Prosecution Insights
Last updated: October 02, 2026
Application No. 17/632,222

NUCLEIC ACID AND AMINO ACID SEQUENCES ENCODING HIGH-LEVEL EXPRESSOR FACTOR VIII POLYPEPTIDES AND METHODS OF USE

Final Rejection §102§103§112§DOUBLEPATENT
Filed
Feb 01, 2022
Priority
Jan 29, 2021 — provisional 63/143,315 +1 more
Examiner
DESAI, ANAND U
Art Unit
1655
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Expression Therapeutics LLC
OA Round
2 (Final)
78%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants 78% — above average
78%
Career Allowance Rate
718 granted / 915 resolved
+18.5% vs TC avg
Moderate +13% lift
Without
With
+12.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 1m
Avg Prosecution
10 currently pending
Career history
941
Total Applications
across all art units

Statute-Specific Performance

§101
3.8%
-36.2% vs TC avg
§103
19.4%
-20.6% vs TC avg
§102
21.4%
-18.6% vs TC avg
§112
36.5%
-3.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 915 resolved cases

Office Action

§102 §103 §112 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This office action is in response to the amendment filed on December 29, 2025. New claims 6-8 have been added. Claims 1-8 are currently pending and are under examination. Withdrawal of Rejections The rejection of claim(s) 1-3 under 35 U.S.C. 102(a)(1) as being anticipated by Shestopal et al. (J Thromb Haemost 15: 709-720 (2017)) is withdrawn based on the amendment to the claims to recite different factor VIII polypeptides. The rejection of claim(s) 3 under 35 U.S.C. 102(a)(2) as being anticipated by Lollar (U.S. Patent 7,635,763 B2) is withdrawn based on the 35 USC 102(b)(2)(C) statement regarding owned by the same person or subject to an obligation of assignment to the same person. The rejection of claim(s) 1-5 under 35 U.S.C. 102(a)(2) as being anticipated by Lollar (U.S. Patent 8,188,246 B2) is withdrawn based on the 35 USC 102(b)(2)(C) statement regarding owned by the same person or subject to an obligation of assignment to the same person. The rejection of claim(s) 4 and 5 under 35 U.S.C. 103 as being unpatentable over Shestopal et al. (J Thromb Haemost 15: 709-720 (2017)) in view of Lollar (U.S. Patent 8,188,246 B2) is withdrawn based on the amendment to the claims to recite different factor VIII polypeptides and based on the 35 USC 102(b)(2)(C) statement regarding owned by the same person or subject to an obligation of assignment to the same person. Pending Rejections Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 3, and 6 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 of U.S. Patent No. 7,635,763 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of overlapping scope. The species have overlapping sequence identity as currently claimed in the instant application. Lollar (U.S. Patent No. 7,635,763 B2) disclose an isolated nucleic acid molecule encoding a modified factor VIII polypeptide comprising a nucleotide sequence having at least 99.7% sequence identity to the polynucleotide sequence shown in SEQ ID NO: 18, wherein said nucleotide sequence encodes a polypeptide characterized by high-level expression when compared to a corresponding human factor VIII polypeptide expressed under the same conditions (see claim 1). The encoded polypeptide from SEQ ID NO: 18 of the issued patent has 99.7% sequence identity to SEQ ID NO: 19 of the pending application (see alignment in Non-Final mailed on 7/28/2025 in 35 U.S.C. 102(a)(2) rejection. It would have been obvious to the person having ordinary skill in the art to isolate the modified factor VIII polypeptide, because the issued patent discloses the method of isolating the polypeptide after recombinant expression (see claims 11-14). Therefore, the isolated modified factor VIII polypeptide is obvious to the person having ordinary skill in the art. Claims 1-8 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 3-11 of U.S. Patent No. 8,188,246 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the species are of overlapping scope. Lollar (U.S. Patent 8,188,246 B2) disclose an isolated polypeptide comprising an amino acid sequence having at least 99.7% sequence identity to SEQ ID NO: 19. A method of increasing the level of expression of a factor VIII polypeptide in a cell comprising: a) introducing into said cell a nucleic acid molecule comprising a nucleotide sequence having at least 99.7% sequence identity to SEQ ID NO: 18, wherein said sequence encodes said factor VIII polypeptide and said factor VIII polypeptide is characterized by high expression; and b) culturing said cell under conditions that allow expression of said nucleic acid molecule. The method, wherein said nucleic acid molecule comprises a nucleotid a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 18. The method, further comprising isolating said polypeptide. The method, further comprising isolating said polypeptide. A method of treating a factor VIII deficiency comprising administering to a subject in need thereof a composition comprising a therapeutically effective amount of a polypeptide, wherein said polypeptide comprises an amino acid sequence having at least 99.7% sequence identity to SEQ ID NO: 19 and said polypeptide is characterized by high-level expression. An isolated polypeptide comprising an amino acid sequence having at least 99.7% sequence identity to SEQ ID NO: 19, wherein said polypeptide is characterized by high-level expression as compared to a corresponding human factor VIII polypeptide expressed under the same conditions. A composition comprising a polypeptide and a pharmaceutically acceptable carrier. The composition, wherein the composition treats a factor VIII deficiency (see alignment in Non-Final mailed on 7/28/2025 in 35 U.S.C 102(a)(2) of SEQ ID NO: 18 of issued patent (identified as Query) and SEQ ID NO: 19 of instant application (identified as Sbjct) and claims 1-11 of issued patent). The variability of amino acids in SEQ ID NO: 19 of the issued patent to the currently claimed factor VIII polypeptide sequences in the instant application are disclosed in corresponding issued patent SEQ ID NO: sequences that have factor VIII activity (e.g. SEQ ID NO: 20), so that it would have been obvious to the person having ordinary skill in the art to arrive at SEQ ID NOs of the pending application that would result in 100% identity with factor VIII polypeptides with similar functional activity, therefore claims 2, and 6-8 are also rejected. Claims 1, 3-5 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 20-27 of U.S. Patent No. 10,058,624 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the species are of overlapping scope. Doering et al. (U.S. Patent 10,058,624 B2) disclose an isolated polynucleotide, e.g. at least 90% identical to SEQ ID NO: 12; SEQ ID NO: 12 comprises a sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A method of treating a factor VIII deficiency (hemophilia A) comprising administering to a subject in need thereof a composition comprising a therapeutically effective amount of a vector, wherein said polynucleotide sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A composition comprising the vector and a pharmaceutically acceptable carrier. The composition, wherein the composition treats a factor VIII deficiency (see alignment below in 35 U.S.C 102(a)(2) of SEQ ID NO: 20 of the pending application (identified as Qy) and SEQ ID NO: 12 of the issued patent (identified as Db) and claims 1 and 20-27). It would have been obvious to the person having ordinary skill in the art to further isolate the active ingredient, factor VIII, and administer the active ingredient as a pharmaceutical composition to treat the blood clotting disorder of hemophilia A, because Doering et al. disclose the use of the nucleic acid that is encoding the same polypeptide factor VIII to treat the same patient population. Claims 1, 3-5 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7, and 11-18 of U.S. Patent No. 10,898,588 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the species are of overlapping scope. Doering et al. (U.S. Patent 10,898,588 B2) disclose an isolated polynucleotide, e.g. at least 90% identical to SEQ ID NO: 12; SEQ ID NO: 12 comprises a sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A method of treating a factor VIII deficiency (hemophilia A) comprising administering to a subject in need thereof a composition comprising a therapeutically effective amount of a vector, wherein said polynucleotide sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A composition comprising the vector and a pharmaceutically acceptable carrier. The composition, wherein the composition treats a factor VIII deficiency (see alignment below in 35 U.S.C 102(a)(2) of SEQ ID NO: 20 of the pending application (identified as Qy) and SEQ ID NO: 12 of the issued patent (identified as Db) and claims 1-18 of issued patent). It would have been obvious to the person having ordinary skill in the art to further isolate the active ingredient, factor VIII, and administer the active ingredient as a pharmaceutical composition to treat the blood clotting disorder of hemophilia A, because Doering et al. disclose the use of the nucleic acid that is encoding the same polypeptide factor VIII to treat the same patient population. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 refers to an isolated modified factor VIII polypeptide comprising a nucleotide sequence. It is unclear how a polypeptide comprises a nucleotide sequence. Clarification is requested as to whether the claims are drawn to a polypeptide or a polynucleotide. Claims dependent on a rejected claim are rejected for failing to cure the indefiniteness. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1 and 3-5 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C 102(a)(2) as being anticipated by Doering et al. (U.S. Patent No. 10,058,624 B2). Doering et al. (U.S. Patent 10,058,624 B2) disclose an isolated polynucleotide, e.g. at least 90% identical to SEQ ID NO: 12 (see claim 25); SEQ ID NO: 12 comprises a sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A method of treating a factor VIII deficiency (hemophilia A) comprising administering to a subject in need thereof a composition comprising a therapeutically effective amount of a vector, wherein said polynucleotide sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A composition comprising the vector and a pharmaceutically acceptable carrier. The composition, wherein the composition treats a factor VIII deficiency (see alignment below of SEQ ID NO: 20 of the pending application (identified as Qy) and SEQ ID NO: 12 of the issued patent (identified as Db) (claims 1 and 20-27)). Claim 1 of the pending application claims a polypeptide comprising a nucleotide sequence. Alignment Scores: Length: 4404 Score: 7773.00 Matches: 1455 Percent Similarity: 99.3% Conservative: 2 Best Local Similarity: 99.2% Mismatches: 0 Query Match: 99.7% Indels: 10 Gaps: 1 US-17/632,222 (SEQ ID NO: 20) (1-1457) x US-15/128,912 (SEQ ID NO:12) (1-4404) Qy 1 MetGlnLeuGluLeuSerThrCysValPheLeuCysLeuLeuProLeuGlyPheSerAla 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGCAGCTGGAACTGTCTACCTGTGTGTTTCTGTGTCTGCTGCCTCTGGGGTTTTCTGCT 60 Qy 21 IleArgArgTyrTyrLeuGlyAlaValGluLeuSerTrpAspTyrArgGlnSerGluLeu 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ATCCGCCGCTACTATCTGGGAGCCGTGGAGCTGTCCTGGGACTACAGGCAGAGCGAGCTG 120 Qy 41 LeuArgGluLeuHisValAspThrArgPheProAlaThrAlaProGlyAlaLeuProLeu 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTGAGAGAACTGCACGTGGATACCAGATTCCCAGCTACCGCTCCAGGAGCTCTGCCTCTG 180 Qy 61 GlyProSerValLeuTyrLysLysThrValPheValGluPheThrAspGlnLeuPheSer 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GGCCCATCCGTGCTGTACAAGAAAACCGTCTTCGTGGAGTTTACCGACCAGCTGTTCAGC 240 Qy 81 ValAlaArgProArgProProTrpMetGlyLeuLeuGlyProThrIleGlnAlaGluVal 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GTGGCCAGGCCAAGACCACCTTGGATGGGACTGCTGGGACCAACCATCCAGGCTGAGGTG 300 Qy 101 TyrAspThrValValValThrLeuLysAsnMetAlaSerHisProValSerLeuHisAla 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 TACGATACCGTGGTCGTGACCCTGAAAAACATGGCCTCCCATCCCGTGAGCCTGCACGCT 360 Qy 121 ValGlyValSerPheTrpLysSerSerGluGlyAlaGluTyrGluAspHisThrSerGln 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GTCGGGGTGTCCTTCTGGAAGTCCAGCGAGGGAGCCGAGTACGAAGACCATACCTCCCAG 420 Qy 141 ArgGluLysGluAspAspLysValLeuProGlyLysSerGlnThrTyrValTrpGlnVal 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CGCGAGAAAGAAGACGATAAGGTGCTGCCTGGCAAAAGCCAGACCTATGTCTGGCAGGTG 480 Qy 161 LeuLysGluAsnGlyProThrAlaSerAspProProCysLeuThrTyrSerTyrLeuSer 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CTGAAGGAGAACGGACCAACCGCTAGCGACCCACCATGCCTGACCTACTCTTATCTGTCC 540 Qy 181 HisValAspLeuValLysAspLeuAsnSerGlyLeuIleGlyAlaLeuLeuValCysArg 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CACGTCGATCTGGTGAAGGACCTGAATTCCGGACTGATCGGAGCTCTGCTGGTGTGTAGA 600 Qy 201 GluGlySerLeuThrArgGluArgThrGlnAsnLeuHisGluPheValLeuLeuPheAla 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GAGGGAAGCCTGACCAGAGAAAGAACCCAGAACCTGCATGAGTTCGTCCTGCTGTTCGCC 660 Qy 221 ValPheAspGluGlyLysSerTrpHisSerAlaArgAsnAspSerTrpThrArgAlaMet 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GTGTTTGACGAAGGGAAGAGCTGGCACTCTGCCCGCAATGACTCCTGGACCAGAGCTATG 720 Qy 241 AspProAlaProAlaArgAlaGlnProAlaMetHisThrValAsnGlyTyrValAsnArg 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 GATCCAGCTCCTGCTAGAGCTCAGCCTGCTATGCACACCGTCAACGGCTACGTGAATCGG 780 Qy 261 SerLeuProGlyLeuIleGlyCysHisLysLysSerValTyrTrpHisValIleGlyMet 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TCTCTGCCAGGACTGATCGGCTGCCATAAGAAAAGCGTCTATTGGCACGTGATCGGAATG 840 Qy 281 GlyThrSerProGluValHisSerIlePheLeuGluGlyHisThrPheLeuValArgHis 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GGCACCAGCCCCGAGGTGCATTCTATCTTCCTGGAAGGCCACACCTTTCTGGTCAGGCAC 900 Qy 301 HisArgGlnAlaSerLeuGluIleSerProLeuThrPheLeuThrAlaGlnThrPheLeu 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CATAGACAGGCCTCTCTGGAGATCTCCCCTCTGACCTTCCTGACCGCTCAGACCTTTCTG 960 Qy 321 MetAspLeuGlyGlnPheLeuLeuPheCysHisIleSerSerHisHisHisGlyGlyMet 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATGGACCTGGGGCAGTTCCTGCTGTTTTGCCATATCTCTTCCCACCATCACGGAGGAATG 1020 Qy 341 GluAlaHisValArgValGluSerCysAlaGluGluProGlnLeuArgArgLysAlaAsp 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GAGGCTCACGTCAGGGTGGAATCCTGTGCTGAGGAACCACAGCTGAGAAGAAAGGCTGAT 1080 Qy 361 GluGluGluAspTyrAspAspAsnLeuTyrAspSerAspMetAspValValArgLeuAsp 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GAGGAAGAGGACTACGACGATAACCTGTATGACAGCGATATGGACGTCGTGCGCCTGGAC 1140 Qy 381 GlyAspAspValSerProPheIleGlnIleArgSerValAlaLysLysHisProLysThr 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GGCGACGATGTCAGCCCTTTCATCCAGATCCGGTCTGTGGCCAAGAAACATCCAAAGACC 1200 Qy 401 TrpValHisTyrIleAlaAlaGluGluGluAspTrpAspTyrAlaProLeuValLeuAla 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TGGGTCCACTACATCGCCGCTGAAGAGGAAGATTGGGACTATGCCCCCCTGGTGCTGGCT 1260 Qy 421 ProAspAspArgSerTyrLysSerGlnTyrLeuAsnAsnGlyProGlnArgIleGlyArg 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CCTGACGATAGATCCTACAAAAGCCAGTATCTGAACAATGGGCCCCAGCGCATCGGACGG 1320 Qy 441 LysTyrLysLysValArgPheMetAlaTyrThrAspGluThrPheLysThrArgGluAla 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 AAGTACAAGAAAGTGAGGTTCATGGCCTATACCGACGAGACCTTTAAGACCAGAGAGGCT 1380 Qy 461 IleGlnHisGluSerGlyIleLeuGlyProLeuLeuTyrGlyGluValGlyAspThrLeu 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 ATCCAGCACGAATCCGGGATCCTGGGACCTCTGCTGTACGGCGAAGTGGGGGATACCCTG 1440 Qy 481 LeuIleIlePheLysAsnGlnAlaSerArgProTyrAsnIleTyrProHisGlyIleThr 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CTGATCATCTTCAAGAACCAGGCCTCCAGGCCATACAATATCTATCCCCATGGCATCACC 1500 Qy 501 AspValArgProLeuTyrSerArgArgLeuProLysGlyValLysHisLeuLysAspPhe 520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 GACGTGAGACCACTGTACAGCAGGAGACTGCCCAAGGGGGTCAAACACCTGAAGGATTTC 1560 Qy 521 ProIleLeuProGlyGluIlePheLysTyrLysTrpThrValThrValGluAspGlyPro 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 CCCATCCTGCCTGGAGAGATCTTTAAGTATAAATGGACCGTCACCGTGGAAGACGGGCCT 1620 Qy 541 ThrLysSerAspProArgCysLeuThrArgTyrTyrSerSerPheValAsnMetGluArg 560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 ACCAAGTCCGATCCACGCTGCCTGACCCGGTACTATAGCTCTTTCGTGAACATGGAGAGA 1680 Qy 561 AspLeuAlaSerGlyLeuIleGlyProLeuLeuIleCysTyrLysGluSerValAspGln 580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 GACCTGGCTAGCGGACTGATCGGACCCCTGCTGATCTGTTACAAAGAGAGCGTGGACCAG 1740 Qy 581 ArgGlyAsnGlnIleMetSerAspLysArgAsnValIleLeuPheSerValPheAspGlu 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 AGGGGCAACCAGATCATGTCTGATAAGAGAAATGTCATCCTGTTCTCCGTGTTTGACGAG 1800 Qy 601 AsnArgSerTrpTyrLeuThrGluAsnIleGlnArgPheLeuProAsnProAlaGlyVal 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 AACCGCAGCTGGTACCTGACCGAGAACATCCAGCGGTTCCTGCCAAATCCAGCTGGAGTG 1860 Qy 621 GlnLeuGluAspProGluPheGlnAlaSerAsnIleMetHisSerIleAsnGlyTyrVal 640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 CAGCTGGAGGACCCAGAATTTCAGGCTTCCAACATCATGCATAGCATCAATGGCTACGTG 1920 Qy 641 PheAspSerLeuGlnLeuSerValCysLeuHisGluValAlaTyrTrpTyrIleLeuSer 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TTCGATAGCCTGCAGCTGTCTGTCTGCCTGCACGAGGTGGCCTACTGGTATATCCTGTCC 1980 Qy 661 IleGlyAlaGlnThrAspPheLeuSerValPhePheSerGlyTyrThrPheLysHisLys 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 ATCGGCGCTCAGACCGACTTCCTGTCCGTGTTCTTTAGCGGGTACACCTTTAAGCATAAA 2040 Qy 681 MetValTyrGluAspThrLeuThrLeuPheProPheSerGlyGluThrValPheMetSer 700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 ATGGTGTATGAGGATACCCTGACCCTGTTCCCCTTTTCTGGCGAGACCGTGTTCATGTCC 2100 Qy 701 MetGluAsnProGlyLeuTrpIleLeuGlyCysHisAsnSerAspPheArgAsnArgGly 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 ATGGAAAACCCTGGCCTGTGGATCCTGGGGTGCCACAACAGCGACTTCAGGAATAGAGGA 2160 Qy 721 MetThrAlaLeuLeuLysValSerSerCysAspLysAsnThrGlyAspTyrTyrGluAsp 740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 ATGACCGCCCTGCTGAAAGTGTCCAGCTGTGATAAGAATACCGGCGATTACTATGAGGAC 2220 Qy 741 SerTyrGluAspIleSerAlaTyrLeuLeuSerLysAsnAsnAlaIleGluProArgSer 760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 TCTTACGAAGATATCTCCGCTTATCTGCTGAGCAAGAACAATGCCATCGAGCCCAGGTCT 2280 Qy 761 PheSerGlnAsn------------------------------ProProValLeuLysArg 770 |||:::|||||| ||||||||||||:::||| Db 2281 TTCGCTCAGAACTCCAGACCTCCAAGCGCTTCTGCTCCTAAGCCACCTGTGCTGAGAAGA 2340 Qy 771 HisGlnArgAspIleSerLeuProThrPheGlnProGluGluAspLysMetAspTyrAsp 790 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 CATCAGAGGGACATCTCCCTGCCTACCTTCCAGCCAGAGGAAGATAAAATGGACTACGAC 2400 Qy 791 AspIlePheSerThrGluThrLysGlyGluAspPheAspIleTyrGlyGluAspGluAsn 810 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 GATATCTTCAGCACCGAGACCAAGGGGGAAGATTTTGACATCTATGGAGAGGACGAAAAC 2460 Qy 811 GlnAspProArgSerPheGlnLysArgThrArgHisTyrPheIleAlaAlaValGluGln 830 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 CAGGATCCAAGATCCTTCCAGAAGAGAACCAGACACTACTTTATCGCCGCTGTGGAGCAG 2520 Qy 831 LeuTrpAspTyrGlyMetSerGluSerProArgAlaLeuArgAsnArgAlaGlnAsnGly 850 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 CTGTGGGACTATGGGATGTCCGAAAGCCCACGGGCCCTGAGGAACAGAGCTCAGAATGGA 2580 Qy 851 GluValProArgPheLysLysValValPheArgGluPheAlaAspGlySerPheThrGln 870 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 GAGGTGCCCCGCTTCAAGAAAGTCGTGTTCCGGGAGTTTGCCGACGGCAGCTTTACCCAG 2640 Qy 871 ProSerTyrArgGlyGluLeuAsnLysHisLeuGlyLeuLeuGlyProTyrIleArgAla 890 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 CCATCTTACAGGGGGGAGCTGAACAAGCATCTGGGGCTGCTGGGACCCTATATCAGAGCC 2700 Qy 891 GluValGluAspAsnIleMetValThrPheLysAsnGlnAlaSerArgProTyrSerPhe 910 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 GAGGTCGAAGATAACATCATGGTGACCTTCAAGAATCAGGCTTCTCGCCCCTACTCCTTT 2760 Qy 911 TyrSerSerLeuIleSerTyrProAspAspGlnGluGlnGlyAlaGluProArgHisAsn 930 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 TATTCTTCCCTGATCTCCTACCCTGACGATCAGGAGCAGGGCGCCGAACCTAGGCACAAC 2820 Qy 931 PheValGlnProAsnGluThrArgThrTyrPheTrpLysValGlnHisHisMetAlaPro 950 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 TTCGTGCAGCCAAATGAGACCAGAACCTACTTTTGGAAGGTGCAGCATCACATGGCTCCC 2880 Qy 951 ThrGluAspGluPheAspCysLysAlaTrpAlaTyrPheSerAspValAspLeuGluLys 970 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 ACCGAGGATGAATTCGACTGCAAAGCTTGGGCCTATTTTTCCGATGTCGACCTGGAGAAG 2940 Qy 971 AspValHisSerGlyLeuIleGlyProLeuLeuIleCysArgAlaAsnThrLeuAsnAla 990 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 GACGTGCATAGCGGCCTGATCGGGCCTCTGCTGATCTGTCGCGCCAACACCCTGAATGCT 3000 Qy 991 AlaHisGlyArgGlnValThrValGlnGluPheAlaLeuPhePheThrIlePheAspGlu 1010 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 GCTCACGGAAGACAGGTCACCGTGCAGGAGTTCGCTCTGTTCTTTACCATCTTTGACGAA 3060 Qy 1011 ThrLysSerTrpTyrPheThrGluAsnValGluArgAsnCysArgAlaProCysHisLeu 1030 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 ACCAAGAGCTGGTACTTCACCGAGAACGTGGAAAGGAATTGCAGAGCCCCCTGTCATCTG 3120 Qy 1031 GlnMetGluAspProThrLeuLysGluAsnTyrArgPheHisAlaIleAsnGlyTyrVal 1050 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 CAGATGGAGGACCCTACCCTGAAGGAAAACTACAGGTTCCACGCCATCAATGGATATGTC 3180 Qy 1051 MetAspThrLeuProGlyLeuValMetAlaGlnAsnGlnArgIleArgTrpTyrLeuLeu 1070 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 ATGGATACCCTGCCCGGCCTGGTCATGGCTCAGAACCAGCGCATCCGGTGGTACCTGCTG 3240 Qy 1071 SerMetGlySerAsnGluAsnIleHisSerIleHisPheSerGlyHisValPheSerVal 1090 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 TCTATGGGATCCAACGAGAATATCCATAGCATCCACTTCTCTGGCCATGTCTTTTCCGTG 3300 Qy 1091 ArgLysLysGluGluTyrLysMetAlaValTyrAsnLeuTyrProGlyValPheGluThr 1110 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 AGGAAGAAAGAGGAATACAAAATGGCCGTGTACAATCTGTATCCTGGGGTCTTCGAGACC 3360 Qy 1111 ValGluMetLeuProSerLysValGlyIleTrpArgIleGluCysLeuIleGlyGluHis 1130 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 GTGGAAATGCTGCCAAGCAAAGTGGGAATCTGGAGAATCGAGTGCCTGATCGGCGAACAC 3420 Qy 1131 LeuGlnAlaGlyMetSerThrThrPheLeuValTyrSerLysLysCysGlnThrProLeu 1150 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 CTGCAGGCCGGGATGAGCACCACCTTCCTGGTGTACTCTAAGAAATGTCAGACCCCACTG 3480 Qy 1151 GlyMetAlaSerGlyHisIleArgAspPheGlnIleThrAlaSerGlyGlnTyrGlyGln 1170 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 GGGATGGCCTCCGGACATATCCGCGACTTCCAGATCACCGCTAGCGGACAGTACGGACAG 3540 Qy 1171 TrpAlaProLysLeuAlaArgLeuHisTyrSerGlySerIleAsnAlaTrpSerThrLys 1190 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 TGGGCTCCAAAGCTGGCTAGACTGCACTATTCTGGCTCCATCAACGCCTGGTCTACCAAA 3600 Qy 1191 GluProPheSerTrpIleLysValAspLeuLeuAlaProMetIleIleHisGlyIleLys 1210 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 GAGCCATTCTCCTGGATCAAGGTGGACCTGCTGGCCCCCATGATCATCCACGGAATCAAA 3660 Qy 1211 ThrGlnGlyAlaArgGlnLysPheSerSerLeuTyrIleSerGlnPheIleIleMetTyr 1230 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 ACCCAGGGCGCTAGGCAGAAGTTCAGCTCTCTGTACATCTCCCAGTTTATCATCATGTAT 3720 Qy 1231 SerLeuAspGlyLysLysTrpGlnThrTyrArgGlyAsnSerThrGlyThrLeuMetVal 1250 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 AGCCTGGACGGGAAGAAATGGCAGACCTACAGAGGCAATTCCACCGGGACCCTGATGGTC 3780 Qy 1251 PhePheGlyAsnValAspSerSerGlyIleLysHisAsnIlePheAsnProProIleIle 1270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3781 TTCTTTGGAAACGTGGATTCCAGCGGCATCAAGCACAACATCTTCAATCCACCCATCATC 3840 Qy 1271 AlaArgTyrIleArgLeuHisProThrHisTyrSerIleArgSerThrLeuArgMetGlu 1290 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3841 GCCCGCTACATCCGGCTGCATCCTACCCACTATAGCATCAGGTCTACCCTGAGAATGGAG 3900 Qy 1291 LeuMetGlyCysAspLeuAsnSerCysSerMetProLeuGlyMetGluSerLysAlaIle 1310 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3901 CTGATGGGATGCGACCTGAACAGCTGTTCTATGCCACTGGGCATGGAGTCCAAGGCTATC 3960 Qy 1311 SerAspAlaGlnIleThrAlaSerSerTyrPheThrAsnMetPheAlaThrTrpSerPro 1330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3961 AGCGATGCCCAGATCACCGCTTCTTCCTACTTCACCAATATGTTTGCTACCTGGTCCCCA 4020 Qy 1331 SerLysAlaArgLeuHisLeuGlnGlyArgSerAsnAlaTrpArgProGlnValAsnAsn 1350 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4021 AGCAAGGCTAGACTGCACCTGCAGGGAAGATCCAACGCTTGGAGACCCCAGGTGAACAAT 4080 Qy 1351 ProLysGluTrpLeuGlnValAspPheGlnLysThrMetLysValThrGlyValThrThr 1370 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 CCTAAGGAGTGGCTGCAGGTCGACTTCCAGAAAACCATGAAGGTCACCGGGGTGACCACC 4140 Qy 1371 GlnGlyValLysSerLeuLeuThrSerMetTyrValLysGluPheLeuIleSerSerSer 1390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4141 CAGGGAGTGAAATCTCTGCTGACCTCCATGTACGTCAAGGAGTTCCTGATCAGCTCTTCC 4200 Qy 1391 GlnAspGlyHisGlnTrpThrLeuPhePheGlnAsnGlyLysValLysValPheGlnGly 1410 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4201 CAGGACGGCCACCAGTGGACCCTGTTCTTTCAGAACGGCAAGGTCAAAGTGTTCCAGGGG 4260 Qy 1411 AsnGlnAspSerPheThrProValValAsnSerLeuAspProProLeuLeuThrArgTyr 1430 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4261 AATCAGGACTCTTTTACCCCCGTCGTGAACTCCCTGGATCCTCCACTGCTGACCAGGTAC 4320 Qy 1431 LeuArgIleHisProGlnSerTrpValHisGlnIleAlaLeuArgMetGluValLeuGly 1450 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4321 CTGAGAATCCATCCTCAGAGCTGGGTGCACCAGATCGCTCTGAGAATGGAGGTCCTGGGA 4380 Qy 1451 CysGluAlaGlnAspLeuTyr 1457 ||||||||||||||||||||| Db 4381 TGCGAAGCTCAGGACCTGTAT 4401 Claim(s) 1 and 3-5 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C 102(a)(2) as being anticipated by Doering et al. (U.S. Patent No. 10,898,588 B2). Doering et al. (U.S. Patent 10,898,588 B2) disclose an isolated polynucleotide, e.g. at least 90% identical to SEQ ID NO: 12 (claim 1); SEQ ID NO: 12 comprises a sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A method of treating a factor VIII deficiency (hemophilia A) comprising administering to a subject in need thereof a composition comprising a therapeutically effective amount of a vector, wherein said polynucleotide sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A composition comprising the vector and a pharmaceutically acceptable carrier. The composition, wherein the composition treats a factor VIII deficiency (see alignment below of SEQ ID NO: 20 of the pending application (identified as Qy) and SEQ ID NO: 12 of the issued patent (identified as Db) and claims 1-18 of issued patent). Claim 1 of the pending application claims a polypeptide comprising a nucleotide sequence. Alignment Scores: Length: 4404 Score: 7773.00 Matches: 1455 Percent Similarity: 99.3% Conservative: 2 Best Local Similarity: 99.2% Mismatches: 0 Query Match: 99.7% Indels: 10 Gaps: 1 US-17/632,222 (SEQ ID NO: 20) (1-1457) x US-16/058,808 (SEQ ID NO:12) (1-4404) Qy 1 MetGlnLeuGluLeuSerThrCysValPheLeuCysLeuLeuProLeuGlyPheSerAla 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGCAGCTGGAACTGTCTACCTGTGTGTTTCTGTGTCTGCTGCCTCTGGGGTTTTCTGCT 60 Qy 21 IleArgArgTyrTyrLeuGlyAlaValGluLeuSerTrpAspTyrArgGlnSerGluLeu 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ATCCGCCGCTACTATCTGGGAGCCGTGGAGCTGTCCTGGGACTACAGGCAGAGCGAGCTG 120 Qy 41 LeuArgGluLeuHisValAspThrArgPheProAlaThrAlaProGlyAlaLeuProLeu 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTGAGAGAACTGCACGTGGATACCAGATTCCCAGCTACCGCTCCAGGAGCTCTGCCTCTG 180 Qy 61 GlyProSerValLeuTyrLysLysThrValPheValGluPheThrAspGlnLeuPheSer 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GGCCCATCCGTGCTGTACAAGAAAACCGTCTTCGTGGAGTTTACCGACCAGCTGTTCAGC 240 Qy 81 ValAlaArgProArgProProTrpMetGlyLeuLeuGlyProThrIleGlnAlaGluVal 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GTGGCCAGGCCAAGACCACCTTGGATGGGACTGCTGGGACCAACCATCCAGGCTGAGGTG 300 Qy 101 TyrAspThrValValValThrLeuLysAsnMetAlaSerHisProValSerLeuHisAla 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 TACGATACCGTGGTCGTGACCCTGAAAAACATGGCCTCCCATCCCGTGAGCCTGCACGCT 360 Qy 121 ValGlyValSerPheTrpLysSerSerGluGlyAlaGluTyrGluAspHisThrSerGln 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GTCGGGGTGTCCTTCTGGAAGTCCAGCGAGGGAGCCGAGTACGAAGACCATACCTCCCAG 420 Qy 141 ArgGluLysGluAspAspLysValLeuProGlyLysSerGlnThrTyrValTrpGlnVal 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CGCGAGAAAGAAGACGATAAGGTGCTGCCTGGCAAAAGCCAGACCTATGTCTGGCAGGTG 480 Qy 161 LeuLysGluAsnGlyProThrAlaSerAspProProCysLeuThrTyrSerTyrLeuSer 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CTGAAGGAGAACGGACCAACCGCTAGCGACCCACCATGCCTGACCTACTCTTATCTGTCC 540 Qy 181 HisValAspLeuValLysAspLeuAsnSerGlyLeuIleGlyAlaLeuLeuValCysArg 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CACGTCGATCTGGTGAAGGACCTGAATTCCGGACTGATCGGAGCTCTGCTGGTGTGTAGA 600 Qy 201 GluGlySerLeuThrArgGluArgThrGlnAsnLeuHisGluPheValLeuLeuPheAla 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GAGGGAAGCCTGACCAGAGAAAGAACCCAGAACCTGCATGAGTTCGTCCTGCTGTTCGCC 660 Qy 221 ValPheAspGluGlyLysSerTrpHisSerAlaArgAsnAspSerTrpThrArgAlaMet 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GTGTTTGACGAAGGGAAGAGCTGGCACTCTGCCCGCAATGACTCCTGGACCAGAGCTATG 720 Qy 241 AspProAlaProAlaArgAlaGlnProAlaMetHisThrValAsnGlyTyrValAsnArg 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 GATCCAGCTCCTGCTAGAGCTCAGCCTGCTATGCACACCGTCAACGGCTACGTGAATCGG 780 Qy 261 SerLeuProGlyLeuIleGlyCysHisLysLysSerValTyrTrpHisValIleGlyMet 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TCTCTGCCAGGACTGATCGGCTGCCATAAGAAAAGCGTCTATTGGCACGTGATCGGAATG 840 Qy 281 GlyThrSerProGluValHisSerIlePheLeuGluGlyHisThrPheLeuValArgHis 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GGCACCAGCCCCGAGGTGCATTCTATCTTCCTGGAAGGCCACACCTTTCTGGTCAGGCAC 900 Qy 301 HisArgGlnAlaSerLeuGluIleSerProLeuThrPheLeuThrAlaGlnThrPheLeu 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CATAGACAGGCCTCTCTGGAGATCTCCCCTCTGACCTTCCTGACCGCTCAGACCTTTCTG 960 Qy 321 MetAspLeuGlyGlnPheLeuLeuPheCysHisIleSerSerHisHisHisGlyGlyMet 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATGGACCTGGGGCAGTTCCTGCTGTTTTGCCATATCTCTTCCCACCATCACGGAGGAATG 1020 Qy 341 GluAlaHisValArgValGluSerCysAlaGluGluProGlnLeuArgArgLysAlaAsp 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GAGGCTCACGTCAGGGTGGAATCCTGTGCTGAGGAACCACAGCTGAGAAGAAAGGCTGAT 1080 Qy 361 GluGluGluAspTyrAspAspAsnLeuTyrAspSerAspMetAspValValArgLeuAsp 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GAGGAAGAGGACTACGACGATAACCTGTATGACAGCGATATGGACGTCGTGCGCCTGGAC 1140 Qy 381 GlyAspAspValSerProPheIleGlnIleArgSerValAlaLysLysHisProLysThr 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GGCGACGATGTCAGCCCTTTCATCCAGATCCGGTCTGTGGCCAAGAAACATCCAAAGACC 1200 Qy 401 TrpValHisTyrIleAlaAlaGluGluGluAspTrpAspTyrAlaProLeuValLeuAla 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TGGGTCCACTACATCGCCGCTGAAGAGGAAGATTGGGACTATGCCCCCCTGGTGCTGGCT 1260 Qy 421 ProAspAspArgSerTyrLysSerGlnTyrLeuAsnAsnGlyProGlnArgIleGlyArg 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CCTGACGATAGATCCTACAAAAGCCAGTATCTGAACAATGGGCCCCAGCGCATCGGACGG 1320 Qy 441 LysTyrLysLysValArgPheMetAlaTyrThrAspGluThrPheLysThrArgGluAla 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 AAGTACAAGAAAGTGAGGTTCATGGCCTATACCGACGAGACCTTTAAGACCAGAGAGGCT 1380 Qy 461 IleGlnHisGluSerGlyIleLeuGlyProLeuLeuTyrGlyGluValGlyAspThrLeu 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 ATCCAGCACGAATCCGGGATCCTGGGACCTCTGCTGTACGGCGAAGTGGGGGATACCCTG 1440 Qy 481 LeuIleIlePheLysAsnGlnAlaSerArgProTyrAsnIleTyrProHisGlyIleThr 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CTGATCATCTTCAAGAACCAGGCCTCCAGGCCATACAATATCTATCCCCATGGCATCACC 1500 Qy 501 AspValArgProLeuTyrSerArgArgLeuProLysGlyValLysHisLeuLysAspPhe 520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 GACGTGAGACCACTGTACAGCAGGAGACTGCCCAAGGGGGTCAAACACCTGAAGGATTTC 1560 Qy 521 ProIleLeuProGlyGluIlePheLysTyrLysTrpThrValThrValGluAspGlyPro 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 CCCATCCTGCCTGGAGAGATCTTTAAGTATAAATGGACCGTCACCGTGGAAGACGGGCCT 1620 Qy 541 ThrLysSerAspProArgCysLeuThrArgTyrTyrSerSerPheValAsnMetGluArg 560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 ACCAAGTCCGATCCACGCTGCCTGACCCGGTACTATAGCTCTTTCGTGAACATGGAGAGA 1680 Qy 561 AspLeuAlaSerGlyLeuIleGlyProLeuLeuIleCysTyrLysGluSerValAspGln 580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 GACCTGGCTAGCGGACTGATCGGACCCCTGCTGATCTGTTACAAAGAGAGCGTGGACCAG 1740 Qy 581 ArgGlyAsnGlnIleMetSerAspLysArgAsnValIleLeuPheSerValPheAspGlu 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 AGGGGCAACCAGATCATGTCTGATAAGAGAAATGTCATCCTGTTCTCCGTGTTTGACGAG 1800 Qy 601 AsnArgSerTrpTyrLeuThrGluAsnIleGlnArgPheLeuProAsnProAlaGlyVal 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 AACCGCAGCTGGTACCTGACCGAGAACATCCAGCGGTTCCTGCCAAATCCAGCTGGAGTG 1860 Qy 621 GlnLeuGluAspProGluPheGlnAlaSerAsnIleMetHisSerIleAsnGlyTyrVal 640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 CAGCTGGAGGACCCAGAATTTCAGGCTTCCAACATCATGCATAGCATCAATGGCTACGTG 1920 Qy 641 PheAspSerLeuGlnLeuSerValCysLeuHisGluValAlaTyrTrpTyrIleLeuSer 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TTCGATAGCCTGCAGCTGTCTGTCTGCCTGCACGAGGTGGCCTACTGGTATATCCTGTCC 1980 Qy 661 IleGlyAlaGlnThrAspPheLeuSerValPhePheSerGlyTyrThrPheLysHisLys 680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 ATCGGCGCTCAGACCGACTTCCTGTCCGTGTTCTTTAGCGGGTACACCTTTAAGCATAAA 2040 Qy 681 MetValTyrGluAspThrLeuThrLeuPheProPheSerGlyGluThrValPheMetSer 700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 ATGGTGTATGAGGATACCCTGACCCTGTTCCCCTTTTCTGGCGAGACCGTGTTCATGTCC 2100 Qy 701 MetGluAsnProGlyLeuTrpIleLeuGlyCysHisAsnSerAspPheArgAsnArgGly 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 ATGGAAAACCCTGGCCTGTGGATCCTGGGGTGCCACAACAGCGACTTCAGGAATAGAGGA 2160 Qy 721 MetThrAlaLeuLeuLysValSerSerCysAspLysAsnThrGlyAspTyrTyrGluAsp 740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 ATGACCGCCCTGCTGAAAGTGTCCAGCTGTGATAAGAATACCGGCGATTACTATGAGGAC 2220 Qy 741 SerTyrGluAspIleSerAlaTyrLeuLeuSerLysAsnAsnAlaIleGluProArgSer 760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 TCTTACGAAGATATCTCCGCTTATCTGCTGAGCAAGAACAATGCCATCGAGCCCAGGTCT 2280 Qy 761 PheSerGlnAsn------------------------------ProProValLeuLysArg 770 |||:::|||||| ||||||||||||:::||| Db 2281 TTCGCTCAGAACTCCAGACCTCCAAGCGCTTCTGCTCCTAAGCCACCTGTGCTGAGAAGA 2340 Qy 771 HisGlnArgAspIleSerLeuProThrPheGlnProGluGluAspLysMetAspTyrAsp 790 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 CATCAGAGGGACATCTCCCTGCCTACCTTCCAGCCAGAGGAAGATAAAATGGACTACGAC 2400 Qy 791 AspIlePheSerThrGluThrLysGlyGluAspPheAspIleTyrGlyGluAspGluAsn 810 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 GATATCTTCAGCACCGAGACCAAGGGGGAAGATTTTGACATCTATGGAGAGGACGAAAAC 2460 Qy 811 GlnAspProArgSerPheGlnLysArgThrArgHisTyrPheIleAlaAlaValGluGln 830 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 CAGGATCCAAGATCCTTCCAGAAGAGAACCAGACACTACTTTATCGCCGCTGTGGAGCAG 2520 Qy 831 LeuTrpAspTyrGlyMetSerGluSerProArgAlaLeuArgAsnArgAlaGlnAsnGly 850 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 CTGTGGGACTATGGGATGTCCGAAAGCCCACGGGCCCTGAGGAACAGAGCTCAGAATGGA 2580 Qy 851 GluValProArgPheLysLysValValPheArgGluPheAlaAspGlySerPheThrGln 870 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 GAGGTGCCCCGCTTCAAGAAAGTCGTGTTCCGGGAGTTTGCCGACGGCAGCTTTACCCAG 2640 Qy 871 ProSerTyrArgGlyGluLeuAsnLysHisLeuGlyLeuLeuGlyProTyrIleArgAla 890 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 CCATCTTACAGGGGGGAGCTGAACAAGCATCTGGGGCTGCTGGGACCCTATATCAGAGCC 2700 Qy 891 GluValGluAspAsnIleMetValThrPheLysAsnGlnAlaSerArgProTyrSerPhe 910 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 GAGGTCGAAGATAACATCATGGTGACCTTCAAGAATCAGGCTTCTCGCCCCTACTCCTTT 2760 Qy 911 TyrSerSerLeuIleSerTyrProAspAspGlnGluGlnGlyAlaGluProArgHisAsn 930 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 TATTCTTCCCTGATCTCCTACCCTGACGATCAGGAGCAGGGCGCCGAACCTAGGCACAAC 2820 Qy 931 PheValGlnProAsnGluThrArgThrTyrPheTrpLysValGlnHisHisMetAlaPro 950 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 TTCGTGCAGCCAAATGAGACCAGAACCTACTTTTGGAAGGTGCAGCATCACATGGCTCCC 2880 Qy 951 ThrGluAspGluPheAspCysLysAlaTrpAlaTyrPheSerAspValAspLeuGluLys 970 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 ACCGAGGATGAATTCGACTGCAAAGCTTGGGCCTATTTTTCCGATGTCGACCTGGAGAAG 2940 Qy 971 AspValHisSerGlyLeuIleGlyProLeuLeuIleCysArgAlaAsnThrLeuAsnAla 990 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 GACGTGCATAGCGGCCTGATCGGGCCTCTGCTGATCTGTCGCGCCAACACCCTGAATGCT 3000 Qy 991 AlaHisGlyArgGlnValThrValGlnGluPheAlaLeuPhePheThrIlePheAspGlu 1010 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 GCTCACGGAAGACAGGTCACCGTGCAGGAGTTCGCTCTGTTCTTTACCATCTTTGACGAA 3060 Qy 1011 ThrLysSerTrpTyrPheThrGluAsnValGluArgAsnCysArgAlaProCysHisLeu 1030 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 ACCAAGAGCTGGTACTTCACCGAGAACGTGGAAAGGAATTGCAGAGCCCCCTGTCATCTG 3120 Qy 1031 GlnMetGluAspProThrLeuLysGluAsnTyrArgPheHisAlaIleAsnGlyTyrVal 1050 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 CAGATGGAGGACCCTACCCTGAAGGAAAACTACAGGTTCCACGCCATCAATGGATATGTC 3180 Qy 1051 MetAspThrLeuProGlyLeuValMetAlaGlnAsnGlnArgIleArgTrpTyrLeuLeu 1070 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 ATGGATACCCTGCCCGGCCTGGTCATGGCTCAGAACCAGCGCATCCGGTGGTACCTGCTG 3240 Qy 1071 SerMetGlySerAsnGluAsnIleHisSerIleHisPheSerGlyHisValPheSerVal 1090 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 TCTATGGGATCCAACGAGAATATCCATAGCATCCACTTCTCTGGCCATGTCTTTTCCGTG 3300 Qy 1091 ArgLysLysGluGluTyrLysMetAlaValTyrAsnLeuTyrProGlyValPheGluThr 1110 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 AGGAAGAAAGAGGAATACAAAATGGCCGTGTACAATCTGTATCCTGGGGTCTTCGAGACC 3360 Qy 1111 ValGluMetLeuProSerLysValGlyIleTrpArgIleGluCysLeuIleGlyGluHis 1130 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 GTGGAAATGCTGCCAAGCAAAGTGGGAATCTGGAGAATCGAGTGCCTGATCGGCGAACAC 3420 Qy 1131 LeuGlnAlaGlyMetSerThrThrPheLeuValTyrSerLysLysCysGlnThrProLeu 1150 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 CTGCAGGCCGGGATGAGCACCACCTTCCTGGTGTACTCTAAGAAATGTCAGACCCCACTG 3480 Qy 1151 GlyMetAlaSerGlyHisIleArgAspPheGlnIleThrAlaSerGlyGlnTyrGlyGln 1170 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 GGGATGGCCTCCGGACATATCCGCGACTTCCAGATCACCGCTAGCGGACAGTACGGACAG 3540 Qy 1171 TrpAlaProLysLeuAlaArgLeuHisTyrSerGlySerIleAsnAlaTrpSerThrLys 1190 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 TGGGCTCCAAAGCTGGCTAGACTGCACTATTCTGGCTCCATCAACGCCTGGTCTACCAAA 3600 Qy 1191 GluProPheSerTrpIleLysValAspLeuLeuAlaProMetIleIleHisGlyIleLys 1210 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 GAGCCATTCTCCTGGATCAAGGTGGACCTGCTGGCCCCCATGATCATCCACGGAATCAAA 3660 Qy 1211 ThrGlnGlyAlaArgGlnLysPheSerSerLeuTyrIleSerGlnPheIleIleMetTyr 1230 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 ACCCAGGGCGCTAGGCAGAAGTTCAGCTCTCTGTACATCTCCCAGTTTATCATCATGTAT 3720 Qy 1231 SerLeuAspGlyLysLysTrpGlnThrTyrArgGlyAsnSerThrGlyThrLeuMetVal 1250 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 AGCCTGGACGGGAAGAAATGGCAGACCTACAGAGGCAATTCCACCGGGACCCTGATGGTC 3780 Qy 1251 PhePheGlyAsnValAspSerSerGlyIleLysHisAsnIlePheAsnProProIleIle 1270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3781 TTCTTTGGAAACGTGGATTCCAGCGGCATCAAGCACAACATCTTCAATCCACCCATCATC 3840 Qy 1271 AlaArgTyrIleArgLeuHisProThrHisTyrSerIleArgSerThrLeuArgMetGlu 1290 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3841 GCCCGCTACATCCGGCTGCATCCTACCCACTATAGCATCAGGTCTACCCTGAGAATGGAG 3900 Qy 1291 LeuMetGlyCysAspLeuAsnSerCysSerMetProLeuGlyMetGluSerLysAlaIle 1310 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3901 CTGATGGGATGCGACCTGAACAGCTGTTCTATGCCACTGGGCATGGAGTCCAAGGCTATC 3960 Qy 1311 SerAspAlaGlnIleThrAlaSerSerTyrPheThrAsnMetPheAlaThrTrpSerPro 1330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3961 AGCGATGCCCAGATCACCGCTTCTTCCTACTTCACCAATATGTTTGCTACCTGGTCCCCA 4020 Qy 1331 SerLysAlaArgLeuHisLeuGlnGlyArgSerAsnAlaTrpArgProGlnValAsnAsn 1350 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4021 AGCAAGGCTAGACTGCACCTGCAGGGAAGATCCAACGCTTGGAGACCCCAGGTGAACAAT 4080 Qy 1351 ProLysGluTrpLeuGlnValAspPheGlnLysThrMetLysValThrGlyValThrThr 1370 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 CCTAAGGAGTGGCTGCAGGTCGACTTCCAGAAAACCATGAAGGTCACCGGGGTGACCACC 4140 Qy 1371 GlnGlyValLysSerLeuLeuThrSerMetTyrValLysGluPheLeuIleSerSerSer 1390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4141 CAGGGAGTGAAATCTCTGCTGACCTCCATGTACGTCAAGGAGTTCCTGATCAGCTCTTCC 4200 Qy 1391 GlnAspGlyHisGlnTrpThrLeuPhePheGlnAsnGlyLysValLysValPheGlnGly 1410 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4201 CAGGACGGCCACCAGTGGACCCTGTTCTTTCAGAACGGCAAGGTCAAAGTGTTCCAGGGG 4260 Qy 1411 AsnGlnAspSerPheThrProValValAsnSerLeuAspProProLeuLeuThrArgTyr 1430 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4261 AATCAGGACTCTTTTACCCCCGTCGTGAACTCCCTGGATCCTCCACTGCTGACCAGGTAC 4320 Qy 1431 LeuArgIleHisProGlnSerTrpValHisGlnIleAlaLeuArgMetGluValLeuGly 1450 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4321 CTGAGAATCCATCCTCAGAGCTGGGTGCACCAGATCGCTCTGAGAATGGAGGTCCTGGGA 4380 Qy 1451 CysGluAlaGlnAspLeuTyr 1457 ||||||||||||||||||||| Db 4381 TGCGAAGCTCAGGACCTGTAT 4401 Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claim(s) 1-8 are rejected under 35 U.S.C. 103 as being unpatentable over Doering et al. (U.S. Patent No. 10,058,624 B2) in view of Lollar (WO 2003/031598 A2). Doering et al. (U.S. Patent 10,058,624 B2) disclose an isolated polynucleotide, e.g. at least 90% identical to SEQ ID NO: 12 (see claim 25); SEQ ID NO: 12 comprises a sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A method of treating a factor VIII deficiency (hemophilia A) comprising administering to a subject in need thereof a composition comprising a therapeutically effective amount of a vector, wherein said polynucleotide sequence having at least 99.3% sequence identity to SEQ ID NO: 20. A composition comprising the vector and a pharmaceutically acceptable carrier. The composition, wherein the composition treats a factor VIII deficiency (see alignment below of SEQ ID NO: 20 of the pending application (identified as Qy) and SEQ ID NO: 12 of the issued patent (identified as Db) (claims 1 and 20-27)). Claim 1 of the pending application claims a polypeptide comprising a nucleotide sequence. Alignment Scores: Length: 4404 Score: 7773.00 Matches: 1455 Percent Similarity: 99.3% Conservative: 2 Best Local Similarity: 99.2% Mismatches: 0 Query Match: 99.7% Indels: 10 Gaps: 1 US-17/632,222 (SEQ ID NO: 20) (1-1457) x US-15/128,912 (SEQ ID NO:12) (1-4404) Doering et al. does not disclose the polypeptides of SEQ ID NO; 15-21 as currently claimed. However, Lollar (WO 2003/031598 A2) disclose an isolated polypeptide comprising an amino acid sequence having at least 99.7% sequence identity to SEQ ID NO: 19. A method of increasing the level of expression of a factor VIII polypeptide in a cell comprising: a) introducing into said cell a nucleic acid molecule comprising a nucleotide sequence having at least 99.7% sequence identity to SEQ ID NO: 18, wherein said sequence encodes said factor VIII polypeptide and said factor VIII polypeptide is characterized by high expression; and b) culturing said cell under conditions that allow expression of said nucleic acid molecule. The method, wherein said nucleic acid molecule comprises a nucleotid a nucleotide sequence comprising the sequence set forth in SEQ ID NO: 18. The method, further comprising isolating said polypeptide. The method, further comprising isolating said polypeptide. A method of treating a factor VIII deficiency comprising administering to a subject in need thereof a composition comprising a therapeutically effective amount of a polypeptide, wherein said polypeptide comprises an amino acid sequence having at least 99.7% sequence identity to SEQ ID NO: 19 and said polypeptide is characterized by high-level expression. An isolated polypeptide comprising an amino acid sequence having at least 99.7% sequence identity to SEQ ID NO: 19, wherein said polypeptide is characterized by high-level expression as compared to a corresponding human factor VIII polypeptide expressed under the same conditions. A composition comprising a polypeptide and a pharmaceutically acceptable carrier. The composition, wherein the composition treats a factor VIII deficiency (see alignment in SCORE file 20260626_152525_us-17-632-222-19.rnpm, result #1, and claims 1-26 of WO 2003/031598). Furthermore, the variability of amino acids in particular positions in SEQ ID NO: 19 of the currently claimed factor VIII polypeptide sequences in the instant application are disclosed in corresponding WO published WO patent document SEQ ID NO: sequences that have factor VIII activity, so that it would have been obvious to the person having ordinary skill in the art to arrive at SEQ ID NOs of the pending application that would result in 100% identity with factor VIII polypeptides with similar functional activity, therefore claims 2, and 6-8 are also rejected. It would have been obvious to the person having ordinary skill in the art to use the modified factor VIII polypeptide as claimed as SEQ ID NO: 15-21, because the modifications were known in the art as disclosed by Lollar with particular amino acids disclosed at particular residues in an active factor VIII polypeptide used for blood clotting. Conclusion No claims are allowed. Art not relied upon US Patent 6,818439 (SEQ ID NO: 47) and 9,050,318 (SEQ ID NO: 2) disclosing polypeptides with 99.9% identity with the polynucleotide of SEQ ID NO: 12 encoding modified factor VIII polypeptides. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANAND U DESAI whose telephone number is (571)272-0947. The examiner can normally be reached 9:00-5:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anand Desai can be reached at 571-272-0947. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANAND U DESAI/Supervisory Patent Examiner, Art Unit 1655
Read full office action

Prosecution Timeline

Feb 01, 2022
Application Filed
Jul 28, 2025
Non-Final Rejection mailed — §102, §103, §112
Dec 29, 2025
Response Filed
Aug 20, 2026
Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12741057
Method for Preparing a Three-Dimensional Scaffold for Medical Use
3y 11m to grant Granted Sep 22, 2026
Patent 12740936
METHOD FOR IMPROVING SKIN COMPLEXION BY USING ROSA CANINA EXTRACT
2y 10m to grant Granted Sep 22, 2026
Patent 12734220
COMPOSITION COMPRISING ALBUMIN FOR USE IN THE TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS (ALS) BY PLASMA EXCHANGE
3y 10m to grant Granted Sep 15, 2026
Patent 12730111
SYSTEMS, METHODS, AND COMPOSITIONS TO IDENTIFY NEW PROTEIN TARGETS OF A CHEMICAL COMPOUND OR ITS DERIVATIVES
3y 8m to grant Granted Sep 08, 2026
Patent 12709744
Xylanase Variants and Polynucleotides Encoding Same
3y 9m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
78%
Grant Probability
91%
With Interview (+12.7%)
3y 1m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 915 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month