DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received 09/29/2021. Claims 1,2,3,4,5,6,7 and 8 are currently pending.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. The priority date is 09/08/2021.
Foreign Priority:
Acknowledgment is made of applicant's claim for foreign priority based on an application filed in PCT on 07/19/2019
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Enablement
Claims 1, and 2 are rejected under 35 U.S.C. 112(a), because the specification, while being enabling for knocking down the miRNA 451a in vitro or in vivo in a murine model , does not reasonably provide enablement for treating endometriosis in vivo in human patients. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to utilize the invention commensurate in scope with these claims.
Scope of enablement
The factors to be considered in determining whether a disclosure would require undue experimentation include: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the specification; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 8 USPQ2d, 1400 (CAFC 1988) and MPEP 2164.01.
The breadth of the claims: The application is for a method for treating endometriosis by administering an effective dose of an inhibitor of microRNA 451a (miR451a) (claim1) or a composition for treating endometriosis comprising an inhibitor of miR451a (claim5) and that inhibitor is an antisense nucleic acid (NA) (claim 3 and 7) wherein the inhibitor comprises the sequence AAACCGUUACCAUUACUGAGUU (SEQ ID NO:1) (claim 4 and 8). The application also claims the inhibitor is at least one selected form the group consisting of a polypeptide, a nucleic acid, an aptamer, an anti-miR, antagomiR, a miR sponge, a silencing RNA (siRNA), a short hairpin RNA (shRNA), a morpholino, a piwi-interacting RNA (piRNA), a repeat associated small interfering RNA (rasiRNAs), and a small molecule (claims 2 and 6).
The nature of the invention: The invention envisioned by the applicant is a method of treating or a composition for treating endometriosis, by means of targeting, knocking down and/or inhibiting miRNA541a.
The state of the prior art: as reviewed in Chakraborty C, Sharma AR, Sharma G, Lee SS. Therapeutic advances of miRNAs: A preclinical and clinical update. J Adv Res. 2020 Aug 29;28:127-138, despite promising therapeutic potential, there are no FDA-approved miRNA-based cancer therapies. However, various oncology clinical trials using miRNAs in screening, diagnosis, and drug testing are underway. Studies have shown that miRNA-based therapy, either by inhibiting an onco miR or by inducing a tumor suppressor, is effective in cancer treatment. Their clinical and preclinical application in cancer is for the design of therapeutic solutions together with ribozymes, DNAzymes, small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), anti-miRNA agents such as ASOs-anti-miRNAs, and locked nucleic acids (LNA)-anti-miRNAs or antagomirs. In animal model experiments, 18 different miRs were tested as potential therapeutic molecules.
The level of one of ordinary skill; a person having ordinary skill in the art, given the sequence formiRNA451a could design an anti-miRNA agents such as RNAs (siRNAs), short hairpin RNAs (shRNAs), anti-miRNA agents such as ASOs-anti-miRNAs, and locked nucleic acids (LNA)-anti-miRNAs or antagomirs.
The level of predictability in the art; Challenges in using anti-miRNA treatments include stability, toxicity, distribution, specificity to target tumor cells, and immunogenicity. Among these challenges, the greatest is probably targeting the correct cells and unknown functions for miRNA451a. For example, as reviewed in Chakraborty C, Sharma AR, Sharma G, Lee SS. Therapeutic advances of miRNAs: A preclinical and clinical update. J Adv Res. 2020 Aug 29;28:127-138. MRX34 (microRNA liposomal injection) was evaluated for its efficacy against melanoma. However, in the Phase 1 clinical trial, the drug was withdrawn due to serious adverse effects. To date, most of the miRNAs are in their early phase of clinical trials; thus, it remains to be seen how other miRNAs that are undergoing clinical trial for human application fairs in terms of toxicity or side effects.
The amount of direction provided by the inventor; pages 18-42 describe the compositions of claim 2 and 6. Of those 24 pages, the bulk (pgs 20-34 and pgs 55¶20-58¶25) describe an oligonucleotide in great detail, including sequence, delivery vectors, promoters, delivery methods and the like, making it likely that production of a nucleic acid, an aptamer, an anti-miR, antagomiR, a miR sponge, a silencing RNA (siRNA), a short hairpin RNA (shRNA), a morpholino, a piwi-interacting RNA (piRNA), or a repeat associated small interfering RNA (rasiRNAs) is within the capabilities of the applicant to produce. Small molecules on the other hand are simply defined (pgs. 18-20) and general principles for how to search for an inhibitor are outlined, making it unlikely that a working example exists. Antibodies and peptides are given similar cursory treatment.
The existence of working examples; the application specification (pg 58¶30-pg65 and Fig 2a, 2b, 3a and 3b (drawings 2-7)) included data from Li M, Zhou Y, Taylor HS. miR-451a Inhibition Reduces Established Endometriosis Lesions in Mice. Reprod Sci. 2019 Nov;26(11):1506-1511. doi: 10.1177/1933719119862050. Epub 2019 Jul 28. All of this data is drawn to the oligonucleotide inhibitor of microRNA 451a (miR451a) discussed above.
The quantity of experimentation needed to make or use the invention based on the content of the disclosure; For the reasons stated above, the application may be enabling for production and administration in mice models of a nucleic acid, an aptamer, an anti-miR, antagomiR, a miR sponge, a silencing RNA (siRNA), a short hairpin RNA (shRNA), a morpholino, a piwi-interacting RNA (piRNA), or a repeat associated small interfering RNA (rasiRNAs). The discovery of small molecule or peptide inhibitor of microRNA 451a (miR451a), however, is only speculated, and the search for those inhibitors has not, to the knowledge of the examiner, been undertaken. Likewise, the ability to use the oligonucleotide inhibitor of microRNA 451a (miR451a) discussed above for the treatment of human patients, clinically, for the treatment of endometriosis still faces the same significant hurdles as using any anti-miRNA treatments include stability, toxicity, distribution, specificity to target tumor cells, and immunogenicity.
As reviewed in Sourial S, Tempest N, Hapangama DK. Theories on the pathogenesis of endometriosis. Int J Reprod Med. 2014;2014:179515. doi: 10.1155/2014/179515. Epub 2014 Feb 12. “Ectopically placed stem cells that are of endometrial or haematopoietic origin or abnormal endometrial differentiation of a resident tissue stem cell may be the first step in the establishment of an ectopic endometrial lesion. The subsequent proliferation and propagation of such lesions may also be dependent on mobile, endometrial progenitor-type cells in these ectopic lesions that are involved in initiating further lesion and also in maintaining the disease. A dysfunctional immune clearance and a genetic predisposition that allow these ectopic lesions to grow in an aberrant microenvironment may also contribute to the development of the disease. The current therapeutic regimens for endometriosis are usually based on manipulating the ovarian steroid hormones that may preferentially target terminally-differentiated ectopic endometriotic cells which would normally die off via apoptosis, while the stem cells that propagate the disease may not be affected.” In fact, as recently as 2022 Nothnick WB, Graham A. Dissecting the miR-451a-Mif Pathway in Endometriosis Pathophysiology Using a Syngeneic Mouse Model: Temporal Expression of Lesion Mif Receptors, Cd74 and Cxcr4. Biomedicines. 2022 Jul 14;10(7):1699. stated “Clearly, more detailed assessment of the role of miR-451a, the MIF-pathway and other pathways modulated by miR-451a in the pathophysiology of endometriosis are warranted for study.”
Written description
Claims 1, 2, 5 and 6 are rejected under 35 U.S.C. 112(a). For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Claim interpretation: The application is for a method for treating endometriosis by administering an effective dose of an inhibitor of microRNA 451a (miR451a) (claim1) or a composition for treating endometriosis comprising an inhibitor of miR451a (claim5) and that inhibitor is an antisense nucleic acid (NA) (claim 3 and 7) wherein the inhibitor comprises the sequence AAACCGUUACCAUUACUGAGUU (SEQ ID NO:1) (claim 4 and 8). The application also claims the inhibitor is at least one selected form the group consisting of a polypeptide, a nucleic acid, an aptamer, an anti-miR, antagomiR, a miR sponge, a silencing RNA (siRNA), a short hairpin RNA (shRNA), a morpholino, a piwi-interacting RNA (piRNA), a repeat associated small interfering RNA (rasiRNAs), and a small molecule (claims 2 and 6).
Analysis: Claims 1 and 5 claims “an inhibitor of microRNA 451 a (miR451 a)” and claims 2 and 6 state that the inhibitor is “selected form the group consisting of a polypeptide, a nucleic acid, an aptamer, an anti-miR, antagomiR, a miR sponge, a silencing RNA (siRNA), a short hairpin RNA (shRNA), a morpholino, a piwi-interacting RNA (piRNA), a repeat associated small interfering RNA (rasiRNAs), and a small molecule. The claims 2 and 6 define a genus “inhibitor”, but does not define specifically what molecules are encompassed by the term “inhibitor” other than the oligonucleotide wherein the inhibitor comprises the sequence AAACCGUUACCAUUACUGAGUU (SEQ ID NO:1) (claims 4 and 8).
Other than the antagomir or antisense sequence AAACCGUUACCAUUACUGAGUU (SEQ ID NO:1) that is described in great detail, no other nucleic acid is described in detail, although the specification does define the principles relied upon to derivatize the oligonucleotide (pg22¶20-28¶20). Proteins and small molecules are unrelated in structure to the oligonucleotide, and no structural information other than principles describing what they might be are given.
For oligonucleotides the written description for the use of the single SEQ ID NO:1, AAACCGUUACCAUUACUGAGUU, is met, but for polypeptide, an aptamer, a miR sponge, a short hairpin RNA (shRNA), or a morpholino, the only description was to speculate as to their existence and use, and no description was given as to production or effectiveness, calling into doubt whether inventor was in possession of the claimed invention at the time of filing.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-8 is/are rejected under 35 U.S.C. 103 as being unpatentable over Bourdoulous US-20200339986-A1 (publication date 2020-10-29 filling date 2017-10-24) in view of Taylor US-20200321077-A1 (publication date 2020-04-28; effectively filed date 2018-10-31), , and Li M, Zhou Y, Taylor HS. miR-451a Inhibition Reduces Established Endometriosis Lesions in Mice. Reprod Sci. 2019 Nov;26(11):1506-1511. doi: 10.1177/1933719119862050. Epub 2019 Jul 28. PMID: 31354069.
PNG
media_image1.png
200
400
media_image1.png
Greyscale
With regard to claims 1-8 Bourdoulous et. al. claims in claim 1 (pg18) “An agent that modulates the activity of a micro ribonucleic acid (miRNA), said miRNA being selected from the group consisting of … miRNA 451a” and specifies (pg 4, paragraph 44) “In particular, said anti-miRNA is an antisense compound (also called "antagomiR") which targets the miRNA, preferably the miRNA selected from the group consisting of… anti-miRNA451a…” and specifies on pg 3 “miRNA as detailed in TABLE 1” (modulated miRNA of the invention) miRNA miRNA 451a-5p Detailed name hsa-miRNA-451a Nucleotide sequence aaaccguuaccauuacugaguu Reference (miRBase) MIMAT0001631 SEQ ID NO 15. Does the art teach that miRNA 451a is related/responsible for endometriosis? Is there more discussion?
Bourdoulous et. al. does not teach a method of treating endometriosis in subject by administering an inhibitor of miRNA-451a.
Taylor et. al. does, however. use the exact same oligonucleotide as the instant application SEQ ID NO: 1, which Taylor et. al. lists as SEQ ID NO: 12. Taylor et. al. uses the oligonucleotide as a biomarker for endometriosis. You may want to discuss more from Taylor- any discussion of using antisense to treat? Why would anyone use the oligo (used as a primer) in treating a disease?
It would have been obvious to a person having ordinary skill in the art before the effective filing date to modify the teachings of Bourdoulous et. al. by targeting endometriosis taught by Taylor et. al. instead of her-2+ cancers taught by Bourdoulous et. al., as a person of ordinary skill in the art would recognize that these claim elements were interchangeable and one of skill in the art could have seen that Watson Crick base pairing would target for destruction by Risk Dicer any miRNA to which the probe bound.
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JERROD W HUNTER whose telephone number is (571)270-1730. The examiner can normally be reached M-F 8am -5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JERROD W HUNTER/
Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights