Prosecution Insights
Last updated: April 19, 2026
Application No. 17/629,603

Astaxanthin Over-Producing Strains of Phaffia Rhodozyma

Non-Final OA §103§112
Filed
Jan 24, 2022
Examiner
GOUGH, TIFFANY MAUREEN
Art Unit
1651
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
NextFerm Technologies Ltd.
OA Round
1 (Non-Final)
31%
Grant Probability
At Risk
1-2
OA Rounds
4y 5m
To Grant
80%
With Interview

Examiner Intelligence

Grants only 31% of cases
31%
Career Allow Rate
158 granted / 507 resolved
-28.8% vs TC avg
Strong +49% interview lift
Without
With
+49.2%
Interview Lift
resolved cases with interview
Typical timeline
4y 5m
Avg Prosecution
41 currently pending
Career history
548
Total Applications
across all art units

Statute-Specific Performance

§101
4.3%
-35.7% vs TC avg
§103
39.9%
-0.1% vs TC avg
§102
18.3%
-21.7% vs TC avg
§112
21.1%
-18.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 507 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I , claims 1-8, 11,12, 13,19 and the species of SEQ ID NO:4 of claim 5, in the reply filed on 5/27/2025 is acknowledged. Claims 1-10 are pending. Claims 9, 10, 14, 15, 16, 17, 18, 20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 5/27/2025. Claims 1-8, 11,12,13,19 have been examined on the merits herein. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 6 and 7 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. Since the microorganism, Phaffia rhodozyma strains as recited in claims 6 and 7, deposited with the NCYC under deposit numbers listed in claims 6 and 7, is recited in the claims, it is essential to the invention recited in those claims. It must therefore be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. If the microorganism is not so obtainable or available, the requirements of 35 U.S.C. 112 may be satisfied by a deposit of the microorganism. The specification does not disclose a repeatable process to obtain the microorganism and it is not apparent if the microorganism is readily available to the public. If the deposit is made under the terms of the Budapest Treaty, then an affidavit or declaration by applicants or a statement by an attorney of record over his/her signature and registration number, stating that the deposit has been made under the Budapest Treaty and that all restrictions imposed by the depositor on availability to the public of the deposited material will be irrevocably removed upon issuance of the patent would satisfy the deposit requirement. See 37 CFR 1.808. Because NCYC has acquired the status of an International Depository in accordance to the Budapest Treaty, a declaration stating that all restrictions will be irrevocably removed upon issuance of the patent will overcome this rejection. *Deposit receipts for the Phaffia rhodozyma strains as recited in claims 6 and 7 are of record and were filed with papers on 1/24/2022. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1, 2, 4, 6-8, 11, 12, 13, 19 is/are rejected under 35 U.S.C. 103 as being unpatentable over Albaino et al. (2014, IDS) in view of Hoshino (US6284506) in further view of Hara . Albaino teaches a yeast strain X. dendrorhous which overproduces the carotenoid astaxanthin. The reference teaches X. dendrorhous comprising a genome comprising i) according to claim 1 corresponding to gene FPS (encoding FPP-synthase, FPS) and gene crtE. (p. 2, whole page, Table 1, p. 3, Obtaining the genes controlling section, Table 2, p. 5, Results and Discussion section Seq. analysis of genes section, p. 6, whole pg., p. 8-9). A sequence search conducted by the Office demonstrates the strains of Alcaino have a 98.2% sequence identity to applicants SEQ ID NO:5 Query Match 98.2%; Score 88.4; Length 2885; Best Local Similarity 98.9%; Matches 89; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 ATATGTTCAAAATGTCAGGCGAGTTCTCGGGAGAAAAAAAAAGCGTGGGCTCTGAAACAG 60 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 179 ATATGTTCAAAGTGTCAGGCGAGTTCTCGGGAGAAAAAAAAAGCGTGGGCTCTGAAACAG 238 Qy 61 TGTGGAAATGTCTACAAAGTGAGCTGGATT 90 |||||||||||||||||||||||||||||| Db 239 TGTGGAAATGTCTACAAAGTGAGCTGGATT 268 Hoshino teach a P. rhodozyma strain (col. 1, lines 12-38, col. 2, lines 32-39, col. 4, lines 32-41, col. 5, lines 1-10, col. 9, lines 65-col. 10, lines 1-4, ex. 13) which is a hyper-producer of astaxanthin having a genome comprising SEQ ID NO:5. Hoshino teaches that the carotengenic pathway consists of multiple enzymatic steps involving the mevalonate pathway (col. 1, lines 25-col. 2, lines 1-10). The genes and enzymes involved in the pathway are useful in improving the astaxanthin production process which include FPS (farnesyl pyrophosphate)(col. 2, lines 47-57, col. 3, lines 1-col. 4lines 1-42, col. 5, lines 1-21, col. 6, lines 55-64). The reference teaches yeast strains having DNA sequences having one or more substitution so long as it maintains the required enzymatic activity to increase astaxanthin production. Common derivatives include amino acid exchanges or nucleotide substitutions which do not alter the protein or peptide activity (col. 3, lines 1-32). A sequence search conducted by the Office demonstrates the strains of Hoshino (SEQ ID NO:5) having 98.2% identity to applicants claimed SEQ ID NO:5, which are overproducers of astaxanthin. Query Match 98.2%; Score 88.4; Length 4092; Best Local Similarity 98.9%; Matches 89; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 ATATGTTCAAAATGTCAGGCGAGTTCTCGGGAGAAAAAAAAAGCGTGGGCTCTGAAACAG 60 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 266 ATATGTTCAAAGTGTCAGGCGAGTTCTCGGGAGAAAAAAAAAGCGTGGGCTCTGAAACAG 325 Qy 61 TGTGGAAATGTCTACAAAGTGAGCTGGATT 90 |||||||||||||||||||||||||||||| Db 326 TGTGGAAATGTCTACAAAGTGAGCTGGATT 355 The above references teach yeast strains of Phaffia rhodozyma, which are overproducers of carotenoids, specifically astaxanthin. The references teach that the strains comprise a genome comprising nucleotide sequences having 98.2% sequence identity to applicants claimed SEQ ID NO:5. Hoshino specifically teaches that common derivatives may comprise nucleotide substitutions so long as it maintains the required enzymatic activity to increase astaxanthin production. Applicants specification does not demonstrate that a point mutation in scaffold 69 of gene XDEN_04715 (which is the FPS gene taught by the prior art) or those of claim 2 changes the activity. For example, the specification demonstrates that the point mutation in XDEN_05955 (crtE) results in an amino acid exchange of proline to serine, which would not be an obvious variant/derivative (nor are there prior art teachings suggesting the amino acid exchange). The above references do not teach the additional mutations of claim 2; however Hara teaches a yeast strain of X. dendrorhous overexpressing carotenoids, specifically astaxanthin, wherein the strain overexpresses multiple genes including acaT/hmgS (corresponding to gene XDEN_06229 of claim 2)/hmgR/crtE (corresponding to gene XDEN_05955)/crtS enhancing carotenoid pathways and synergistically increasing astaxanthin production (p. 2, 2nd col.-p. 3, whole page, p. 4 combinatorial overexpression of genes section, Fig .1, Fig. 4). Thus, before the effective filing date of the claimed invention, nucleotide substitutions and deletions and yeast strains comprising multiple overexpressed genes making them hyperproducers would have been obvious to one of ordinary skill in the art when making recombinant yeast strains producing greater amounts of carotenoids given the teachings of the prior art references. Additionally, while the art does not teach that the strain is “characterized in that it is capable of producing a greater amount of carotenoid when cultivated in a yeast growth medium comprising at least 3%(w/v) carbon source…”, these strains contain the genome which make them hyper-producers of carotenoids. Thus, even if the claimed microorganism is not identical to the referenced microorganism with regard to some unidentified characteristics, the differences between that which is disclosed and that which is claimed are considered to be so slight that the referenced microorganism is likely to inherently possess the same characteristics of the claimed microorganism particularly in view of the similar characteristics which they have been shown to share. Thus the claimed strain would have been obvious to those skilled in the art within the meaning of USC 103. Accordingly, the claimed invention as a whole was at least prima facie obvious, if not anticipated by the reference, especially in the absence of evidence to the contrary. The Patent and Trademark Office is not equipped to conduct experimentation in order to determine whether or not applicant' s strains differ and, if so, to what extent, from the strains discussed in the references. Accordingly, it has been established that the prior art strains, which are of the same species as that claimed, likewise share the property of capable of producing a greater amount of carotenoid when cultivated in a yeast growth medium comprising at least 3%(w/v) carbon source, and thus demonstrate a reasonable possibility that the compared strains are either identical or sufficiently similar; and therefore, whatever differences exist, are not patentably significant. Therefore, the burden of establishing non-obviousness by objective evidence is shifted to Applicants. Thus, a POSITA would have had a reasonable expectation that the claimed strain and that of the prior art would exhibit the same characteristics and functions when substituted for each other, therefore, one could have substituted one known strain for another and the results of the substitution would have been predictable Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Castelblanco-Matiz (C-M) teaches a carotenoid overproducing mutant strain (XR4) of yeast strain of Phaffia rhodozyma, i.e. Xanthophyllomyces dendrorhous (the sexual state of Phaffia rhodozyma) which produces a greater amount of astaxanthin, i.e. a carotenoid, compared to wild-type strains. C-M teaches that the carotenoid pathway of X. dendrorhous has been well established and genes including geranylgeranyl pyrophosphate synthase (crtE) have been characterized and overexpressed. The XR4 strain comprises the genome comprising the crtE gene, corresponding to applicants claimed SEQ ID NO:4 (of claim 5). A sequence search conducted by the Office demonstrates the sequence identity (see below). Qy 1 CTTTATCAAGATACGTATCTTTCGAGAACGGAATCTGCGAATTAGGAGTTGACGTGCCCC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1791 CTTTATCAAGATACGTATCTTTCGAGAACGGAATCTGCGAATTAGGAGTTGACGTGCCCC 1732 Qy 61 CGTTTTCAGACGAGGCCGAGGAGGAGGAGGATGCAGAGGAGACGGATGATTGAAGCGAAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1731 CGTTTTCAGACGAGGCCGAGGAGGAGGAGGATGCAGAGGAGACGGATGATTGAAGCGAAG 1672 Qy 121 CAGATGAAGGAGGAATTACAGGCATGGGTATCGATGTTGGGCGAAGCTTGAAGATCTCTT 180 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Db 1671 CAGATGAAGGAGGAATTACAGGCATGGGTATCGGTGTTGGGCGAAGCTTGAAGATCTCTT 1612 Qy 181 GATAAGCCAGAAAGTAGACGTAGTTTGCACTATAATCCATAGTAGTTATCCGGT 234 ||||||||||||||||||||||||||||||||||||||||||| |||||||||| Db 1611 GATAAGCCAGAAAGTAGACGTAGTTTGCACTATAATCCATAGTGGTTATCCGGT 1558 . Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIFFANY MAUREEN GOUGH whose telephone number is (571)272-0697. The examiner can normally be reached M-Thu 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Adam Weidner can be reached at 571-272-3045. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TIFFANY M GOUGH/ Examiner, Art Unit 1651 /Adam Weidner/ SPE, Art Unit 1651
Read full office action

Prosecution Timeline

Jan 24, 2022
Application Filed
Jan 24, 2022
Response after Non-Final Action
Sep 16, 2025
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584113
METHOD OF CELL CULTURE
2y 5m to grant Granted Mar 24, 2026
Patent 12576138
COMPOUNDS AND METHODS FOR THE IMMOBILIZATION OF MYOSTATIN-INHIBITORS ON THE EXTRACELLULAR MATRIX BY TRANSGLUTAMINASE
2y 5m to grant Granted Mar 17, 2026
Patent 12553902
Methods, Kits and Compositions for Diagnosing and Treating Renal Disease
2y 5m to grant Granted Feb 17, 2026
Patent 12553903
IVALTINOSTAT COMBINATION THERAPY FOR TREATING PANCREATIC CANCER
2y 5m to grant Granted Feb 17, 2026
Patent 12520859
TURKEY COLLAGEN HYDROLYSATES AND METHODS OF MAKING
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
31%
Grant Probability
80%
With Interview (+49.2%)
4y 5m
Median Time to Grant
Low
PTA Risk
Based on 507 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month