Prosecution Insights
Last updated: April 18, 2026
Application No. 17/627,966

METHODS AND COMPOSITIONS FOR GENE SPECIFIC DEMETHYLATION AND ACTIVATION

Final Rejection §112
Filed
Jan 18, 2022
Examiner
GOMEZ RODRIGUEZ, JULIO WASHINGTON
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
BETH ISRAEL DEACONESS MEDICAL CENTER, INC.
OA Round
2 (Final)
50%
Grant Probability
Moderate
3-4
OA Rounds
4y 1m
To Grant
96%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allow Rate
11 granted / 22 resolved
-10.0% vs TC avg
Strong +46% interview lift
Without
With
+45.8%
Interview Lift
resolved cases with interview
Typical timeline
4y 1m
Avg Prosecution
48 currently pending
Career history
70
Total Applications
across all art units

Statute-Specific Performance

§101
6.3%
-33.7% vs TC avg
§103
32.8%
-7.2% vs TC avg
§102
19.1%
-20.9% vs TC avg
§112
27.1%
-12.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 22 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This action is in response to the amendment, filed 12/15/2025, in which claims 53-54, and 56-57 were cancelled; claims 47-49, and 51 were amended and claims 59-63 were added. Applicant’s arguments have been thoroughly reviewed, but are not persuasive for the reasons that follow. Any rejections and objections not reiterated in this action have been withdrawn. This action is FINAL. Election/Restrictions Applicant’s election without traverse of Group I in the reply filed on 06/12/2025 is acknowledged. Upon further consideration, the species election requirement has been withdrawn. The restriction between groups is maintained. Claims 55, 58, 62-63 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 06/12/2025. Claims 47-52, 59-61 are under consideration. Priority Applicant’s claim for the benefit of a Provisional Application No 62874160 filed 07/15/2019 is acknowledged. Specification The substitute specification, filed 12/15/2025, has been entered. Withdrawn Claim Objections The objection to claim 47 has been withdrawn in view of Applicant’s amendment to the claim in the reply filed 12/15/2025. Withdrawn Rejections The rejection of claims 47-52 under 35 U.S 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, has been withdrawn in view of Applicant’s amendments to the claims in the reply in the reply filed 12/15/2025. The rejection of claim 49 under 35 U.S 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, has been withdrawn in view of Applicant’s amendments to the claim in the reply in the reply filed 12/15/2025. The rejection of claims 47-52, under 35 U.S 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, has been withdrawn in view of Applicant’s amendments to the claims in the reply in the reply filed 12/15/2025. The rejection of claims 47-52, under 35 U.S 103, has been withdrawn in view of Applicant’s amendments and arguments to the claims in the reply in the reply filed 12/15/2025. New Objections and Rejections necessitated by Amendment to the claims. Specification The amendment filed 12/15/2025 is objected to under 35 U.S.C. 132(a) because it introduces new matter into the disclosure. 35 U.S.C. 132(a) states that no amendment shall introduce new matter into the disclosure of the invention. The added material which is not supported by the original disclosure is as follows: In the reply filed 12/15/2025, the applicant introduced new matter in the specification in the form of SEQ ID NO 115 in the Sequence Listing: guuugagagcuacccgggacgcggguccgggacaguagcaaguucaaauaaggcuaguccguuaucaacuucugaggccuuggcgaggcuucuaaguggcaccgagucggugcuuuuuu which specifically incorporates the nucleotide Uracil (U) (highlighted U). However, the original disclosure has support for thymidine (T) not for (U). By substituting “T” for “U” in the claim, the applicant has introduced new matter that was not present in the original disclosure. Consequently, the specification fails to provide an adequate written description for the claimed sequence. Applicant is required to cancel the new matter in the reply to this Office Action. Claim Objections Claims 48 and 59 are objected to because the claims are missing sequence identifiers. MPEP 2412.04: (c) Where the description or claims of a patent application discuss a sequence that is set forth in the “Sequence Listing XML” in accordance with paragraph (a) of this section, reference must be made to the sequence by use of the sequence identifier, preceded by “SEQ ID NO:” or the like in the text of the description or claims, even if the sequence is also embedded in the text of the description or claims of the patent application. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 48 and 60 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection. In the reply filed 12/15/2025, claim 48 was amended to recite an oligonucleotide comprising the sequence: (Ra)GUUUGAGAGCUACCCGGGACGCGGGUCCGGGACAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUCUGAGGCCUUGGCGAGGCUUCUAAGU[T]]GGCACCGAGUC GGUGCUUUUUU, which specifically incorporates the nucleotide Uracil (U) (highlighted U). However, the original disclosure has support for thymidine (T) not for (U). By substituting “T” for “U” in the claim, the applicant has introduced new matter that was not present in the original disclosure. Consequently, the specification fails to provide an adequate written description for the claimed sequence. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JULIO GOMEZ RODRIGUEZ whose telephone number is (571)270-0991. The examiner can normally be reached Monday - Friday 8:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 5712722916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JULIO WASHINGTON GOMEZ RODRIGUEZ/Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jan 18, 2022
Application Filed
Jul 08, 2025
Non-Final Rejection — §112
Dec 15, 2025
Response Filed
Apr 01, 2026
Final Rejection — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12534717
AAV CAPSID PROTEINS FOR NUCLEIC ACID TRANSFER
2y 5m to grant Granted Jan 27, 2026
Patent 12534725
METHOD FOR CONTROLLING MICRORNA EXPRESSION
2y 5m to grant Granted Jan 27, 2026
Patent 12514901
AD36E4ORF1: A THERAPEUTIC TREATMENT FOR ALZHEIMER'S DISEASE
2y 5m to grant Granted Jan 06, 2026
Patent 12480116
USE OF LNCRNA XR_595534.2 IN PREPARATION OF MEDICINE FOR TREATMENT OR PREVENTION OF CHRONIC PAIN
2y 5m to grant Granted Nov 25, 2025
Patent 12467052
Striatin interacting protein inhibitor and use thereof in preparation of anti-tumor drug
2y 5m to grant Granted Nov 11, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
50%
Grant Probability
96%
With Interview (+45.8%)
4y 1m
Median Time to Grant
Moderate
PTA Risk
Based on 22 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month