invention can be incorporated into pharmaceutical compositions suitable for administration, for example the inhibitor and a pharmaceutically acceptable carrier (paragraph 0309).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the siRNA that targets nucleotides 2494-2512 of Jak3 of NM_00215 of Christiano et al. to target the nearby regions of Jak3 including nucleotides 2554-2574 of Jak3 of NM_00215 to arrive at an siRNA comprising a sense sequence of instant SEQ ID NO: 3 and antisense sequence of SEQ ID NO: 4, and wherein the siRNA would consist of at most 50 nucleotides based on the taught length of 21-25 base pairs with a reasonable expectation of success. There would be a reasonable expectation of success since Christiano et al. teach Jak3 targeting siRNA which targets a region (nucleotides 2494-2512 of JAK3) that is very close to that of instant SEQ ID NOs: 3 and 4 (nt 2554-2574 of JAK3), and because Christiano et al. teach siRNA can be about 21 to about 25 base pairs in length. An ordinary artisan knowing the mRNA sequence of Jak3 taught by Christiano et al. as being publicly available as NM_00215 and the taught lengths of siRNA comprising about 21-25 base pairs, as well as the region of Jak3 to target would be able to arrive at the instant sequences of SEQ ID NO: 3 and 4 with a reasonable expectation of success. As the range of 21-25 base pairs is taught by Christiano et al., the ordinary artisan could also design each strand of siRNA to consist of at most 24 nucleotides, as well as design the sense and antisense strands to be of the same length. As there are only two options, of either the strands being the same length or a different length, it would be obvious to provide both strands to have the same length. One of ordinary skill in the art would have been motivated to do so because Christiano et al. recites a method of inducing hair growth in a subject comprising administering to the subject an effective amount of a Jak inhibitor, and wherein the inhibitor is an siRNA directed to a Jak3 gene and is any one of the sequences listed in Table 3 (claim 13), and therefore would be motivated to provide an siRNA directed to Jak3 for inducing hair growth.
Accordingly, the limitations of claims 7,8,16,17,20 and 21 would have been prima facie obvious to one of ordinary skill in the art.
Response to Arguments
Applicant's arguments, filed 07/09/2026 have been fully considered but they are not persuasive.
Applicant argues on page 10, that regarding the Examiner’s position that the claimed sequences target a “nearby region” of JAK3 does not establish obviousness, as in the field of RNA interference, target site selection is highly sensitive, and small positional changes can lead to substantial differences in activity, and the prior art provides no teaching or suggestion to select the specific region recited in the claims. Applicant argues that Christiano et al. provides specific siRNA sequences and that a person of ordinary skill in the art would have been motivated to use those disclosed sequences rather than modify them to arrive at a different sequence without clear guidance, and the Examiner’s position relies upon hindsight. Applicant argues that the mere public availability of the JAK3 mRNA sequence does not render all possible siRNA target that sequence obvious, and the identification of an effective siRNA require more than routine selection and involves substantial experimentation and unpredictability. Applicant argues on page 11 the Examiner has not established a reasonable expectation of success, as the cited prior art does not teach or suggest the claimed invention, there is no proper motivation to combine the references and no reasonable expectation of success.
This is not found persuasive. Claims 7,8,16,17,20 and 21 are all product claims and do not recite any function. Note: MPEP 2111.02 "the patentability of apparatus or composition claims depends on the claimed structure, not on the use or purpose of that structure." Catalina Mktg. Int'l, Inc. v. Coolsavings.com, Inc., 289 F.3d 801,809 (Fed. Cir. 2002). Therefore, as no functional limitations are recited in these claims regarding the effect of the claimed sequences, the Examiner maintains that given the teachings of Christiano et al. regarding siRNAs and motivation to target JAK3, as well as the siRNA “CGATCTTCGAGGAGAGACA” targeting a region near to that of instant SEQ ID NO: 3 and 4, the lengths of the siRNAs and the target sequence of JAK3 being publicly available, that there would be a reasonable expectation of success at arriving at instant sequences of SEQ ID NO: 3 and 4. Obviousness does not require absolute predictability, however, at least some degree of predictability is required. Evidence showing there was no reasonable expectation of success may support a conclusion of nonobviousness. NOTE: MPEP 2143.02.
In addition, any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected. An unexpected property or result must actually be unexpected and of statistical and practical significance. The burden is on the applicant to establish the results are in fact unexpected, unobvious and of statistical and practical significance. See MPEP 716.02. In the absence of unexpected results or evidence showing no reasonable expectation of success, which Applicant has not provided, the Examiner is maintaining the rejection.
Claims 15 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 as applied to claims 7,8,16,17,20 and 21 above, and further in view of Alagia et al. (WIREs RNA 2016, 7:316-329), cited on an IDS.
The teachings of Christiano et al. as evidenced by NM_00215 as applicable to claims 7,8,16,17,20 and 21 are described above.
Christiano et al. as evidenced by NM_00215 do not teach wherein the nucleotide at the 5’ end of the antisense strand of the dsRNA is phosphorylated.
However, before the effective filing date, Alagia et al. teach the optimization of siRNA molecules and advances of the siRNA field to optimized siRNA pharmacokinetic properties (Abstract) and chemical modifications to different parts of the structure of siRNA (page 3, left column). Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand is essential for siRNA efficacy and the phosphorylation of the 5’-end is required for strand loading and proper Ago2-mediated cleavage (page 4, left column, The Anchor Site).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to provide the modified siRNA of Christiano et al. as evidenced by NM_00215 with the teaching of Alagia et al. regarding the phosphorylation of the nucleotide at the 5’ end of the guide strand, to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success because this would have amounted to applying a known technique (phosphorylation of 5’ end of the guide strand) to a known product ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to do so, because Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand (the antisense strand) is essential for siRNA efficacy and for proper strand loading and Ago2-mediated cleavage, and would make obvious the limitations of claims 15 and 19.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Response to Arguments
Applicant's arguments, filed 07/09/2026 have been fully considered but they are not persuasive.
Applicant argues on page 11 that the rejection is based on Christiano et al. and NCBI Reference sequence NM_00215 and is addressed above. Alagia et al. describes general chemical modifications without directing one of ordinary skill toward the claimed invention.
This is not found persuasive. The Examiner has responded to the arguments regarding Christiano et al. and NCBI Reference sequence NM_00215 above and as no additional arguments are provided, no additional arguments are provided by the Examiner.
Claims 17 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 as applied to claims 7,8,16,17,20 and 21 above, and further in view of Yuan et al. (Human Gene Therapy 23:524-532, May 2012).
The teachings of Christiano et al. as evidenced by NM_00215 as applicable to claims 7,8,16 and 20 are described above. The examiner included claims 17 and 21 in the rejection above as unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 based on a case of obviousness as only having two options of either the strands being the same length or a different length.
Christiano et al. as evidenced by NM_00215 do not explicitly teach wherein the two strands of the JAK3 siRNA are of identical length.
Before the effective filing date, Yuan et al. taught the most widely used siRNA structure consists of double-stranded RNA with 19 base pairs and 2-nucleotide overhangs at the 3’ end of both strands (19+2) (Abstract). Therefore, Yuan et al. teach siRNA wherein both strands are of identical length (21 nucleotides). Yuan et al. taught an siRNA which is siCCR5_19+2 shown below (Fig. 1A). The overhang on each 3’ end of each strand can be seen but each strand is of the same length.
PNG
media_image4.png
66
389
media_image4.png
Greyscale
siCCR5_19+2 is taught as efficiently knocking down CCR5 mRNA levels and CCR5 expression (Figures 1B and C).
PNG
media_image5.png
226
361
media_image5.png
Greyscale
PNG
media_image6.png
202
312
media_image6.png
Greyscale
Therefore, it would have been obvious to one of ordinary skill in the art to have designed the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 to have the two strands of the siRNA to be of identical length based on the teachings of Yuan et al. with a reasonable expectation of success. There would be a reasonable expectation of success, because both Christiano et al. and Yuan et al. pertain to siRNAs and are in the same field of endeavor. One of ordinary skill in the art would be motivated to provide the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 to have identical lengths in both strands of the siRNA, because Yuan et al. taught the most widely used siRNA structure consists of double-stranded RNA with 19 base pairs and 2-nucleotide overhangs at the 3’ end of both strands (19+2) and therefore that both strands had the same length and showed that this design provided efficient knockdown of the mRNA of the target gene and expression levels (CCR5).
Accordingly, the limitations of claims 17 and 21 would have been prima facie obvious to one of ordinary skill in the art.
Response to Arguments
Applicant's arguments, filed 07/09/2026 have been fully considered but they are not persuasive.
Applicant argues on page 12 that the rejection is based on Christiano et al. and NCBI Reference sequence NM_00215 and is addressed above. Yuan et al. describes siRNA structural features but does not suggest the claimed sequences and does not address the deficiencies of the two primary references.
This is not found persuasive. The Examiner has responded to the arguments regarding Christiano et al. and NCBI Reference sequence NM_00215 above and as no additional arguments are provided, no additional arguments are provided by the Examiner.
Claims 9,10,12 and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 as applied to claim 7 above, and further in view of Chang et al. (Transplant Immunology 21 (2009) 27-32), cited on an IDS.
The teachings of Christiano et al. as evidenced by NM_00215 as applicable to claim 7 has been described above. Christiano et al. teach an siRNA that specifically targets the Jak3 gene.
Christiano et al. as evidenced by NM_00215 do not teach introducing into a cell in vitro a double-stranded RNA comprising a sense strand of SEQ ID NO: 3 and an antisense strand of SEQ ID NO: 4, and maintaining the cell produced in the introducing for a period of time sufficient to achieve degradation of the mRNA of a JAK1 or JAK3 gene, thereby inhibiting expression of JAK1 or JAK3 in the cell.
Before the effective filing date, Chang et al. taught a study aimed to inhibit JAK3 expression using RNAi to determine allograft tolerance (Abstract). Chang et al. taught the study aimed to demonstrate the siRNA effectively silences immune genes in JAK3 and in vitro immune modulations can be achieved via downregulation of JAK3 expression using siRNA (Section 1.1, page 28). Chang et al. taught JAK3 dsRNA consisting of a sense strand UCUACUUGCAGUCCAGAAUGCCAGC and antisense strand GCUGGCAUUCUGGACUGCAAGUAGA (Section 2.2.2 page 28) and which were transfected into rat basophilic leukemia cells RBL-2H3, using 10nM of the siRNA duplex (Section 2.2.3, page 28). Results of the in vitro transfection of 10nM of siRNA showed downregulation of JAK3 expression in RBL-2H3 cells as more than 84% reduction in JAK3 level 24 hours after siRNA therapy which demonstrated the in vitro suppression of JAK3 expression by siRNA (Section 3.2, page 29).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to use the modified JAK3 siRNA as taught by Christiano et al. as evidenced by NM_00215 that comprises the sense sequence of instant SEQ ID NO: 3 and antisense sequence of instant SEQ ID NO: 4, and introduce the siRNA into a cell in vitro for a period of time sufficient for degradation of the mRNA of JAK3 and inhibiting the expression of JAK3 in the cell based on the teachings of Chang et al. with a reasonable expectation of success. There would be a reasonable expectation of success because both Christiano et al. and Chang et al. pertain to siRNAs that target JAK3, and Christiano et al. teaches siRNAs of 21-25 nucleotides in length, and the siRNA of Chang et al. is 25 nucleotides in length and therefore are relevant art. An ordinary artisan knowing the mRNA sequence of Jak3 taught by Christiano et al. as being publicly available as NM_00215 and the taught lengths of siRNA comprising about 21-25 base pairs, as well as the region of Jak3 to target would be able to arrive at the instant sequences of SEQ ID NO: 3 and 4 with a reasonable expectation of success. As the range of 21-25 base pairs is taught by Christiano et al., the ordinary artisan could also design each strand of siRNA to consist of at most 24 nucleotides. One of ordinary skill in the art would have been motivated to introduce the modified JAK3 siRNA as taught by Christiano et al. as evidenced by NM_00215 that comprises the sense sequence of instant SEQ ID NO: 3 and antisense sequence of instant SEQ ID NO: 4 into a cell in vitro, and maintained the cell for a period of time sufficient to achieve degradation of the mRNA of JAK3 gene, thereby inhibiting the expression of JAK3 in the cell because Chang et al. taught a study aimed to demonstrate the siRNA effectively silences immune genes in JAK3 and in vitro immune modulations can be achieved via downregulation of JAK3 expression using siRNA and taught transfection of JAK3 siRNA comprising a sense and antisense strand into rat basophilic leukemia cells RBL-2H3, using 10nM of the siRNA duplex and results of the in vitro transfection of 10nM of siRNA showed downregulation of JAK3 expression in RBL-2H3 cells as more than 84% reduction in JAK3 level 24 hours after siRNA therapy which demonstrated the in vitro suppression of JAK3 expression by siRNA.
Accordingly, the limitations of claims 9,10,12 and 13 would have been prima facie obvious to one of ordinary skill in the art.
Response to Arguments
Applicant's arguments, filed 07/09/2026 have been fully considered but they are not persuasive.
Applicant argues on page 12 that the rejection is based on Christiano et al. and NCBI Reference sequence NM_00215 and is addressed above. Chang et al. demonstrates in vitro silencing of JAK3 but does not teach or suggest the claimed molecules and does not address the deficiencies of the two primary references.
This is not found persuasive. The Examiner has responded to the arguments regarding Christiano et al. and NCBI Reference sequence NM_00215 above. In addition, as claims 9,10,12 and 13 are method claims rather than product claims as the Examiner argued regarding the product claims above, it is noted that claims 9,10,12 and 13 do not require a specific amount of inhibition of expression of JAK1 or JAK3, and therefore, even inhibiting a very small amount would meet the claim limitations. As stated in the rejection, there would be a reasonable expectation of success because both Christiano et al. and Chang et al. pertain to siRNAs that target JAK3, and Christiano et al. teaches siRNAs of 21-25 nucleotides in length, and the siRNA of Chang et al. is 25 nucleotides in length and therefore are relevant art. An ordinary artisan knowing the mRNA sequence of Jak3 taught by Christiano et al. as being publicly available as NM_00215 and the taught lengths of siRNA comprising about 21-25 base pairs, as well as the region of Jak3 to target would be able to arrive at the instant sequences of SEQ ID NO: 3 and 4 with a reasonable expectation of success. As the range of 21-25 base pairs is taught by Christiano et al., the ordinary artisan could also design each strand of siRNA to consist of at most 24 nucleotides. Without evidence to the contrary, one of ordinary skill would expect that the siRNA would result in some level of inhibition of expression of JAK3 and that there would be a reasonable expectation of success of arriving at the instant claims. Obviousness does not require absolute predictability, however, at least some degree of predictability is required. Evidence showing there was no reasonable expectation of success may support a conclusion of nonobviousness. NOTE: MPEP 2143.02.
For these reasons the rejection is maintained.
Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 in view of Chang et al. as applied to claims 9,10,12 and 13 above and further in view of Alagia et al.
The teachings of Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 and as Chang et al. as applicable to claims 9,10,12 and 13 have been described above.
Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 and as Chang et al. do not teach wherein the nucleotide at the 5’ end of the antisense strand of the dsRNA is phosphorylated.
However, before the effective filing date, Alagia et al. teach the optimization of siRNA molecules and advances of the siRNA field to optimized siRNA pharmacokinetic properties (Abstract) and chemical modifications to different parts of the structure of siRNA (page 3, left column). Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand is essential for siRNA efficacy and the phosphorylation of the 5’-end is required for strand loading and proper Ago2-mediated cleavage (page 4, left column, The Anchor Site).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to further modify the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 used in the method of Chang et al. with the teachings of Alagia et al. regarding the phosphorylation of the nucleotide at the 5’ end of the guide strand, to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success because this would have amounted to applying a known technique (phosphorylation of 5’ end of the guide strand) to a known product (JAK3 siRNA of Christiano et al. as evidenced by NM_00215) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to further modify the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 used in the method of Chang et al. with the teaching of Alagia et al. regarding phosphorylation of the nucleotide at the 5’ end of the antisense strand, because Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand (the antisense strand) is essential for siRNA efficacy and for proper strand loading and Ago2-mediated cleavage.
Accordingly, the limitations of claim 11 would have been prima facie obvious to one of ordinary skill in the art.
Response to Arguments
Applicant's arguments, filed 07/09/2026 have been fully considered but they are not persuasive.
Applicant argues on page 12 that the rejection is based on Christiano et al. and NCBI Reference sequence NM_00215 and Chang et al. and further in view of Alagia et al. and the rejection as based on Christiano et al. and NCBI Reference sequence NM_00215 is addressed above. Alagia et al. describes general chemical modifications without directing one of ordinary skill toward the claimed invention and does not address the deficiencies of the two primary references.
This is not found persuasive. The Examiner has responded to the arguments regarding Christiano et al. and NCBI Reference sequence NM_00215 above and as no new arguments are made, the Examiner is not providing any additional arguments.
Rejections Necessitated by Amendment
Claims 24-27 are rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. (US 20140142160), Published 22 May 2014, in view of Fakhr et al. (Cancer Gene Therapy 2016, 23, 73-82).
Regarding claim 24, Lee et al. teach an inhibitory nucleic acid that specifically binds to, or is complementary to, an RNA that binds to polycomb repressive complex 2 (PRC2), for example SEQ ID NOs: 1-193,049, and the inhibitory nucleic acids are able to interfere with the binding of and function of PRC2 (paragraph 0015). Lee et al. teach that SEQ ID NOs: 1-193,049 represent murine RNA sequences containing portions that have been experimentally determined to bind PRC2 (paragraph 0016). Nucleotides 5-25 of SEQ ID NO: 163,305 of Lee et al. has 100% identity to all 21 nucleotides of instant SEQ ID NO:5, and the sequence of Lee et al. has a length of 46 nucleotides. See alignment below, wherein Qy is instant SEQ ID NO: 5 and Db is SEQ ID NO: 163,305 of Lee et al.:
PNG
media_image7.png
181
574
media_image7.png
Greyscale
Lee et al. teach the inhibitory nucleic acid may be 5-40 bases in length, for example may be one of any of 5,….. 21, 22, 23,24….bases in length (paragraph 0051).
Lee et al. teach the inhibitory nucleic acid may be double-stranded, and can be siRNA or double-stranded RNAi compounds (paragraphs 0048,0051). Lee et al. teach the inhibitory nucleic acid is double-stranded and blunt-ended (paragraph 0051).
SEQ ID NO: 163,305 (Qy) of Lee et al. is 100% complementary to instant SEQ ID NO: 6 (Db), with conservative substitutions but no mismatches:
PNG
media_image8.png
163
575
media_image8.png
Greyscale
While nucleotides 5-25 of SEQ ID NO: 163,305 of Lee et al. has 100% identity to all 21 nucleotides of instant SEQ ID NO:5 and taught dsRNA of various lengths, Lee et al. does not teach the sense strand consists of SEQ ID NO: 5 and the antisense strand consists of SEQ ID NO: 6 as instantly claimed.
Before the effective filing date, Fakhr et al. taught precise design of siRNAs is a critical step owing to the fact that only few changes in the nucleotides within the sequence can alter its functionality, and numerous studies have tried introducing uniform and practical algorithms for selecting the most efficient siRNAs in which suitable design can lead to a more efficient silencing (Introduction, right column). Fakhr et al. taught 19 nucleotide long siRNAs that obtained good results, and that others have used longer siRNAs ranging from 21-29 nucleotides, and that siRNAs from 19-25 nucleotides have shown the same efficiency in silencing. Fakhr et al. taught small siRNAs are better to use for mammalian cells as longer siRNAs can induce mammalian immune response (page 75, left column, first paragraph).
Regarding claim 25, Lee et al. teach pharmaceutical compositions of the inhibitory nucleic acid sequences, formulated with a pharmaceutically acceptable carrier (paragraphs 0788-0789).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention, to have provided nucleotides 5-25 of SEQ ID NO: 163,305 of Lee et al. as a sense strand consisting of 21 nucleotides in length in a double-stranded RNA as taught by Lee et al., and which would therefore comprise the corresponding antisense sequence to the sense sequence, based on the teachings of Fakhr et al. to arrive at the instant claimed sequences with a reasonable expectation of success. There would be a reasonable expectation of success because both Lee et al. and Fakhr et al. pertain to inhibitory nucleic acids. The ordinary artisan would be motivated to do so because Lee et al. taught the inhibitory nucleic acids of the invention include double-stranded RNA, and may be 5-40 bases in length and specifically recites 21 bases in length (paragraph 0051), and Fakhr et al. taught different length siRNAs that had good results, including 19 nucleotide long siRNAs, and longer siRNAs ranging from 21-29 nucleotides, and that siRNAs from 19-25 nucleotides have shown the same efficiency in silencing and also Fakhr et al. taught small siRNAs are better to use for mammalian cells as longer siRNAs can induce mammalian immune response. An ordinary artisan could arrive at a length of 21 nucleotides for the dsRNA consisting of a sense strand consisting of the nucleotide sequence SEQ ID NO: 5 and the antisense sequence consisting of the nucleotide sequence SEQ ID NO: 6 as claimed in claims 24 and 25 based on Lee et al. teaching inhibitory nucleic acids being 5-40 bases in length and specifically recites 21 bases in length and Fakhr et al. teaching siRNAs ranging from 21-29 nucleotides in length have shown good efficiency of silencing, from a finite number of identified, predictable solutions with a reasonable expectation of success.
Regarding claim 26, the instant specification does not define “maintaining the cell produced in the introducing of (a) for a period of time sufficient”. However, the instant examples show transfecting cells with siRNA using Lipofectamine RNAimax for 48 hours (Example 2, pages 17-23). Therefore, art that teaches the same or over-overlapping time reads on “for a period time sufficient”. Lee et al. teach methods of modulating gene expression may be carried out in vitro (paragraph 0017), and teach inhibitory oligonucleotides were designed to target lncRNA, and Hep3B cells were seeded into each well of 24-well plates and transfections were performed with Lipofectamine and the inhibitory oligonucleotides, and at 48 hours post-transfection, RNA was harvested from the Hep3B cells and mRNA levels of ApoE were determined in the presence of the inhibitory oligonucleotide (paragraphs 0883,0886).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention, to have provided a method of introducing into a cell in vitro a dsRNA consisting of nucleotides 5-25 of SEQ ID NO: 163,305 of Lee et al. as a sense strand as taught by Lee et al., and which would therefore comprise the corresponding antisense sequence to the sense sequence and maintain the cell comprising the introduced dsRNA for 48 hours, in view of the teachings of Fakhr et al. to arrive at the instant method with a reasonable expectation of success. There would be a reasonable expectation of success because both Lee et al. and Fakhr et al. pertain to inhibitory nucleic acids, and Lee et al. teach in vitro methods of introducing the inhibitory nucleic acids into cells for the same amount of time that is exemplified in the instant specification. The function of “to achieve degradation of the mRNA of a Jak1 or JAK3 gene, thereby inhibiting expression” is a result that flows from the method steps. The ordinary artisan would be motivated to do so because Lee et al. taught methods of modulating gene expression may be carried out in vitro (paragraph 0017), and that inhibitory oligonucleotides were designed to target lncRNA, and Hep3B cells were seeded into each well of 24-well plates and transfections were performed with Lipofectamine and the inhibitory oligonucleotides, and at 48 hours post-transfection, RNA was harvested from the Hep3B cells and mRNA levels of ApoE were determined in the presence of the inhibitory oligonucleotide (paragraphs 0883,0886).
Regarding claim 27 and the dsRNA concentration of 5 pM to 10 nM, the amount of a specific ingredient in a composition is clearly a result effective parameter that a person of ordinary skill in the art would routinely optimize. Optimization of parameters is a routine practice that would be obvious for a person of ordinary skill in the art to employ and reasonably would expect success. It would have been customary for an artisan of ordinary skill to determine the optimal amount of the inhibitory oligonucleotide of Lee et al. in view of Fakhr et al. in order to best achieve the desired results in a cell in vitro. Where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. In re Aller, 220 F. 2d 454, 105 USPQ 233 (CCPA 1955). NOTE: MPEP 2144.05.
Accordingly, the limitations of claims 24-27 would have been prima facie obvious to one of ordinary skill in the art.
Response to Arguments
Applicant's arguments and amendments, filed 07/09/2026 have been fully considered but they are not persuasive.
Applicant argues on page 8 of response that the cited references fail to teach or suggest the specific nucleotide sequences recited in the present claims, and while Lee et al. discloses broad classes of inhibitory nucleic acids, it does not disclose or direct one of ordinary skill in the art to the claimed sequences, and the Examiner’s reliance on partial sequence similarity does not establish that the specific sequences would have been selected. Applicant argues the art teaches siRNA design is inherently unpredictable, including Fakhr et al. indicating that small changes in nucleotide sequence can significantly affect functionality. Applicant argues the present application shows that among the generated siRNAs, some of the siRNA sequences in particular HJ1D64 was not effective in inhibiting expression of JAK1 (Table 3, page 12, lines 1-3 of specification), which supports the methods to generate siRNA cannot guarantee to provide siRNAs all having adequate efficacy and safety. The dsRNA as currently claimed are remarkable or unpredictable by a person skilled in the art and one of ordinary skill in the art would not have had a reasonable expectation of success in selecting the claimed sequences from the multitude of possible alternatives. Applicant argues although the references disclose ranges of nucleotides lengths, this does not provide motivation to arrive at the claimed combination of sequence, length and structural features and the Examiner’s rationale relies on hindsight reconstruction using Applicant’s disclosure as a blueprint.
This is not found persuasive. First, regarding claims 24 and 25, these are product claims and do not recite any function, and do not require inhibiting a specific gene, and merely require the sequences. Note: MPEP 2111.02 "the patentability of apparatus or composition claims depends on the claimed structure, not on the use or purpose of that structure." Catalina Mktg. Int'l, Inc. v. Coolsavings.com, Inc., 289 F.3d 801,809 (Fed. Cir. 2002). Therefore, as no functional limitations are recited in these claims regarding the effect of the claimed sequences, the Examiner maintains that given the teachings of Lee et al. and Fakhr et al. regarding the sequences and effective lengths of siRNA known in the art, that there would be a reasonable expectation of success of picking any 21 nucleotide segment in the sense sequence of Lee et al. and provide the corresponding antisense sequence to arrive at the instant claims.
Regarding the method claims, the art teaches maintaining the cell produced in the introducing step for the same period of time sufficient as the instant Examples (48 hours), and therefore when these conditions are met, the rest of the claim flows from those method steps. Although the reference is silent about degrading the mRNA of a JAK1 or JAK3 gene, thereby inhibiting the expression of JAK1 or JAK3 in the cells, it does not appear that the claim language or limitations result in a manipulative difference in the method steps when compared to the prior art disclosure. See Bristol-Myers Squibb Company v. Ben Venue Laboratories, 58 USPQ2d 1508 (CAFC 2001). “It is a general rule that merely discovering and claiming a new benefit of an old process cannot render the process again patentable.” In re Woodruff, 16 USPQ2d 1934, 1936 (Fed. Cir. 1990). Granting a patent on the discovery of an unknown but inherent function would remove from the public that which is in the public domain by virtue of its inclusion in, or obviousness from, the prior art. In re Baxter Travenol Labs, 21 USPQ2d 1281 (Fed. Cir. 1991). See M.P.E.P. 2145.
In addition, regarding predictability, obviousness does not require absolute predictability, however, at least some degree of predictability is required. Evidence showing there was no reasonable expectation of success may support a conclusion of nonobviousness. NOTE: MPEP 2143.02.
Regarding Applicant’s argument about hindsight reconstruction, “[a]ny judgment on obviousness is in a sense necessarily a reconstruction based on hindsight reasoning, but so long as it takes into account only knowledge which was within the level of ordinary skill in the art at the time the claimed invention was made and does not include knowledge gleaned only from applicant’s disclosure, such a reconstruction is proper." In re McLaughlin, 443 F.2d 1392, 1395, 170 USPQ 209, 212 (CCPA 1971).
Claims 28-30 are rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. and Fakhr et al. as applied to claims 24-27 above, and further in view of Alagia et al. (WIREs RNA 2016, 7:316-329), cited on an IDS.
The teachings of Lee et al. and Fakhr et al. as applicable to claims 24-27 are described above.
Lee et al. and Fakhr et al. do not teach wherein the nucleotide at the 5’ end of the antisense strand of the dsRNA is phosphorylated.
However, before the effective filing date, Alagia et al. teach the optimization of siRNA molecules and advances of the siRNA field to optimized siRNA pharmacokinetic properties (Abstract) and chemical modifications to different parts of the structure of siRNA (page 3, left column). Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand is essential for siRNA efficacy and the phosphorylation of the 5’-end is required for strand loading and proper Ago2-mediated cleavage (page 4, left column, The Anchor Site).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the dsRNA inhibitory nucleic acid molecule of Lee et al. and Fakhr et al., with the teachings of Alagia et al. regarding the phosphorylation of the nucleotide at the 5’ end of the guide strand, to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success because this would have amounted to applying a known technique (phosphorylation of 5’ end of the guide strand) to a known product (the inhibitory dsRNA of Lee et al. and Fakhr et al.) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to modify the dsRNA product of Lee et al. and Fakhr et al. with the teaching of Alagia et al, because Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand (the antisense strand) is essential for siRNA efficacy and for proper strand loading and Ago2-mediated cleavage, and would make obvious the limitations of claims 28-30.
Response to Arguments
Applicant's arguments, filed 07/09/2026 have been fully considered but they are not persuasive.
Applicant argues on page 9 that the rejection based on Lee et al. and Fakhr et al. is addressed above, and that Alagia et al. describes general modifications such as 5’ phosphorylation and does not suggest applying such modifications to the claimed sequences and does not remedy the deficiencies of the primary references.
This is not found persuasive. The Examiner has responded to the arguments regarding Lee et al. and Fakhr et al. above and as no new arguments are made, the Examiner is not providing any additional arguments.
Conclusion
Claims 7-13,15-17,19-21 and 24-30 are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/STEPHANIE L SULLIVAN/Examiner, Art Unit 1635
/ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Prosecution Insights