DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment
The Amendment filed 10/14/2025 in which claims 1, 3, 5, 7-8, 10, 15, were amended, new claims 71, 72 were added, and claims 17 and 19 were canceled, has been entered. Claims 26, 43, 49, 57, 63 were previously withdrawn.
Claims 1-3, 5, 7-8, 10-12, 15, 21-22, 35, 71 and 72 are under examination on the merits.
Information Disclosure Statement
The information disclosure statement (IDS) was submitted on 10/14/2025. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
(Previous objection, withdrawn) Applicant’s amendments to the Drawings submitted on 10/14/2025 have overcome the objection previously set forth in the Non-Final Office Action mailed 07/11/2025.
Specification
(Previous objection, withdrawn) Applicant’s amendments to the Specification submitted on 10/14/2025 have overcome the objection previously set forth in the Non-Final Office Action mailed 07/11/2025.
Claim Objections
(Previous objections, withdrawn as to claims 8, 10). Applicant’s amendments to claims 8 and 10 have overcome previous objections to claims 7 and 8.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
(previous rejection, withdrawn as to claims 1-3, 5, 7-8, 10-12, 15, 21-22, 35) Claims 1-3, 5, 7-8, 10-12, 15, 21-22, 35 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
See claims 1-3, 5, 7-8, 10-12, 15, 21-22, 35 as submitted on 10/14/2025.
Applicant’s amendments to claims 1, 10 have overcome previous rejection to claims 1-3, 5, 7-8, 10-12, 15, 21-22, 35.
(New rejection, as to claims 71 and 72) Claims 71 and 72 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
See claims 71 and 72 as submitted on 10/14/2025.
Claim 71 recites “The detection system of claim 5, wherein the detection system comprises a guide RNA comprising the nucleic acid sequence of GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACTTGCTACTGCATTGACTGCTT CACACAG (SEQ ID NO: 17).” This recitation is unclear because claim 5, which claim 71 depends on, recites a guide RNA comprising SEQ ID NO: 20 and not SEQ ID NO: 17. As noted previously, the sequence of SEQ ID NO: 20 (28 nucleotides) is contained within the sequence of SEQ ID NO: 17 (64 nucleotides). It is unclear if claim 71 requires an additional guide RNA comprising instant SEQ ID: 17 or if the guide RNA comprising SEQ ID: 17 in claim 71 is meant to replace the guide RNA comprising SEQ ID NO: 20 in claim 5. It is also noted that Applicant elected SEQ ID NO: 20 as a guide RNA in the response to the Restriction/Election requirement filed on 06/17/2025. For purposes of compact prosecution and applying prior art, claim 71 was interpreted herein as referring to a guide RNA comprising SEQ ID NO: 20 or SEQ ID NO: 17.
Claim 72 recites “The detection system of claim 15, wherein the detection system comprises a forward primer comprising the nucleic acid sequence of GAAATTAATACGACTCACTATAGGCATTGCAGAGTTTCTTCAGTTAGGTCTAAGCC (SEQ ID NO: 1).” This recitation is unclear because claim 15, which claim 72 depends on, recites a forward primer comprising SEQ ID NO: 25 and not SEQ ID NO: 1. It is noted that the sequence of SEQ ID NO: 25 (32 nucleotides) is contained within the sequence of SEQ ID NO: 1 (56 nucleotides). It is unclear if claim 72 requires an additional forward primer comprising instant SEQ ID: 1 or if the forward primer comprising SEQ ID: 25 in claim 72 is meant to replace the forward primer comprising SEQ ID NO: 25 in claim 15. It is also noted that Applicant elected SEQ ID NO: 25 as a forward primer in the response to the Restriction/Election requirement filed on 06/17/2025. For purposes of compact prosecution and applying prior art, claim 72 was interpreted herein as referring to a forward primer comprising SEQ ID NO: 25 or SEQ ID NO: 1.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22, 35) Claims 1-3, 8, 10-12, 21-22, 35 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by US 2019/0144929 A1 to Abudayyeh et al.
See claims 1-3, 8, 10-12, 21-22, 35 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22, 35.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
(previous rejection, expanded as necessitated by amendment as to claims 1-3, 8, 10-12, 21-22, 35, 71 and 72; maintained as to claims 5, 7, and 15) Claims 1-3, 5, 7, 8, 10-12, 15, 21-22, 35, 71, 72 are rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh in view of Vats (prior art of record).
See claims 1-3, 5, 7, 8, 10-12, 15, 21-22, 35, 71, 72 as submitted on 10/14/2025.
Regarding claim 1, it is noted that the amendment to claim 1 filed on 10/14/2025 introduced the new limitation of “ wherein the guide RNA comprises a spacer region having at least 90% identity to the sequence of SEQ ID NO: 20”. However, as explained in detail in the Non-Final Action mailed on 07/11/2025, this limitation is already taught by Vats. Collectively, the cited prior art teach the limitations of claim 1 as follows:
Abudayyeh teaches a nucleic acid detection system (¶ [0005]) comprising a CRISPR component comprising the following elements:
(i) an effector protein (¶ [0005]); and
(ii) a guide RNA, and/or a polynucleotide encoding a guide RNA, that binds or hybridizes to a corresponding target molecule (¶ [0051]); wherein the target molecule is a polynucleotide that is indicative of an infection (¶¶ [0006], [0008], [0013]).
Abudayyeh further teaches a target molecule is a viral DNA (¶¶ [0006], [0008], [0013]), wherein the target molecule is a BK polyomavirus DNA (¶ [0361]).
Abudayyeh does not teach a BK polyomavirus sequence comprising the nucleic acid sequence of SEQ ID NO: 20.
However, Vats teaches a method for detecting BK virus-associated nephropathy in renal transplants. Vats further teaches a nucleic acid sequence of SEQ ID NO: 3 which comprises a nucleic acid sequence which shares 100% sequence identity with instant SEQ ID NO: 20 and SEQ ID NO: 17. It is noted that the sequence of SEQ ID NO: 20 (28 nucleotides) is contained within the sequence of SEQ ID NO: 17 (64 nucleotides). Alignment shown below (Qy is instant SEQ ID NO: 20; Db is Vats’ SEQ ID NO: 3).
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have incorporated the nucleotide sequence of a BK polyomavirus as taught by Vats into the nucleic acid detection system of Abudayyeh for the benefit of detecting BK virus-associated nephropathy in renal transplant patients. See MPEP 2144.07. The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945)
PNG
media_image1.png
501
863
media_image1.png
Greyscale
One of ordinary skill in the art would have had reasonable expectation of success in incorporating the nucleotide sequence of a BK polyomavirus taught by Vats as a guided RNA into the CRISPR-based nucleic acid detection system of Abudayyeh given that the methods of CRISPR-based nucleic acid detection and guide RNA design are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
Regarding claim 2, it is noted that no amendments were introduced to claim 2 in the response filed on 10/14/2025. As explained previously, Abudayyeh further teaches wherein the effector protein is Cas13 (¶ [0021]).
Regarding claim 3, it is noted that amended claim 3 no longer recites multiple species of target molecules. Amended claim 3 solely recites “BK polyomavirus DNA”. As previously explained this limitation is already taught by Abudayyeh who specifically teaches wherein the target molecule is a viral DNA (¶¶ [0006], [0008], [0013]), wherein the target molecule is a BK polyomavirus DNA (¶ [0361]).
Regarding claim 5 and 71, Abudayyeh and Vats teach the detection system of claim 1. As indicated above and previously, Vats further teaches a nucleic acid sequence of SEQ ID NO: 3 which comprises a nucleic acid sequence which shares 100% sequence identity with instant SEQ ID NO: 20 and SEQ ID NO: 17. See alignment above. As explained previously, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have incorporated with reasonable expectation of success the nucleotide sequence of a BK polyomavirus as taught by Vats into the nucleic acid detection system of Abudayyeh in view of Vats for the benefit of detecting BK virus-associated nephropathy in renal transplant patients. See MPEP 2144.07. The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).
Regarding claim 7, Abudayyeh and Vats teach the detection system of claim 1. As indicated above and previously, the nucleic acid sequence of instant SEQ ID NO: 14 is complementary to the nucleic acid sequence of instant SEQ ID NO: 17. As shown above, Vats teaches a nucleic acid sequence which comprises SEQ ID NO: 17 for detection of BK virus-associated nephropathy in renal transplant patients. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have included a nucleic acid sequence of instant SEQ ID NO: 14 as a nucleic acid encoding a guide RNA to bind a complementary strand of a BK polyomavirus in a CRISPR-based nucleic acid detection system for the benefit of detecting BK virus-associated nephropathy in renal transplant patients. One of ordinary skill in the art would have had reasonable expectation of success given that the methods of guide RNA design comprising complementary DNA strands are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
PNG
media_image2.png
476
728
media_image2.png
Greyscale
Regarding claims 15 and 72, as previously explained the forward primer sequence of instant SEQ ID NO: 25 and the reverse primer sequence in instant SEQ ID NO: 2 are also taught by the BK polyomavirus sequence of Vats (SEQ ID NO: 3). Alignments shown below (Qy is instant SEQ ID NO: 25; Db is Vats’ SEQ ID NO: 3).
(Qy is instant SEQ ID NO: 2; Db is Vats’ SEQ ID NO: 3).
PNG
media_image3.png
170
791
media_image3.png
Greyscale
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have included a nucleic acid sequences of instant SEQ ID NO: 25 and SEQ ID NO: 2 as a forward and reverse primers for amplification into the nucleic acid detection system of Abudayyeh in view of Vats for the benefit of detecting BK virus-associated nephropathy in renal transplant patients. One of ordinary skill in the art would have had reasonable expectation of success given that the methods of primer design for CRISPR-based nucleic acid detection systems are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
Regarding claim 8, it is noted that the amendment to claim 8 was made to overcome the previous objection set forth in the Non-Final Office Action mailed on 07/11/2025. As previously explained, Abudayyeh and Vats teach the detection system of claim 1. Abudayyeh further teaches an amplification component, wherein the amplification component comprises a polymerase and one or more primers (¶¶ [0006], [0150]).
Regarding claim 10, it is noted that all of the amendments to claim 10 were made to overcome the previous rejections under 35 U.S.C. 112(b), second paragraph set forth in the Non-Final Office Action mailed on 07/11/2025. As previously explained, Abudayyeh and Vats teach the detection system of claim 1. Abudayyeh further teaches a T7 RNA polymerase (¶¶ [0164], [0150], [0480], [0267]).
Regarding claim 11, it is noted that no amendments were introduced to claim 11 in the response filed on 10/14/2025. Abudayyeh and Vats teach the detection system of claim 8. Abudayyeh further teaches wherein the detection system comprises a forward primer and a reverse primer, wherein the forward and reverse primer concentrations are between 100 nM and 400 nM (¶¶ [0252], [0150]). It is noted that the primer concentrations recited in claim 11 are those considered to be determined by routine optimization according to one of skill in the art in view of the teachings of Abudayyeh (¶ [0252]).
Regarding claim 12, it is noted that no amendments were introduced to claim 12 in the response filed on 10/14/2025. Abudayyeh and Vats teach the detection system of claim 8. Abudayyeh further teaches wherein the detection system comprises a forward primer and a reverse primer, wherein an RNA T7 polymerase promoter sequence is added to one of the primers (¶ [0249]).
Regarding claim 21, it is noted that no amendments were introduced to claim 21 in the response filed on 10/14/2025. Abudayyeh further teaches the detection system further comprising an RNAse inhibitor (¶ [0234]).
Regarding claim 22, it is noted that no amendments were introduced to claim 22 in the response filed on 10/14/2025. Abudayyeh further teaches the detection system further comprising an oligonucleotide comprising a detectable molecule such as a quenched fluorophore that exhibits fluorescence when the oligonucleotide is cleaved by the effector protein (¶ [0239]).
Regarding claim 35, it is noted that no amendments were introduced to claim 35 in the response filed on 10/14/2025. As previously explained, Abudayyeh further teaches a kit comprising the detection system of claim 1 and a polynucleic acid isolation component (¶¶ [0326], [0505], [0536], [0620]).
Accordingly, the claimed invention as a whole was prima facie obvious to one of ordinary skill in the art before the effective filing date, especially in the absence of evidence to the contrary.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22) Claims 1-3, 8, 10-12, 21-22 were rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 9 and 10 of US patent No. 10266887 B2.
See claims 1-3, 8, 10-12, 21-22 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22) Claims 1-3, 8, 10-12, 21-22 were rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4 of US patent No. 11174515 B2.
See claims 1-3, 8, 10-12, 21-22 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22) Claims 1-3, 8, 10-12, 21-22 were rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2 of US patent No. 10266886 B2.
See claims 1-3, 8, 10-12, 21-22 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22) Claims 1-3, 8, 10-12, 21-22 were rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 8, 10, 11 of US patent No. 12037639 B2.
See claims 1-3, 8, 10-12, 21-22 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22) Claims 1-3, 8, 10-12, 21-22 were provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 4, 12 of copending application No. 17241382.
See claims 1-3, 8, 10-12, 21-22 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22. It is further noted that claims 1, 2, 4, 12 of copending application No. 17241382 were canceled as of 12/05/2025.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22) Claims 1-3, 8, 10-12, 21-22 were provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 9, 12 of copending application No. 18772681.
See claims 1-3, 8, 10-12, 21-22 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22.
(previous rejection, withdrawn as to claims 1-3, 8, 10-12, 21-22) Claims 1-3, 8, 10-12, 21-22 were provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, and 3, of copending application No. 19007301.
See claims 1-3, 8, 10-12, 21-22 as submitted on 10/14/2025.
Applicant’s amendments to the instant claims have overcome previous rejection to claims 1-3, 8, 10-12, 21-22.
Response to Arguments
Applicant's arguments filed 10/14/2025 have been fully considered but they are not persuasive.
Applicant contends on page 14 of the Remarks submitted on 10/14/2025:
SEQ ID NO: 3 of Vats corresponds to the complete genome of BK polyomavirus (5,153 bp). Applicants assert that, in contrast to the Examiner's assertion, one having ordinary skill in the art would not include the complete genome of BK polyomavirus in a guide RNA (typically shorter than 100 bp in length). In addition, Applicants assert that, in contrast to the Examiner's assertion, one having ordinary skill in the art would not have been motivated to include the complete genome of BK polyomavirus in a system for detecting BK polyomavirus, as doing so would render the detection useless (BK polyomavirus would always be present). In addition, the cited prior art does not provide any motivation or a reasonable expectation of success to specifically select SEQ ID NO: 20 (or a sequence having at least 90% identity to the sequence of SEQ ID NO: 20, as recited in amended claim 1) to use as a spacer region for a guide RNA. For at least these reasons, the Examiner has not established a prima facie case of obviousness with respect to claim 3.
In response:
The instant rejection is in view of instant claim language. Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). It is noted that the instant claims recite “wherein the guide RNA comprises a spacer region having at least 90% identity to the sequence of SEQ ID NO: 20”. The recitation of “comprises” is herein interpreted in an open-ended fashion and does not exclude additional components (See MPEP 2111). Accordingly, under BRI, the claim language of “comprises a spacer region” is herein interpreted as a guide RNA comprising any amino acid sequence of any length that matches a portion of SEQ ID NO: 20 with at least 90% identity. As indicated above and previously, Vats teaches one such sequence which shares 100% sequence identity with instant SEQ ID NO: 20.
Further, it is noted that the Examiner did not at any point make the assertion that, one having ordinary skill in the art would include the complete genome of BK polyomavirus in a guide RNA, as Applicant alleges. It is well known in the art that guide RNAs in CRISPR-based detection systems comprise shot sequences of approximately 50 base pairs in length (see Abudayyeh). Further, it is reiterated that the methods of CRISPR-based nucleic acid detection and guide RNA design using known sequences are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art (see Abudayyeh). It is maintained that in view of the language of the instant claims, one of ordinary skill in the art would have been motivated and had a reasonable expectation of success in arriving at the instant claims in view of Abudayyeh and Vats.
Applicant contends on page 14 of the Remarks submitted on 10/14/2025:
SEQ ID NO: 14 in claim 7 is not a guide RNA. It is a sequence comprised in a
polynucleotide encoding a guide RNA. Only a fraction of SEQ ID NO: 14 is complementary to the genome of BK polyomavirus. In contrast to the Examiner's assertion, one having ordinary skill in the art would not have included a nucleic acid sequence of SEQ ID NO: 14 as a guide RNA.
In response:
As indicated above, the instant rejection is in view of instant claim language. It is noted that the instant claims recite “a polynucleotide encoding a guide RNA and comprising the nucleic acid of SEQ ID NO: 14”. The recitation of “comprising” is herein interpreted in an open-ended fashion and does not exclude additional components (See MPEP 2111). As indicated previously, the nucleic acid sequence of instant SEQ ID NO: 14 is complementary to the nucleic acid sequence of instant SEQ ID NO: 17. As shown above, Vats teaches a nucleic acid sequence which comprises SEQ ID NO: 17 for detection of BK virus-associated nephropathy in renal transplant patients. It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to have included a nucleic acid sequence of instant SEQ ID NO: 14 as a nucleic acid encoding a guide RNA to bind a complementary strand of a BK polyomavirus in a CRISPR-based nucleic acid detection system for the benefit of detecting BK virus-associated nephropathy in renal transplant patients. Accordingly, it is herein maintained that one of ordinary skill in the art would have had reasonable expectation of success at arriving at the claimed invention given that the methods of CRISPR-based nucleic acid detection and guide RNA design using known sequences are well known, successfully demonstrated, and commonly used as evidenced by the applied prior art (see Abudayyeh). It is maintained that in view of the language of the instant claims, one of ordinary skill in the art would have been motivated and had a reasonable expectation of success in arriving at the instant claims in view of Abudayyeh and Vats.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARLENE V BUCKMASTER whose telephone number is (703)756-5371. The examiner can normally be reached M-F 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MARLENE V BUCKMASTER/Examiner, Art Unit 1672
/THOMAS J. VISONE/Supervisory Patent Examiner, Art Unit 1672