DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This action is in response to the amendment, filed 12/15/2025, in
which claims 53-54, and 56-57 were cancelled; claims 47-49, and 51 were amended and claims 59-63 were added. Applicant’s arguments have been thoroughly reviewed, but are not persuasive for the reasons that follow. Any rejections and objections not reiterated in this action have been withdrawn. This action is FINAL.
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 06/12/2025 is acknowledged. Upon further consideration, the species election requirement has been withdrawn. The restriction between groups is maintained.
Claims 55, 58, 62-63 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 06/12/2025.
Claims 47-52, 59-61 are under consideration.
Priority
Applicant’s claim for the benefit of a Provisional Application No 62874160 filed 07/15/2019 is acknowledged.
Specification
The substitute specification, filed 12/15/2025, has been entered.
Withdrawn Claim Objections
The objection to claim 47 has been withdrawn in view of Applicant’s amendment to the claim in the reply filed 12/15/2025.
Withdrawn Rejections
The rejection of claims 47-52 under 35 U.S 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, has been withdrawn in view of Applicant’s amendments to the claims in the reply in the reply filed 12/15/2025.
The rejection of claim 49 under 35 U.S 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, has been withdrawn in view of Applicant’s amendments to the claim in the reply in the reply filed 12/15/2025.
The rejection of claims 47-52, under 35 U.S 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, has been withdrawn in view of Applicant’s amendments to the claims in the reply in the reply filed 12/15/2025.
The rejection of claims 47-52, under 35 U.S 103, has been withdrawn in view of Applicant’s amendments and arguments to the claims in the reply in the reply filed 12/15/2025.
New Objections and Rejections necessitated by Amendment to the claims.
Specification
The amendment filed 12/15/2025 is objected to under 35 U.S.C. 132(a) because it introduces new matter into the disclosure. 35 U.S.C. 132(a) states that no amendment shall introduce new matter into the disclosure of the invention. The added material which is not supported by the original disclosure is as follows:
In the reply filed 12/15/2025, the applicant introduced new matter in the specification in the form of SEQ ID NO 115 in the Sequence Listing:
guuugagagcuacccgggacgcggguccgggacaguagcaaguucaaauaaggcuaguccguuaucaacuucugaggccuuggcgaggcuucuaaguggcaccgagucggugcuuuuuu
which specifically incorporates the nucleotide Uracil (U) (highlighted U). However, the original disclosure has support for thymidine (T) not for (U). By substituting “T” for “U” in the claim, the applicant has introduced new matter that was not present in the original disclosure. Consequently, the specification fails to provide an adequate written description for the claimed sequence.
Applicant is required to cancel the new matter in the reply to this Office Action.
Claim Objections
Claims 48 and 59 are objected to because the claims are missing sequence identifiers.
MPEP 2412.04: (c) Where the description or claims of a patent application discuss a sequence that is set forth in the “Sequence Listing XML” in accordance with paragraph (a) of this section, reference must be made to the sequence by use of the sequence identifier, preceded by “SEQ ID NO:” or the like in the text of the description or claims, even if the sequence is also embedded in the text of the description or claims of the patent application.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 48 and 60 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection.
In the reply filed 12/15/2025, claim 48 was amended to recite an oligonucleotide comprising the sequence: (Ra)GUUUGAGAGCUACCCGGGACGCGGGUCCGGGACAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUCUGAGGCCUUGGCGAGGCUUCUAAGU[T]]GGCACCGAGUC GGUGCUUUUUU, which specifically incorporates the nucleotide Uracil (U) (highlighted U). However, the original disclosure has support for thymidine (T) not for (U). By substituting “T” for “U” in the claim, the applicant has introduced new matter that was not present in the original disclosure. Consequently, the specification fails to provide an adequate written description for the claimed sequence.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JULIO GOMEZ RODRIGUEZ whose telephone number is (571)270-0991. The examiner can normally be reached Monday - Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 5712722916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JULIO WASHINGTON GOMEZ RODRIGUEZ/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637