Prosecution Insights
Last updated: April 19, 2026
Application No. 17/627,606

SIRNA SEQUENCES TARGETING THE EXPRESSION OF HUMAN GENES JAK1 OR JAK3 FOR A THERAPEUTIC USE

Non-Final OA §103
Filed
Jan 14, 2022
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
COMMISSARIAT À L'ÉNERGIE ATOMIQUE ET AUX ÉNERGIES ALTERNATIVES
OA Round
3 (Non-Final)
62%
Grant Probability
Moderate
3-4
OA Rounds
3y 6m
To Grant
98%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allow Rate
38 granted / 61 resolved
+2.3% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
58 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
30.8%
-9.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 01/30/2026 has been entered. Response to Amendment/Status of Claims Receipt of Arguments/Remarks filed on 01/30/2026 is acknowledged. Claims 1-6,14,18 and 22-23 were/stand cancelled. Claims 7 and 9 were amended. Claims 7-13,15-17 and 19-21 are pending and under examination. Response to Arguments Applicant's arguments and amendments, see page 6, filed 01/30/2026, regarding the objections to the drawings have been fully considered and are persuasive as Applicant’s Petition to Accept Color Drawings has been accepted and a new color version of these figures was previously submitted with Applicant’s petition. Therefore, the objection has been withdrawn. Applicant’s arguments and amendments, see page 6, filed 01/30/2026, with respect to the 35 U.S.C. 112(b) rejection of claims 9-13 have been fully considered and are persuasive due to the amendments to claim 9 which no longer recites dependency on claim 2. The 35 U.S.C. 112(b) rejection of claims 9-13 has been withdrawn. Applicant’s arguments and amendments, see page 7, filed 01/30/2026, with respect to the 35 U.S.C. 112(a) Scope of Enablement rejection of claims 2-7,9-13,15-17,22 and 23 have been fully considered and has been found persuasive due to the cancellation of claims 2-6 and 22-23 and amendment to claim 7 removing “adapted for use in human therapy”. The Scope of Enablement ejection of claims 2-7,9-13,15-17,22 and 23 has been withdrawn. Applicant’s arguments, see pages 8-10, filed 01/30/2026 with respect to the 35 U.S.C. 102(a)(1) rejection of claims 7,8,17 and 21 as anticipated by Lee, have been fully considered and are found persuasive as the examiner agrees that Lee does not anticipate the instant claims. Therefore the rejection has been withdrawn. However, upon further consideration a new ground of rejection is made in view of a case of obviousness regarding the sequence and lengths taught by Lee and the art. Applicant’s arguments, see page 11, filed 01/30/2026 with respect to the 35 U.S.C. 103 rejection of claims 15 and 19 over Lee and Alagia et al. have been fully considered and are found persuasive. Therefore the rejection has been withdrawn. However, upon further consideration a new ground of rejection is made in view of a case of obviousness. Applicant did not respond to the 35 U.S.C. 103 rejection of claims 16 and 20 as unpatentable over Lee et al. The examiner is withdrawing the 35 U.S.C. 103 rejection of claims 16 and 20 as unpatentable over Lee et al. and making a new ground of rejection based on a case of obviousness. See the new rejections below. Claim Rejections - 35 USC § 103 The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 7,8,16,17,20 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. (US 20140142160), Published 22 May 2014, in view of Fakhr et al. (Cancer Gene Therapy 2016, 23, 73-82). Regarding claims 7,16,17,20 and 21 Lee et al. teach an inhibitory nucleic acid that specifically binds to, or is complementary to, an RNA that binds to polycomb repressive complex 2 (PRC2), for example SEQ ID NOs: 1-193,049, and the inhibitory nucleic acids are able to interfere with the binding of and function of PRC2 (paragraph 0015). Lee et al. teach that SEQ ID NOs: 1-193,049 represent murine RNA sequences containing portions that have been experimentally determined to bind PRC2 (paragraph 0016). Nucleotides 5-25 of SEQ ID NO: 163,305 of Lee et al. has 100% identity to all 21 nucleotides of instant SEQ ID NO:5, and the sequence of Lee et al. has a length of 46 nucleotides. See alignment below, wherein Qy is instant SEQ ID NO: 5 and Db is SEQ ID NO: 163,305 of Lee et al.: PNG media_image1.png 181 574 media_image1.png Greyscale Lee et al. teach the inhibitory nucleic acid may be 5-40 bases in length, for example may be one of any of 5,….. 21, 22, 23,24….bases in length (paragraph 0051). Lee et al. teach the inhibitory nucleic acid may be double-stranded, and can be siRNA or double-stranded RNAi compounds (paragraphs 0048,0051). Lee et al. teach the inhibitory nucleic acid is double-stranded and blunt-ended (paragraph 0051). SEQ ID NO: 163,305 (Qy) of Lee et al. is 100% complementary to instant SEQ ID NO: 6 (Db), with conservative substitutions but no mismatches: PNG media_image2.png 163 575 media_image2.png Greyscale While nucleotides 5-25 of SEQ ID NO: 163,305 of Lee et al. has 100% identity to all 21 nucleotides of instant SEQ ID NO:5, Lee et al. does not teach that the double-stranded RNA consists of at most 60 nucleotides, or each strand of the dsRNA consists of at most 24 nucleotides. Before the effective filing date, Fakhr et al. taught precise design of siRNAs is a critical step owing to the fact that only few changes in the nucleotides within the sequence can alter its functionality, and numerous studies have tried to introducing uniform and practical algorithms for selecting the most efficient siRNAs in which suitable design can lead to a more efficient silencing (Introduction, right column). Fakhr et al. taught 19 nucleotide long siRNAs that obtained good results, and that others have used longer siRNAs ranging from 21-29 nucleotides, and that siRNAs from 19-25 nucleotides have shown the same efficiency in silencing. Fakhr et al. taught small siRNAs are better to use for mammalian cells as longer siRNAs can induce mammalian immune response (page 75, left column, first paragraph). Regarding claim 8, Lee et al. teach pharmaceutical compositions of the inhibitory nucleic acid sequences, formulated with a pharmaceutically acceptable carrier (paragraphs 0788-0789). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention, to have provided nucleotides 5-25 of SEQ ID NO: 163,305 of Lee et al. as a sense strand of 21 nucleotides in length in a double-stranded RNA as taught by Lee et al., and which would therefore comprise the corresponding antisense sequence to the sense sequence, based on the teachings of Fakhr et al. with a reasonable expectation of success. There would be a reasonable expectation of success because both Lee et al. and Fakhr et al. pertain to inhibitory nucleic acids. The ordinary artisan would be motivated to do so because Lee et al. taught the inhibitory nucleic acids of the invention include double-stranded RNA, and may be 5-40 bases in length and specifically recites 21,22,23 or 24 bases in length (paragraph 0051), and Fakhr et al. taught different length siRNAs that had good results, including 19 nucleotide long siRNAs, and longer siRNAs ranging from 21-29 nucleotides, and that siRNAs from 19-25 nucleotides have shown the same efficiency in silencing and also Fakhr et al. taught small siRNAs are better to use for mammalian cells as longer siRNAs can induce mammalian immune response. An ordinary artisan could arrive at a length of the dsRNA consisting of no more than 60 nucleotides as in claim 7, as well as each strand consisting of at most 24 nucleotides as in claims 16 and 20 based on Lee et al. teaching inhibitory nucleic acids being 5-40 bases in length and specifically recites 21,22,23 or 24 bases in length and Fakhr et al. teaching siRNAs ranging from 21-29 nucleotides in length have shown good efficiency of silencing, from a finite number of identified, predictable solutions with a reasonable expectation of success. Accordingly, the limitations of claims 7,8,16,17,20 and 21 would have been prima facie obvious to one of ordinary skill in the art. Claims 15 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. and Fakhr et al. as applied to claims 7,8,16,17,20 and 21 above, and further in view of Alagia et al. (WIREs RNA 2016, 7:316-329), cited on an IDS. The teachings of Lee et al. and Fakhr et al. as applicable to claims 7,8,16,17,20 and 21 are described above. Lee et al. and Fakhr et al. do not teach wherein the nucleotide at the 5’ end of the antisense strand of the dsRNA is phosphorylated. However, before the effective filing date, Alagia et al. teach the optimization of siRNA molecules and advances of the siRNA field to optimized siRNA pharmacokinetic properties (Abstract) and chemical modifications to different parts of the structure of siRNA (page 3, left column). Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand is essential for siRNA efficacy and the phosphorylation of the 5’-end is required for strand loading and proper Ago2-mediated cleavage (page 4, left column, The Anchor Site). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the dsRNA inhibitory nucleic acid molecule of Lee et al. and Fakhr et al., with the teachings of Alagia et al. regarding the phosphorylation of the nucleotide at the 5’ end of the guide strand, to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success because this would have amounted to applying a known technique (phosphorylation of 5’ end of the guide strand) to a known product (the inhibitory dsRNA of Lee et al. and Fakhr et al.) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to modify the dsRNA product of Lee et al. and Fakhr et al. with the teaching of Alagia et al, because Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand (the antisense strand) is essential for siRNA efficacy and for proper strand loading and Ago2-mediated cleavage, and would make obvious the limitations of claims 15 and 19. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Claims 7,8,16,17,20 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. (US 20140065153, Pub. 6 Mar 2014) as evidenced by NCBI Reference Sequence: NM_00215 (Homo sapiens Janus kinase 3, transcript variant 1, mRNA), publicly available 01 April 1999. Regarding claims 7,16,17,20 and 21, Christiano et al. teach an siRNA that specifically targets the Jak3 gene, and is any one of the sequences listed in Table 3 (paragraph 0006). Christiano et al. recite a method of inducing hair growth in a subject comprising administering to the subject an effective amount of a Jak inhibitor, and wherein the inhibitor is an siRNA directed to a Jak3 gene and is any one of the sequences listed in Table 3 (claim 13). Christiano et al. teach that siRNA comprises a double-stranded structure containing about 15 to about 50 base pairs, for example about 21 to about 25 base pairs, and having a nucleotide sequence identical or nearly identical to an expressed targe gene or RNA within the cell, and comprises a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (paragraph 0210). Christiano et al. teach sequence information related to Jak3 is accessible in public databases by GenBank Accession number NM_00215 for nucleic acid (paragraph 0150). Below are the siRNA sequences for Jak3 of Table 3 on page 40 of Christiano et al.: PNG media_image3.png 312 255 media_image3.png Greyscale Christiano et al. do not teach the sense strand of the siRNA comprises the nucleotide sequence of SEQ ID NO: 3 and the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4, and does not explicitly teach the strands are of identical length. However, Christiano et al. teach a Jak3 siRNA sequence of “CGATCTTCGAGGAGAGACA” as seen above in Table 3, which is 19 nucleotides in length and therefore the antisense strand which would have the corresponding antisense sequence to the above sequence. Christiano et al. teach the mRNA sequence of Jak3 was publicly available before the effective filing date in paragraph 0150 as GenBank Accession number NM_00215. A nucleotide blast of the sense sequence of instant SEQ ID NO: 3 shows that nucleotides 2554-2574 of JAK3 transcript variant 1 of NCBI Sequence ID NM_00215 aligns with all 21 nucleotides of the sense strand of instant SEQ ID NO: 3. PNG media_image4.png 225 562 media_image4.png Greyscale A nucleotide blast of the Jak3 siRNA sequence CGATCTTCGAGGAGAGACA of Christiano in Table 3 aligns with nucleotides 2494-2512 of JAK3 transcript variant 1 of NCBI Sequence ID NM_000215. PNG media_image5.png 218 569 media_image5.png Greyscale Therefore, it can be seen that the region of Jak3 targeted by the siRNA of Christiano et al. is very close to the region of Jak3 that instant SEQ ID NO: 3 aligns with, therefore providing motivation for targeting this region of Jak3. Regarding claim 8, Christiano et al. teach pharmaceutical compositions for use in accordance with the invention can be formulated in a conventional manner using one or more physiologically acceptable carriers (paragraph 0280), and an inhibitor of the invention can be incorporated into pharmaceutical compositions suitable for administration, for example the inhibitor and a pharmaceutically acceptable carrier (paragraph 0309). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the siRNA that targets nucleotides 2494-2512 of Jak3 of NM_00215 of Christiano et al. to target the nearby regions of Jak3 including nucleotides 2554-2574 of Jak3 of NM_00215 to arrive at an siRNA comprising a sense sequence of instant SEQ ID NO: 3 and antisense sequence of SEQ ID NO: 4, and wherein the siRNA would consist of at most 50 nucleotides based on the taught length of 21-25 base pairs with a reasonable expectation of success. There would be a reasonable expectation of success since Christiano et al. teach Jak3 targeting siRNA which targets a region (nucleotides 2494-2512 of JAK3) that is very close to that of instant SEQ ID NOs: 3 and 4 (nt 2554-2574 of JAK3), and because Christiano et al. teach siRNA can be about 21 to about 25 base pairs in length. An ordinary artisan knowing the mRNA sequence of Jak3 taught by Christiano et al. as being publicly available as NM_00215 and the taught lengths of siRNA comprising about 21-25 base pairs, as well as the region of Jak3 to target would be able to arrive at the instant sequences of SEQ ID NO: 3 and 4 with a reasonable expectation of success. As the range of 21-25 base pairs is taught by Christiano et al., the ordinary artisan could also design each strand of siRNA to consist of at most 24 nucleotides, as well as design the sense and antisense strands to be of the same length. As there are only two options, of either the strands being the same length or a different length, it would be obvious to provide both strands to have the same length. One of ordinary skill in the art would have been motivated to do so because Christiano et al. recites a method of inducing hair growth in a subject comprising administering to the subject an effective amount of a Jak inhibitor, and wherein the inhibitor is an siRNA directed to a Jak3 gene and is any one of the sequences listed in Table 3 (claim 13), and therefore would be motivated to provide an siRNA directed to Jak3 for inducing hair growth. Accordingly, the limitations of claims 7,8,16,17,20 and 21 would have been prima facie obvious to one of ordinary skill in the art. Claims 15 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 as applied to claims 7,8,16,17,20 and 21 above, and further in view of Alagia et al. (WIREs RNA 2016, 7:316-329), cited on an IDS. The teachings of Christiano et al. as evidenced by NM_00215 as applicable to claims 7,8,16,17,20 and 21 are described above. Christiano et al. as evidenced by NM_00215 do not teach wherein the nucleotide at the 5’ end of the antisense strand of the dsRNA is phosphorylated. However, before the effective filing date, Alagia et al. teach the optimization of siRNA molecules and advances of the siRNA field to optimized siRNA pharmacokinetic properties (Abstract) and chemical modifications to different parts of the structure of siRNA (page 3, left column). Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand is essential for siRNA efficacy and the phosphorylation of the 5’-end is required for strand loading and proper Ago2-mediated cleavage (page 4, left column, The Anchor Site). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to provide the modified siRNA of Christiano et al. as evidenced by NM_00215 with the teaching of Alagia et al. regarding the phosphorylation of the nucleotide at the 5’ end of the guide strand, to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success because this would have amounted to applying a known technique (phosphorylation of 5’ end of the guide strand) to a known product ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to do so, because Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand (the antisense strand) is essential for siRNA efficacy and for proper strand loading and Ago2-mediated cleavage, and would make obvious the limitations of claims 15 and 19. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Claims 17 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 as applied to claims 7,8,16,17,20 and 21 above, and further in view of Yuan et al. (Human Gene Therapy 23:524-532, May 2012). The teachings of Christiano et al. as evidenced by NM_00215 as applicable to claims 7,8,16 and 20 are described above. The examiner included claims 17 and 21 in the rejection above as unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 based on a case of obviousness as only having two options of either the strands being the same length or a different length. Christiano et al. as evidenced by NM_00215 do not explicitly teach wherein the two strands of the JAK3 siRNA are of identical length. Before the effective filing date, Yuan et al. taught the most widely used siRNA structure consists of double-stranded RNA with 19 base pairs and 2-nucleotide overhangs at the 3’ end of both strands (19+2) (Abstract). Therefore, Yuan et al. teach siRNA wherein both strands are of identical length (21 nucleotides). Yuan et al. taught an siRNA which is siCCR5_19+2 shown below (Fig. 1A). The overhang on each 3’ end of each strand can be seen but each strand is of the same length. PNG media_image6.png 66 389 media_image6.png Greyscale siCCR5_19+2 is taught as efficiently knocking down CCR5 mRNA levels and CCR5 expression (Figures 1B and C). PNG media_image7.png 226 361 media_image7.png Greyscale PNG media_image8.png 202 312 media_image8.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art to have designed the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 to have the two strands of the siRNA to be of identical length based on the teachings of Yuan et al. with a reasonable expectation of success. There would be a reasonable expectation of success, because both Christiano et al. and Yuan et al. pertain to siRNAs and are in the same field of endeavor. One of ordinary skill in the art would be motivated to provide the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 to have identical lengths in both strands of the siRNA, because Yuan et al. taught the most widely used siRNA structure consists of double-stranded RNA with 19 base pairs and 2-nucleotide overhangs at the 3’ end of both strands (19+2) and therefore that both strands had the same length and showed that this design provided efficient knockdown of the mRNA of the target gene and expression levels (CCR5). Accordingly, the limitations of claims 17 and 21 would have been prima facie obvious to one of ordinary skill in the art. Claims 9,10,12 and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 as applied to claim 7 above, and further in view of Chang et al. (Transplant Immunology 21 (2009) 27-32), cited on an IDS. The teachings of Christiano et al. as evidenced by NM_00215 as applicable to claim 7 has been described above. Christiano et al. teach an siRNA that specifically targets the Jak3 gene. Christiano et al. as evidenced by NM_00215 do not teach introducing into a cell in vitro a double-stranded RNA comprising a sense strand of SEQ ID NO: 3 and an antisense strand of SEQ ID NO: 4, and maintaining the cell produced in the introducing for a period of time sufficient to achieve degradation of the mRNA of a JAK1 or JAK3 gene, thereby inhibiting expression of JAK1 or JAK3 in the cell. Before the effective filing date, Chang et al. taught a study aimed to inhibit JAK3 expression using RNAi to determine allograft tolerance (Abstract). Chang et al. taught the study aimed to demonstrate the siRNA effectively silences immune genes in JAK3 and in vitro immune modulations can be achieved via downregulation of JAK3 expression using siRNA (Section 1.1, page 28). Chang et al. taught JAK3 dsRNA consisting of a sense strand UCUACUUGCAGUCCAGAAUGCCAGC and antisense strand GCUGGCAUUCUGGACUGCAAGUAGA (Section 2.2.2 page 28) and which were transfected into rat basophilic leukemia cells RBL-2H3, using 10nM of the siRNA duplex (Section 2.2.3, page 28). Results of the in vitro transfection of 10nM of siRNA showed downregulation of JAK3 expression in RBL-2H3 cells as more than 84% reduction in JAK3 level 24 hours after siRNA therapy which demonstrated the in vitro suppression of JAK3 expression by siRNA (Section 3.2, page 29). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to use the modified JAK3 siRNA as taught by Christiano et al. as evidenced by NM_00215 that comprises the sense sequence of instant SEQ ID NO: 3 and antisense sequence of instant SEQ ID NO: 4, and introduce the siRNA into a cell in vitro for a period of time sufficient for degradation of the mRNA of JAK3 and inhibiting the expression of JAK3 in the cell based on the teachings of Chang et al. with a reasonable expectation of success. There would be a reasonable expectation of success because both Christiano et al. and Chang et al. pertain to siRNAs that target JAK3, and Christiano et al. teaches siRNAs of 21-25 nucleotides in length, and the siRNA of Chang et al. is 25 nucleotides in length and therefore are relevant art. An ordinary artisan knowing the mRNA sequence of Jak3 taught by Christiano et al. as being publicly available as NM_00215 and the taught lengths of siRNA comprising about 21-25 base pairs, as well as the region of Jak3 to target would be able to arrive at the instant sequences of SEQ ID NO: 3 and 4 with a reasonable expectation of success. As the range of 21-25 base pairs is taught by Christiano et al., the ordinary artisan could also design each strand of siRNA to consist of at most 24 nucleotides. One of ordinary skill in the art would have been motivated to introduce the modified JAK3 siRNA as taught by Christiano et al. as evidenced by NM_00215 that comprises the sense sequence of instant SEQ ID NO: 3 and antisense sequence of instant SEQ ID NO: 4 into a cell in vitro, and maintained the cell for a period of time sufficient to achieve degradation of the mRNA of JAK3 gene, thereby inhibiting the expression of JAK3 in the cell because Chang et al. taught a study aimed to demonstrate the siRNA effectively silences immune genes in JAK3 and in vitro immune modulations can be achieved via downregulation of JAK3 expression using siRNA and taught transfection of JAK3 siRNA comprising a sense and antisense strand into rat basophilic leukemia cells RBL-2H3, using 10nM of the siRNA duplex and results of the in vitro transfection of 10nM of siRNA showed downregulation of JAK3 expression in RBL-2H3 cells as more than 84% reduction in JAK3 level 24 hours after siRNA therapy which demonstrated the in vitro suppression of JAK3 expression by siRNA. Accordingly, the limitations of claims 9,10,12 and 13 would have been prima facie obvious to one of ordinary skill in the art. Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 in view of Chang et al. as applied to claims 9,10,12 and 13 above and further in view of Alagia et al. The teachings of Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 and as Chang et al. as applicable to claims 9,10,12 and 13 have been described above. Christiano et al. as evidenced by NCBI Reference Sequence: NM_00215 and as Chang et al. do not teach wherein the nucleotide at the 5’ end of the antisense strand of the dsRNA is phosphorylated. However, before the effective filing date, Alagia et al. teach the optimization of siRNA molecules and advances of the siRNA field to optimized siRNA pharmacokinetic properties (Abstract) and chemical modifications to different parts of the structure of siRNA (page 3, left column). Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand is essential for siRNA efficacy and the phosphorylation of the 5’-end is required for strand loading and proper Ago2-mediated cleavage (page 4, left column, The Anchor Site). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to further modify the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 used in the method of Chang et al. with the teachings of Alagia et al. regarding the phosphorylation of the nucleotide at the 5’ end of the guide strand, to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success because this would have amounted to applying a known technique (phosphorylation of 5’ end of the guide strand) to a known product (JAK3 siRNA of Christiano et al. as evidenced by NM_00215) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to further modify the JAK3 siRNA of Christiano et al. as evidenced by NM_00215 used in the method of Chang et al. with the teaching of Alagia et al. regarding phosphorylation of the nucleotide at the 5’ end of the antisense strand, because Alagia et al. teach the presence of a phosphate group at the 5’ terminus of the guide strand (the antisense strand) is essential for siRNA efficacy and for proper strand loading and Ago2-mediated cleavage. Accordingly, the limitations of claim 11 would have been prima facie obvious to one of ordinary skill in the art. Conclusion Claims 7-13,15-17 and 19-21 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jan 14, 2022
Application Filed
May 08, 2025
Non-Final Rejection — §103
Sep 15, 2025
Response Filed
Nov 19, 2025
Final Rejection — §103
Jan 30, 2026
Request for Continued Examination
Feb 02, 2026
Response after Non-Final Action
Mar 17, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
2y 5m to grant Granted Mar 03, 2026
Patent 12534727
NOVEL TARGET TO TREAT A METABOLIC DISEASE IN AN INDIVIDUAL
2y 5m to grant Granted Jan 27, 2026
Patent 12522830
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12522826
THERAPEUTICS FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS
2y 5m to grant Granted Jan 13, 2026
Patent 12496347
NUCLEIC ACID, COMPOSITION AND CONJUGATE CONTAINING NUCLEIC ACID, PREPARATION METHOD THEREFOR AND USE THEREOF
2y 5m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
62%
Grant Probability
98%
With Interview (+35.7%)
3y 6m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month