Prosecution Insights
Last updated: April 19, 2026
Application No. 17/627,817

Genetically Engineered Bacteriophage

Final Rejection §103§112
Filed
Jan 18, 2022
Examiner
SULLIVAN, DENNIS JOHN
Art Unit
1642
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Cytophage Technologies
OA Round
2 (Final)
60%
Grant Probability
Moderate
3-4
OA Rounds
3y 6m
To Grant
99%
With Interview

Examiner Intelligence

Grants 60% of resolved cases
60%
Career Allow Rate
61 granted / 102 resolved
At TC average
Strong +51% interview lift
Without
With
+50.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
44 currently pending
Career history
146
Total Applications
across all art units

Statute-Specific Performance

§101
6.8%
-33.2% vs TC avg
§103
40.8%
+0.8% vs TC avg
§102
3.6%
-36.4% vs TC avg
§112
27.1%
-12.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 102 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Claims 1-2, 5-7, 9-18, and 21-26 have an effective filing date of 18 JUL 2019. Information Disclosure Statement The information disclosure statements (IDS) submitted on 11/05/2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Election/Restriction In the response from Applicant on 02 JUL 2025, from Kathleen Ehrhard, Applicant elected: Species: 1. A distinct gene useful for overcoming bacterial defenses is biofilm reducer, alpha-amylase [0134] 2. A distinct gene for enzyme that disrupts the bacterial wall is endolysin 3. A distinct endolysin nucleotide sequence is SEQ ID NO: 143 4. No selection 5. A distinct gene that targets linking chemistries is SEQ ID NO: 145 6. A distinct non-natural attachment gene is SEQ ID NO: 126 7. A distinct bacterium that the bacteriophage binds to is Klebsiella pneumoniae [0110] Status of Claims Claims 1-2, 5-7, 9-18, and 21-26 are currently pending. Claims 13, 17, and 21-26 are withdrawn from further consideration by Examiner under CFR 1.142(b) as being drawn to non-elected inventions. Claims 3-4, 8, 19-20, and 27-31 are canceled. Rejections Maintained Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 7 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 7 is reject for reciting the claim limitation, “a low copy number of lysogenic genes”, but has not defines what is a low copy number. As such one skilled in the art would be unable to clearly delineate the metes and bounds of the claim. Clarification is required. Applicant’s Arguments: In the invention of claim 7,"a low copy number of lysogenic genes" refers to phages that have a lower number of lysogenic genes relative to other phages isolated from environmental samples (see e.g., page 19, lines 3-8 of the application as originally filed). It is known in the art that "copy number" of a gene refers to the number of copies of the gene nucleotide sequence. For example, "'Copy number' of a genetic element, plasmid or vector refers to how many copies are present in a host cell... A 'low copy number' genetic element or plasmid is present at, e.g., less than about 20 copies per cell" (see U.S. Patent No. 11,485,977 B2 at col. 8, lines 8-9 and 20- 22). Examiner’s Response: Applicant states, “a lower number of lysogenic genes relative to other phages isolated from environmental samples”. Applicant additionally provides US Pat. 11485977 B2, that states, “A “low copy number” genetic element or plasmid is present at, e.g., less than about 20 copies per cell.” One of ordinary skill would not interpret an example of a possible value, as a low number of genetic elements that are present. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Lu et al (WO 2015035168 A1, IDS 3/21/2023). In regards to claim 1, Lu et al teaches a method of engineering a bacteriophage [Line 15, pg. 2]. Lu et al further teaches the recombinant bacteriophage is isolated from natural or human-made environment and comprises a phage that comprises a genome that has been genetically modified by insertion of a heterologous nucleic acid sequence into the genome [Lines 27-31, pg. 8]. Lu et al further teaches bacteriophage attachment to bacterial cells [Lines 10-11, pg. 9]. Lu et al further teaches altering the host recognition element, thus altering the host recognition elements of the bacteriophage and altering the bacteriophage infectivity [Lines 11-14, pg. 9]. Lu et al further teaches the bacteriophage can be modified to infect numerous species of bacteria [Lines 14-24, pg. 13]. Lu et al further teaches if the bacteriophage is unknown then to use a method to generate a complete sequence [Lines 17-18, pg. 15]. Lu et al further teaches a phage requiring additional functions to counteract host defenses [Lines 3-5, pg. 17]. Lu et al further teaches synthesizing a bacteriophage de novo [Line 2, pg. 18]. Accordingly, Lu et al teaches engineering a bacteriophage to alter the range of host bacterial cells recognized by the bacteriophage, and inserting one or more attachment gene and/or non-natural attachment gene that is specific for attaching to a selected bacterium. One of ordinary skill, before the effective filing date, would have motivated to use Lu’s method for engineering a bacteriophage comprising isolating the bacteriophage, modifying the bacteriophage by removing or adding genes for attachment and overcoming bacterial defenses. It would have been prima facie obvious to use Lu’s method of engineering a bacteriophage comprising isolating a bacteriophage, removing all attachment genes, inserting a first non-natural attachment gene and a second gene for overcoming bacterial defenses, because such a method allows for the creation of phage-based therapeutics and diagnostics. Claims 10 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Lu et al (WO 2015035168 A1, IDS 3/21/2023) as applied to claims 1 and 9 above, and further in view of Collins et al (US 20150050717 A1, IDS 3/21/2023). The teachings of Lu et al are discussed above. Lu et al does not specifically teach a second open reading frame encoding a gene useful for overcoming bacterial defenses. However, this deficiency is made up in the teachings of Collins et al. In regards to claims 10, Collins et al teaches engineering bacteriophages expressing antimicrobial peptides for overcoming bacterial defenses [Abstract]. Collins et al further teaches the engineered bacteriophage can comprise one or more antimicrobial agents [0121]. Collins et al further teaches bacteriophage comprising antimicrobial-agent for the treatment of bacterial biofilm [0060]. In regards to claim 14, Collins et al teaches phage that comprise nucleic acids which encode enzymes which assist in breaking down or degrading the biofilm matrix [0192]. Collins et al further teaches amylase [0192]. One of ordinary skill in the art, before the effective filing date, would have been motivated to combine Lu’s method for engineering a bacteriophage comprising isolating the bacteriophage, modifying the bacteriophage by removing or adding genes for attachment and overcoming bacterial defenses, with Collin’s method of using a second open reading frame encoding a gene for overcoming bacterial defenses. Furthermore, for the second gene for overcoming bacterial defenses is amylase. The idea of combining them flows logically from their having been individually taught in the prior art (MPEP 2144.06). Combining prior art elements according to known methods to yield predictable results is an exemplary rationale for a prima facie case of obviousness. MPEP2143. It would have been prima facie obvious to combine to methods of Lu and Collin’s for a method of engineering a bacteriophage comprising removing all attachment genes, inserting a first non-natural attachment gene and a second gene for overcoming bacterial defenses, because Lu and Collin’s teach methods of modifying bacteriophages. As such the inventions of Lu and Collin would reasonably be expected to use for a method of engineering a bacteriophage comprising removing all attachment genes, inserting a first non-natural attachment gene and a second gene for overcoming bacterial defenses. Claims 2, 5-6, and 11 are rejected under 35 U.S.C. 103 as being unpatentable over Lu et al (WO 2015035168 A1, IDS 3/21/2023) and Collins et al (US 20150050717 A1, IDS 3/21/2023), as applied to claims 1, 9, 10, and 14 above, and further in view of Pires et al (Genetically Engineered Phages: a Review of Advances over the Last Decade, MMBR, Vol. 80, Num. 3, pgs. 523-543, IDS 3/21/2023). The teachings of Lu et al and Collins et al are discussed above. Lu et al does not specifically teach genes useful for overcoming bacterial defenses comprising endolysin, cell free cloning, screening for lysogenic genes and inactivating said lysogenic genes, and genes that disrupt bacterial walls including endolysin. However, these deficiencies are made up in the teachings of Pires et al. In regards to claim 2, Pires et al teaches the use of phage-encoded endolysins degrade the peptidoglycan of the bacterial cell wall from within the cell [Pg. 533, Phage-Derived Antimicrobials, 1st paragraph]. In regards to claim 5, Pires et al teaches the use of a cell-free cloning system [Pg. 528, Right column, Fig. 8]. Pires et al further teaches benefits of using cell-free cloning are that the genome can be engineered without causing toxicity to the host and as a way to overcome the bottleneck in throughput and efficiency in in vitro and yeast-based systems for phage engineering [Pg. 528, Cell-Free Transcription-Translation Systems]. In regards to claim 6, Pires et al teaches improving engineered phage endolysins and isolating them from different species of bacteria [Pg. 533, Phage-Derived Antimicrobials, 1st Paragraph]. In regards to claim 11, Pires et al teaches phage-encoded endolysins degrade the peptidoglycan of the bacterial cell wall from within the cell [Pg. 533, Phage-Derived Antimicrobials, 1st Paragraph]. One of ordinary skill in the art, before the effective filing date, would have been motivated to combine Lu’s method for engineering a bacteriophage comprising isolating the bacteriophage, modifying the bacteriophage by removing or adding genes for attachment and overcoming bacterial defenses, with Collin’s method of using a second open reading frame encoding a gene for overcoming bacterial defenses, with Pires’s method of engineering bacteriophages comprising genes useful for overcoming bacterial defenses comprising endolysin, cell free cloning, screening for lysogenic genes and inactivating said lysogenic genes, and genes that disrupt bacterial walls including endolysin. The idea of combining them flows logically from their having been individually taught in the prior art (MPEP 2144.06). Combining prior art elements according to known methods to yield predictable results is an exemplary rationale for a prima facie case of obviousness. MPEP2143. It would have been prima facie obvious to combine to methods of Lu, Collin, and Pires’s for a method of engineering a bacteriophage comprising removing all attachment genes, inserting a first non-natural attachment gene and a second gene for overcoming bacterial defenses, because Lu, Collin, and Pires’s teach methods of modifying bacteriophages. As such the inventions of Lu, Collin, and Pires would reasonably be expected to be used for a method of engineering a bacteriophage comprising removing all attachment genes, inserting a first non-natural attachment gene and a second gene for overcoming bacterial defenses. Claims 15 and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Lu et al (WO 2015035168 A1, IDS 3/21/2023) and Collins et al (US 20150050717 A1, IDS 3/21/2023), as applied to claims 1, 9, 10, and 14, and further in view of Iqbal et al (Antibacterial enzymes from the functional screening of metagenomic libraries hosted in Ralstonia metallidurans, FEMS Microbiol Lett 354 (2014) 19–26). The teachings of Lu et al are discussed above. Lu et al does not specifically teach the gene that targets linking chemistries in the bacterial wall comprising SEQ ID NO: 145. However, this deficiency is made up in the teachings of Iqbal et al. In regards to claims 15-16, Iqbal et al teaches antibacterial enzymes comprising Uncultured bacterium clone SZR5 genomic sequence. A comparison of instant SEQ ID NO: 145, and Uncultured bacterium clone SZR5 genomic sequence is shown below. Instant SEQ ID NO: 145 and Uncultured bacterium clone SZR5 genomic sequence of Iqbal et al. Query Match 100.0%; Score 1395; Length 37132; Best Local Similarity 100.0%; Matches 1395; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGACCATCGACGTTGCCATCGCCTTTGCCGACGCTAACCACTCCACCTACCTCGAAGAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 34024 ATGACCATCGACGTTGCCATCGCCTTTGCCGACGCTAACCACTCCACCTACCTCGAAGAC 33965 Qy 61 CTGAAAGGCCTCGCGCGCATACCGAGCGTCAGCTTCCCGGGCTTCGACGCTGCCGAAGTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33964 CTGAAAGGCCTCGCGCGCATACCGAGCGTCAGCTTCCCGGGCTTCGACGCTGCCGAAGTG 33905 Qy 121 GAGCGGTCCGCGGAACACGTCGCGGACCTGTGCCGGAATCGTGGCCTCGAGAACGTCGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33904 GAGCGGTCCGCGGAACACGTCGCGGACCTGTGCCGGAATCGTGGCCTCGAGAACGTCGAA 33845 Qy 181 GTCCTTCGCGTCCCCGGCGCCCACCCCTACGTCTACGGCGACTGGCTACATGCGCCAGGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33844 GTCCTTCGCGTCCCCGGCGCCCACCCCTACGTCTACGGCGACTGGCTACATGCGCCAGGC 33785 Qy 241 AAGCCGACGCTGCTTCTCTACGCGCACCACGATGTGCAGCCGCCGGGCCGCGAGGAGCTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33784 AAGCCGACGCTGCTTCTCTACGCGCACCACGATGTGCAGCCGCCGGGCCGCGAGGAGCTG 33725 Qy 301 TGGCTCACGCCGCCCTTCGAGCCGACGGAGCGCGATGGGCGCCTGTACGGCCGCGGCTGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33724 TGGCTCACGCCGCCCTTCGAGCCGACGGAGCGCGATGGGCGCCTGTACGGCCGCGGCTGC 33665 Qy 361 GCTGATGACAAAGCCGGCGCTATCACGCACATCGCTGCGATTGCAGCGTGGCTGGGCGCG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33664 GCTGATGACAAAGCCGGCGCTATCACGCACATCGCTGCGATTGCAGCGTGGCTGGGCGCG 33605 Qy 421 ACCGGCTCGCTGCCGCTGAACGTGAAGCTGATCATCGAAGGGGAGGAAGAGATCGGCTCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33604 ACCGGCTCGCTGCCGCTGAACGTGAAGCTGATCATCGAAGGGGAGGAAGAGATCGGCTCT 33545 Qy 481 GAGCACCTTGAGTCGTTTCTGGAAACCCATGCTTCGAAGCTGATGGCGGACGCCATCGTG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33544 GAGCACCTTGAGTCGTTTCTGGAAACCCATGCTTCGAAGCTGATGGCGGACGCCATCGTG 33485 Qy 541 CTCACCGACACTGCCAACTTCGATGCCGACACGCCGTCGATCACAGTGGCCCTCCGCGGC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33484 CTCACCGACACTGCCAACTTCGATGCCGACACGCCGTCGATCACAGTGGCCCTCCGCGGC 33425 Qy 601 CTTGTCGCAGTCGACGTCACGGTGCGGTCCATGGACCATCCATTGCACTCCGGCCTGTGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33424 CTTGTCGCAGTCGACGTCACGGTGCGGTCCATGGACCATCCATTGCACTCCGGCCTGTGG 33365 Qy 661 GGCGGGCCGATACCGGACCCGGTGCAGGCCCTCGCCCGCATGATTGCCGCCTGCACTGAC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33364 GGCGGGCCGATACCGGACCCGGTGCAGGCCCTCGCCCGCATGATTGCCGCCTGCACTGAC 33305 Qy 721 GCGACGGGGCGGATGACCATCCCCGGCATATACGACGACGTCGCGGAGCCCGGCGCTGCC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33304 GCGACGGGGCGGATGACCATCCCCGGCATATACGACGACGTCGCGGAGCCCGGCGCTGCC 33245 Qy 781 GCCGAGGCAAGCCTCAAGGTGCTGGAGTACCCTGAAGCGCTCTTCCGCGAGCACACCGGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33244 GCCGAGGCAAGCCTCAAGGTGCTGGAGTACCCTGAAGCGCTCTTCCGCGAGCACACCGGC 33185 Qy 841 CTCAACCCTGAGTCGCAGCTACTGGTGGCGTCTACAGACGTCCTGCGCTCGAACTGGTAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33184 CTCAACCCTGAGTCGCAGCTACTGGTGGCGTCTACAGACGTCCTGCGCTCGAACTGGTAC 33125 Qy 901 CAGCCGTCGCTCTCCGTGAACGCCATCCAGGCTTCGTCGCGCAGGGACGTCGCGAACATC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33124 CAGCCGTCGCTCTCCGTGAACGCCATCCAGGCTTCGTCGCGCAGGGACGTCGCGAACATC 33065 Qy 961 ATCAACGACAGTGCCTGGGCGCACGTCGGCATCCGCATCGTGCCCAACATGGACGCGCGC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33064 ATCAACGACAGTGCCTGGGCGCACGTCGGCATCCGCATCGTGCCCAACATGGACGCGCGC 33005 Qy 1021 AAGACCCTCGAGGCGCTGAAAGCGCACCTCGCAGCTAATGCGCCGTGGGGCGTGCGCGTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 33004 AAGACCCTCGAGGCGCTGAAAGCGCACCTCGCAGCTAATGCGCCGTGGGGCGTGCGCGTC 32945 Qy 1081 GAATTCTCCAACGAAGCCGCCAGCCCCGCCTGGACCACGGATACCGACGCACCGGCCTTC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32944 GAATTCTCCAACGAAGCCGCCAGCCCCGCCTGGACCACGGATACCGACGCACCGGCCTTC 32885 Qy 1141 GCAGCCGCCCGCCGCGCCCTCGAACGCGGCTACGCCAAGCCCGCCATCGACATGGGCTGC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32884 GCAGCCGCCCGCCGCGCCCTCGAACGCGGCTACGCCAAGCCCGCCATCGACATGGGCTGC 32825 Qy 1201 GGCGGCTCCATACCCTTTGTCGGCCCCTTCGCCGCTGCCCTCAAGGGCGCCCCGGCCCTG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32824 GGCGGCTCCATACCCTTTGTCGGCCCCTTCGCCGCTGCCCTCAAGGGCGCCCCGGCCCTG 32765 Qy 1261 CTTATCGGCGTCGAAGACCCGCTGTCAAACGCCCACAGCGAGAACGAGAGCCTGCATCTC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32764 CTTATCGGCGTCGAAGACCCGCTGTCAAACGCCCACAGCGAGAACGAGAGCCTGCATCTC 32705 Qy 1321 GGCATGTTCCGCAAAGCAATTGCGTCGGCGGTAGCGCTGTACGGAGAAATCGCGGCGCTA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32704 GGCATGTTCCGCAAAGCAATTGCGTCGGCGGTAGCGCTGTACGGAGAAATCGCGGCGCTA 32645 Qy 1381 GACAGCGTGAAGTAG 1395 ||||||||||||||| Db 32644 GACAGCGTGAAGTAG 32630 One of ordinary skill in the art, before the effective filing date, would have been motivated to combine Lu’s method for engineering a bacteriophage comprising isolating the bacteriophage, modifying the bacteriophage by removing or adding genes for attachment and overcoming bacterial defenses, with Collin’s method of using a second open reading frame encoding a gene for overcoming bacterial defenses, with Iqbal’s method of targeting linking chemistries of walls. The idea of combining them flows logically from their having been individually taught in the prior art (MPEP 2144.06). Combining prior art elements according to known methods to yield predictable results is an exemplary rationale for a prima facie case of obviousness. MPEP2143. It would have been prima facie obvious to combine to methods of Lu, Collin, and Iqbal’s for a method of engineering a bacteriophage comprising removing all attachment genes, inserting a first non-natural attachment gene and a second gene for overcoming bacterial defenses, because Lu, Collin, and Iqbal teach methods of modifying bacteriophages. As such the inventions of Lu, Collin, and Iqbal would reasonably be expected to use for a method of engineering a bacteriophage comprising removing all attachment genes, inserting a first non-natural attachment gene and a second gene for overcoming bacterial defenses. Applicant’s Arguments: None of the cited references teach or suggest a method that includes removing all attachment genes from a genome of a bacteriophage as defined in claim 1. None of the cited references provide the motivation to modify the methods of the prior art in the manner necessary to arrive at the method as defined in claim 1, which includes removing all attachment genes. The prior art does not provide any reasonable expectation that a bacteriophage engineered in such a manner as to remove all attachment genes would have efficacy or the unexpected advantages discovered by the inventor. Examiner’s Response: Lu et al teaches a bacteriophage, using its tail fibers, recognizes and adsorbs to the outer membrane of its host bacterial cell [Lines 20-21, pg. 2]. Lu et al further teaches altering (e.g., swapping, mutating) the tail fibers of a bacteriophage can alter the range of host bacterial cells recognized by the bacteriophage [Lines 22-23, pg. 2]. Lu et al further teaches, for example, a T3 bacteriophage may be modified to have tail fibers from one or more different types of bacteriophages (e.g., T7, SP6, yppR, Kl-5, K11). One of ordinary skill in the art would recognize that swapping out the tail fibers includes “removing all attachment genes”. Furthermore, Lu et al states the bacteriophage is modified to have one tail, one would recognize that all other attachment genes would have to be removed to allow this combination. Applicant states, “unexpected advantages discovered”. The ability to remove all attachment genes is taught by Lu et al. Allowable Subject Matter With respect to the elected SEQ ID NO: 143, claim 12 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. With respect to the elected SEQ ID NO: 126, claim 18 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DENNIS JOHN SULLIVAN whose telephone number is (571)272-0509. The examiner can normally be reached Mon - Fri: 7:30AM - 4:30PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached at (571) 270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DENNIS J SULLIVAN/ Examiner, Art Unit 1642 /NELSON B MOSELEY II/ Primary Examiner, Art Unit 1642
Read full office action

Prosecution Timeline

Jan 18, 2022
Application Filed
Jul 02, 2025
Examiner Interview (Telephonic)
Jul 23, 2025
Non-Final Rejection — §103, §112
Oct 24, 2025
Response Filed
Jan 05, 2026
Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584920
METHOD OF DETECTING CANCER OR CANCER CELLS
2y 5m to grant Granted Mar 24, 2026
Patent 12559557
METHODS AND COMPOSITIONS RELATING TO ANTI-PD1 ANTIBODY REAGENTS
2y 5m to grant Granted Feb 24, 2026
Patent 12534525
AQUEOUS PHARMACEUTICAL COMPOSITION OF AN ANTI-IL17A ANTIBODY AND USE THEREOF
2y 5m to grant Granted Jan 27, 2026
Patent 12479915
CYTOTOXICITY-INDUCING THERAPEUTIC AGENT
2y 5m to grant Granted Nov 25, 2025
Patent 12448442
TREATMENT OF T CELL LYMPHOMA
2y 5m to grant Granted Oct 21, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
60%
Grant Probability
99%
With Interview (+50.6%)
3y 6m
Median Time to Grant
Moderate
PTA Risk
Based on 102 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month