Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election/Restrictions
Applicant's election without traverse of Group I, SEQ ID NO. 111, in the reply filed on 09/05/2025 is acknowledged. After further consideration, SEQ ID No. 112 will be examined along with the elected sequence.
Status of the Application
Claims 3, 4 and 6-23 are pending and are currently under examination.
Information Disclosure Statement
The submission of the Information Disclosure Statement on 01/18/2023 is in compliance with 37 CFR 1.97. The information disclosure statement has been considered by the examiner and signed copies have been placed in the file.
Drawings
The drawings filed 01/25/2022 are objected to under 37 CFR 1.83(a) because they are illegible for the reasons listed below:
Fig. 2 A-E all text is light and illegible.
Fig. 3 A-E all text is light and illegible.
Fig. 4 A-C the text on the x and y axis is light and illegible
Fig. 5 A-F all text is light and illegible.
Fig. 7 A, 7B has sequences that are light text and illegible.
Fig. 8 A-8G all text is light and illegible.
Fig. 9 A-B all text in the y-axis and legend is light and illegible.
Fig. 11 B some text on the x-axis is light and illegible
Fig. 13 A-D all text is light and illegible.
Fig. 14 A-L all text is light and illegible.
Fig. 15 A-C all text is light and illegible.
Fig. 16 A-C all text is light and illegible.
Fig. 17.3 A-B all text is light and illegible.
Fig. 17.6 A-N all text is light and illegible.
Fig. 19 A-B all text is light and illegible.
Fig. 21 A-B test on the y-axis and x-axis is light and illegible
Fig. 21 E-F test on the y-axis and x-axis is light and illegible
Fig. 23 A-C all text is light and illegible.
Fig. 26 all text is light and illegible.
Fig. 29 A-B has sequences that are light text and illegible.
Fig. 30 A-E all text is light and illegible.
Fig. 31 A-E the text on the x and y axis is light and illegible
Fig. 34 A-B all text is light and illegible.
Fig. 35 D-F all text on the legend is light and illegible.
Fig. 36 A-C all text is light and illegible.
Fig. 37 A-C all text is light and illegible.
Any structural detail that is essential for a proper understanding of the disclosed invention should be shown in the drawing. Replacement drawing sheets in compliance with 37 CFR 1.84 and 1.121(d) containing figures that are of sufficient quality to be electronically reproduced are required.
See 37 CFR 1.84(I). Replacement drawing sheets in compliance with 37 CFR 1.84 and 1.121(d) containing figures that are of sufficient quality to be electronically reproduced are required.
MPEP § 608.02(d). Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification – Sequence Listing
The following guidelines illustrate the preferred layout for the specification of a utility application. These guidelines are suggested for the applicant’s use.
Arrangement of the Specification
As provided in 37 CFR 1.77(b), the specification of a utility application should include the following sections in order. Each of the lettered items should appear in upper case, without underlining or bold type, as a section heading. If no text follows the section heading, the phrase “Not Applicable” should follow the section heading:
(a) TITLE OF THE INVENTION.
(b) CROSS-REFERENCE TO RELATED APPLICATIONS.
(c) STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT.
(d) THE NAMES OF THE PARTIES TO A JOINT RESEARCH AGREEMENT.
(e) INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ON A READ-ONLY OPTICAL DISC, AS A TEXT FILE OR AN XML FILE VIA THE PATENT ELECTRONIC SYSTEM. (emphasis added).
(f) STATEMENT REGARDING PRIOR DISCLOSURES BY THE INVENTOR OR A JOINT INVENTOR.
(g) BACKGROUND OF THE INVENTION.
(1) Field of the Invention.
(2) Description of Related Art including information disclosed under 37 CFR 1.97 and 1.98.
(h) BRIEF SUMMARY OF THE INVENTION.
(i) BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S).
(j) DETAILED DESCRIPTION OF THE INVENTION.
(k) CLAIM OR CLAIMS (commencing on a separate sheet).
(l) ABSTRACT OF THE DISCLOSURE (commencing on a separate sheet).
(m) SEQUENCE LISTING. (See MPEP § 2422.03 and 37 CFR 1.821 - 1.825).
A “Sequence Listing” is required on paper if the application discloses a nucleotide or amino acid sequence as defined in 37 CFR 1.821(a) and if the required “Sequence Listing” is not submitted as an electronic document either on read-only optical disc or as a text file via the patent electronic system.
Specific deficiency - The incorporation by reference paragraph required by 37 CFR 1.834(c)(1), 1.835(a)(2), or 1.835(b)(2) is missing, defective or incomplete.
This requirement is necessary if the application has:
(i) One or more ASCII plain text files, submitted via the USPTO patent electronic filing system or on one or more read-only optical discs (see § 1.52(e)(8) ), identifying the names of each file, the date of creation of each file, and the size of each file in bytes, for the following document types:
(A) A "Computer Program Listing Appendix" (see § 1.96(c) );
(B) A “Sequence Listing" (see § 1.821(c) ); or
(C) "Large Tables" (see § 1.58(c) ).
(ii) An XML file for a " Sequence Listing XML" (see § 1.831(a) ), submitted via the USPTO patent electronic filing system or on one or more read-only optical discs (see § 1.52(e)(8) ), identifying the names of each file, the date of creation of each file, and the size of each file in bytes.
Required response - Applicant must:
• Provide a substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph, consisting of:
• A copy of the previously-submitted specification, with deletions
Claim Objections
Claim 23 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Claim Rejections – Improper Markush
Claim 8 is rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: The claims are directed to a large multitude of sequences that have no common searchable structure.
"A Markush claim contains an 'improper Markush grouping' if: (1) The species of the Markush group do not share a 'single structural similarity,' or (2) the species do not share a common use." Supplementary Examination Guidelines for Determining Compliance With 35 U.S.C. 112 and for Treatment of Related Issues in Patent Applications, 76 Fed. Reg. 7162, 7166 (2011).
When the Markush grouping is for alternatives of chemical compounds, they shall be regarded as being of a similar nature where the following criteria are fulfilled:
(A) All alternatives have a common property or activity; and
(B) (1) A common structure is present, i.e., a significant structural element is shared by all of the alternatives; or
(B) (2) In cases where the common structure cannot be the unifying criteria, all alternatives belong to a recognized class of chemical compounds in the art to which the invention pertains.
In paragraph (B)(1), above, the words “significant structural element is shared by all of the alternatives” refer to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity. The structural element may be a single component or a combination of individual components linked together.
In paragraph (B)(2), above, the words “recognized class of chemical compounds” mean that there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved.
The sequences shown in claim 8 do not share any common sequence, and therefore do not share a common structure. For example, SEQ ID NO. 1 is 40 nucleotides long and represented as ccgggtgggggtttggcaccgggcctggcgcagggattcg and SEQ ID No. 108 is 17 nucleotides long and represented as ungcagcgauucunnuu (wherein n is a, c, g, or u).
Although both sequences, like all DNA/RNA sequences, are made up of the same four bases, they do not share any significant similarity in the order in which those bases are arranged. Thus, the structures of the DNA molecules represented by the sequences are different.
Moreover, in order for the members of the Markush group to belong to “recognized class of chemical compounds” there must be an expectation that the members of the class will behave in the same way in the context of the claimed invention. In other words, each member of the class could be substituted one for the other with the expectation that the same intended result would be achieved. In the instant case, activity of any specific nucleic acid molecule is dependent upon the specific sequence of nucleotides.
The specification describes several different aptamer sequences as claimed in Tables 3-7 wherein each of the sequences has a different level of binding to a CD3 target in Jurkat and EL4 cells. There is no expectation that any one of the nucleotide sequences as claimed can be substituted for any of the other with a completely different sequence with the expectation of the same activity.
In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 3 and 6-22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 3 recites "a variant thereof" and is indefinite because the metes and bounds of a variant is not defined and thus it is unclear what structure of the aptamer is being claimed. Claims 6-22 are rejected as being depended on a base claim.
Claim 12 is indefinite because it recites “A vehicle for delivering an agent, a dye …” and recites “wherein the vehicle comprises the aptamer of claim 3” but does not specifical claim the vehicle actually has an agent, a dye, etc. The claims only require the aptamer. The claims will be interpreted such that the vehicle can comprise an agent, dye etc. and the aptamer.
Claim 13 lacks antecedent basis because it recites “The vehicle of claim 11…” however claim 11 does not recite a vehicle. The claim will not be further examined on the merits as it cannot be ascertained, without assumption, what further limitations are included in claim 11. Claims 14-22 will not be further examined on the merits because they depend from claim 13 which lacks antecedent basis.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 3, 4 and 6-11 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Diener et al. (US Patent No. 7,566,701).
Under AIA 35 U.S.C. 102(a)(1), there is no requirement that the prior art relied upon be by others. Thus, any prior art which falls under AIA 35 U.S.C. 102(a)(1) need not be by another to constitute potentially available prior art. However, disclosures of the subject matter made one year or less before the effective filing date of the claimed invention by the inventor or a joint inventor or another who obtained the subject matter directly or indirectly from the inventor or a joint inventor may fall within an exception under AIA 35 U.S.C. 102(b)(1) to AIA 35 U.S.C. 102(a)(1). See MPEP 2152.02(f).
The instant specification defines the aptamers of invention can have any desired length. The aptamers may include at least about 15 oligonucleotides. Preferably, the aptamers may include up to about 80 nucleotides. (page 16 lines 28-30).
Diener et al. teach an aptamer sequence of 80 nucleotides in length comprising all 21 nucleotides of instantly claimed SEQ ID No. 112 and SEQ ID No. 57 (see alignment below). This meets the limitations of claims 4 and 8.
RESULT 4
US-11-222-346A-156
(NOTE: this sequence has 2 duplicates in the database searched)
Sequence 156, US/11222346A
Patent No. 7566701
GENERAL INFORMATION
APPLICANT: Diener, John L
SEQ ID NO 156
LENGTH: 80
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Description of Artificial Sequence: chemically synthesized
Query Match 100.0%; Score 21; Length 80;
Best Local Similarity 76.2%;
Matches 16; Conservative 5; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGGNTTGGCNNNGGGNCTGGC 21
Db 42 GGGTTTGGCATTGGGTCTGGC 62
The instant specification defines a variant of a nucleic acid sequence as including 80-99% sequence identity to a specific sequence (see page 17 lines 16-22). The sequence of Diener having SEQ ID No. 156 comprises 20 nucleotides identical to SEQ ID No 111 which would meet the limitations of a variant thereof. This meets the limitations of claim 3
Diener et al. teach the aptamers can have a dissociation constant 100 nM or less (see 44) and teach the aptamer can be modified with non-naturally occurring bases such as thiouridine (see 92). This meets the limitations of claims 6, 7, 9 and 10. Diener et al. further teach pharmaceutical carriers comprising the aptamer and other agents (174-175). This meets the limitations of claim 12.
With respect to claim 11, because the aptamer sequence meets the structural limitations of claim 3, it would have the functional limitations of claim 11 wherein the aptamer binds to but does not activate CD3+T cells.
Thus Diener et al. anticipates the instant claims.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 3, 4 and 6-10 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zumrut, Hasan E., et al. "Ligand-guided selection of aptamers against T-cell Receptor-cluster of differentiation 3 (TCR-CD3) expressed on Jurkat E6 cells." Analytical biochemistry 512 (2016): 1-7) of record cited on P.237.IN filed 01/25/2022) and Diener et al. (US Patent No. 7,566,701).
Zumrut et al teach the T cell receptor complex is a multidomain protein consisting of both CD3γε and CD3δε (see page 2 last para of col. 1) and teach design of aptamers targeted to CD3 in Jurkat T lymphocyte cells (see page 2-3 and Fig. 2) but do not teach the specific sequences having SEQ ID Nos. 111, 112 and 57. Zumrut et al. teach the routine and well known SELEX method to obtain aptamers binding CD3 with very high affinity (abstract, which refers to affinities as low as 3.06 nM). It would have therefore been obvious for one of ordinary skill in the art to make and arrive at the claimed aptamers targeted to any CD3 domain of the TCR complex.
It was well known in the art that aptamers with dissociation constants of at least 100 nM or less were efficient (see 44) and that aptamers can be modified with non-naturally occurring bases such as thiouridine (see 92) as taught by Diener et al. Diener et al. teach pharmaceutical carriers comprising aptamers and other agents (174-175). One of skill in the art would have wanted to make aptamers with these known features for efficient binding to a target and would have been capable of making said aptamers.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Closest prior art
The closest prior art to the methods of isolating T cells from a subject using the aptamer of claim 3 is Zumrut et al. (cited above) who teach design of aptamers targeted to CD3e in Jurkat T lymphocyte cells (see page 2-3 and Fig. 2) but do not teach the specific sequences having SEQ ID Nos. 111, 112 and 57. Zumrut et al. teach routine and well known SELEX methods to obtain aptamers binding CD3e with very high affinity (abstract, which refers to affinities as low as 3.06 nM). Zumrut et al. do not teach using the aptamers to isolate T cells from a subject and the prior art does not teach targeting CD3e with aptamers and isolating T cells from a subject using said aptamers.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/
Primary Examiner Art Unit 1636