DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant' s correspondence received March 31, 2026. Claims 1-10, 15, 16, and 18-20 are currently pending. The restriction requirement mailed June 30, 2025 is still deemed proper. Applicant elected AON2, SEQ ID NO: 15-18, and SEQ ID NO: 7 without traverse in the reply filed September 1, 2025.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicants’ amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding Claim 5, the phrase "such as" in line 5 renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 6 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Regarding Claim 6, Claim 1 recites the limitation “wherein the antisense oligonucleotide comprises at least one 2’-O alkyl phosphorothioate antisense oligonucleotide”. This is interpreted as the antisense oligonucleotide contains a phosphorothioate backbone. Claim 6 recites the antisense oligonucleotide of Claim 1 further comprising a phosphorothioate backbone. This limitation is already present in Claim 1, and therefore, Claim 6 fails to further limit Claim 1.
Applicant may cancel the claim, amend the claim to place the claim in proper dependent form, rewrite the claim in independent form, or present a sufficient showing that the dependent claim complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3, 5, 6, 15, and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Albert, S. et. al., The American Journal of Human Genetics, Vol. 102, p. 517-527, April 5, 2018 and Braun, T. et. al., Human Molecular Genetics, Vol. 22, No. 25, p. 5136-5145, Aug. 4, 2013.
Regarding Claim 1, Albert teaches an antisense oligonucleotide that binds to and/or is complementary to a poly nucleotide sequence of ABCA4 pre-mRNA where in the antisense oligonucleotide induces skipping of a pseudoexon in ABCA4 pre-mRNA to restore wild-type splicing: “we demonstrated that two neighboring deep-intronic ABCA4 variants … result in a retina-specific 345-nt pseudoexon insertion… Administration of antisense oligonucleotides (AONs) targeting the 345-nt pseudoexon can significantly rescue the splicing defect” (Abstract, p. 517). Albert teaches at least one 2’-O alkyl phosphorothioate antisense oligonucleotide: “AONs were chemically modified by adding a phosphorothioate backbone and a 2-O-methyl sugar modification 2OMe/PS” (p. 519). Albert provides motivation for their expanding their technique across ABCA4 mutations to treat Stargardt Disease: “a single AON molecule rescued splicing defects associated with different neighboring mutations, thereby providing new strategies for the treatment of persons with STGD1” (Abstract, P. 517).
Albert does not teach an antisense oligonucleotide that binds to and/or is complementary to SEQ ID NO: 10.
Braun teaches splice variants in ABCA4 that lead to Stargardt disease including c.5196+1137G>A in exon 36 and the alternate exon formed (p. 5193, Table 1). The alternate exon or pseudo-exon 36.1 taught by Braun (p. 5138, Figure 2) is complementary to SEQ ID NO: 10.
SEQ ID NO: 10
Qy 47 CGAGGAAACACUCAUAAAUGCACGGGGAGGAGGUCAGAACCUGAAAGCCUUUCUUUGGAU 106
|:|||||||||:||:|||:||||||||||||||:|||||||:|||||||:::|:::|||:
Db 1 CRAGGAAACACTCATAAATGCACGGGGAGGAGGTCAGAACCTGAAAGCCTTTCTTTGGAT 60
Qy 107 AAGAGCAUCAACUGCAGGUACC 128
|||||||:||||:|||||:|:|
Db 61 AAGAGCATCAACTGCAGGTAMC 82
It would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 because Albert provides motivation to use AONs to target ABCA4 pre-mRNA to correct for aberrant splicing due to psuedoexons and Braun teaches a psuedoexon target to treat Stargardt Disease . One skilled in the art would have a reasonable expectation of success because Albert was able to use AONs to induce skipping of a psuedoexon in ABCA4 pre-mRNA to restore wild-type splicing, and Braun teaches the sequence to target. Therefore, Claim 1 is obvious over Albert and Braun.
Regarding Claim 3, Albert teaches AON of 19 bp length (Table 1, p. 519), which is in the range of about 8 to about 40 nucleotides. Therefore, Claim 3 is obvious over Albert and Braun.
Regarding Claim 5, Claim 5 is rejected under 112b for indefiniteness. For compact prosecution, Claim 5 is interpreted as “such as halogenated derivatives” is not a limitation of the claim. Albert teaches an AON modified with 2’-O-methyl modified ribose (p. 519). Therefore, Claim 5 is obvious over Albert and Braun.
Regarding Claim 6, Claim 6 is rejected under 112d for failing to further to limit the claimed invention of Claim 1. Albert teaches a phosphorothioate backbone. Therefore, Claim 6 is obvious over Albert and Braun.
Regarding Claim 15, Albert teaches a method for treatment of an ABCA-4 related disease or condition requiring modulating splicing of ABCA4 of an individual need thereof, where said method comprises contacting a cell of said individual with an AON for redirecting splicing: “Moreover, an AON based therapeutic approach was designed and tested, showing that one AON was able to redirect the splice defect in both mutated cell lines … Overall, these results highlight the potential of AONs as a therapeutic tool for Stargardt disease” (p. 524, col. 2); “PPCs were treated with AONs (0.5 and
1 mM) by mixing the naked AONs directly with the culturing medium” (p. 519, col. 1). Therefore, Claim 15 is obvious over Albert and Braun.
Regarding Claim 16, Albert teaches a method of treating Stargardt disease (p. 524, col. 2). Therefore, Claim 16 is obvious over Albert and Braun.
Claims 2, 4, 7, 8, 18 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Albert, S. et. al., The American Journal of Human Genetics, Vol. 102, p. 517-527, April 5, 2018 and Braun, T. et. al., Human Molecular Genetics, Vol. 22, No. 25, p. 5136-5145, Aug. 4, 2013. as applied to Claim 1 above, and further in view of Aznarez, I. and Nash, H., WO 2017/106370 A1, published June 22, 2017.
Regarding Claim 2, Claim 1 is obvious over Albert and Braun
Albert and Braun do not teach a nucleotide in the antisense oligonucleotide may be an RNA residue, a DNA residue, or a nucleotide analogue or equivalent.
Aznarez teaches an antisense oligonucleotide for redirecting splicing that binds to a polynucleotide including targeting ABCA4 pre-mRNA: “[A]n antisense oligomer (ASO) complementary to a targeted portion of the RIC pre-mRNA encoding the target protein or functional RNA, whereby the retained intron is constitutively spliced from the RIC pre-mRNA encoding the target protein or functional RNA,” (p. 1, [0004], p. 2 [0004]). Aznarez teaches, “The nucleobase of an ASO may be any naturally occurring, unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase” (p. 89, [00260]), which includes an RNA residue, a DNA residue, or a nucleotide analogue or equivalent. Aznarez provides evidence that their invention works in Example 5 (p. 113).
It would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to have further substituted into the AON to include an RNA residue, a DNA residue, or a nucleotide equivalent taught by Aznarez because Aznarez teaches that an AON may have these residues such that they are capable of bonding with the target pre-mRNA. The results would have been predictable because Aznarez was able to create an AON that binded their target pre-mRNA. Therefore, Claim 2 is obvious over Albert and Braun in further view of Aznarez.
Regarding Claim 4, Claim 1 is obvious over Albert and Braun.
Braun teaches splice variants in ABCA4 that lead to Stargardt disease including c.5196+1137G>A in exon 36 and the alternate exon formed (p. 5193, Table 1). The alternate exon or pseudo-exon 36.1 taught by Braun (p. 5138, Figure 2) is complementary to SEQ ID NO: 15.
Qy 1 CUUUCAGGUUCUGACCUCC 19
|:::||||::|:||||:||
Db 7 CTTTCAGGTTCTGACCTCC 29
Albert and Braun do not teach SEQ ID NO: 15.
Aznarez teaches “Methods of identifying additional ASOs that enhance splicing” for ABCA4 (p. 100, [00290]). The method includes doing a round of screening performed by an “ASO-walk” described in Example 3 (p. 105, [00300]).
Regarding Claim 4, it would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to have further tried the method of Aznarez to create an AON comprising of SEQ ID NO: 15. Albert and Braun teach a recognized problem that aberrant splicing causes Stargardt disease. Aznarez and Albert teach a predictable solution to aberrant splicing by designing an antisense oligonucleotide that binds the pseudoexon, and Albert provides evidence the method solves the aberrant splicing. Braun teaches the pseudoexon is 82 nucleotides long (p. 5138, Figure 2) to rescue aberrant splicing such that a limited number of solutions exists with a reasonable expectation of success. Therefore, Claim 4 is obvious over Albert and Braun in further view of Aznarez.
Regarding Claim 7, Claim 1 is obvious over Albert and Braun.
Albert and Braun do not teach a viral vector expressing an AON.
Aznarez teaches, “delivery of agents by administration of an adenovirus vector” for expression of an AON, which is a viral vector expressing a AON. (p. 98, [00283]).
Regarding Claim 7, it would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to have further substituted the invention into the viral vector taught by Aznarez. Aznarez teaches using an AON targeting ABCA4 expressed by a viral vector, and Albert teaches an AON targeting ABCA4 such that the substituted component would perform the same function. The results would be predictable because Aznarezes teach the structure and use of AON and AAV vectors. Therefore, Claim 7 is obvious over Albert and Braun in further view of Aznarez.
Regarding Claims 8, Claim 1 is obvious over Albert and Braun.
Albert and Braun do not teach a pharmaceutical composition comprising an AON.
Aznarez teaches “pharmaceutical compositions comprising any of the aforementioned antisense oligomers and an excipient” (p. 9, [0015]) comprising an AON for redirecting splicing.
Regarding Claim 8, it would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to have further substituted the invention into the pharmaceutical composition taught by Aznarez. Aznarez teaches a pharmaceutical composition comprising an AON targeting ABCA4, and Albert teaches an AON targeting ABCA4 such that the substituted component would perform the same function. The results would be predictable because Aznarez teaches that pharmaceutical compositions may comprise of AONs. Therefore, Claim 8 is obvious over Albert and Braun in further view of Aznarez.
Regarding Claim 18, Braun teaches splice variants in ABCA4 that lead to Stargardt disease including c.5196+1137G>A in exon 36 and the alternate exon formed (p. 5193, Table 1). The alternate exon or pseudo-exon 36.1 taught by Braun (p. 5138, Figure 2) is complementary to SEQ ID NO: 7.
Qy 1 GAAACACUCAUAAAUGCACGGGGAGGAGGUCAGAACCUGAAAGCCUUUCUUUGGAUAAGA 60
|||||||:||:|||:||||||||||||||:|||||||:|||||||:::|:::|||:||||
Db 5 GAAACACTCATAAATGCACGGGGAGGAGGTCAGAACCTGAAAGCCTTTCTTTGGATAAGA 64
Qy 61 GCAUCAACUGCAG 73
|||:||||:||||
Db 65 GCATCAACTGCAG 77
Regarding Claim 18, it would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to have further tried the method of Aznarez to create an AON that binds to or is complementary to SEQ ID NO: 7 as described in the rejection of Claim 4 above. Therefore, Claim 18 is obvious over Albert and Braun in further view of Aznarez.
Regarding Claim 19, Braun teaches splice variants in ABCA4 that lead to Stargardt disease including c.5196+1137G>A in exon 36 and the alternate exon formed (p. 5193, Table 1). The alternate exon or pseudo-exon 36.1 taught by Braun (p. 5138, Figure 2) is complementary to SEQ ID NO: 16-18.
SEQ ID NO: 16
Qy 1 GGAGGUCAGAACCUGAAAG 19
|||||:|||||||:|||||
Db 29 GGAGGTCAGAACCTGAAAG 47
SEQ ID NO: 17
Qy 1 GGGGAGGAGGUCAGAACCUGAAAGCCUUU 29
||||||||||:|||||||:|||||||:::
Db 24 GGGGAGGAGGTCAGAACCTGAAAGCCTTT 52
SEQ ID NO: 18
Qy 1 UGCACGGGGAGGAGGUCAGAACCUGAAAGCCUUUCUUUG 39
:||||||||||||||:|||||||:|||||||:::|:::|
Db 19 TGCACGGGGAGGAGGTCAGAACCTGAAAGCCTTTCTTTG 57
Regarding Claim 19, it would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to have further tried the method of Aznarez to create an AON that binds to or is complementary to SEQ ID NO: 16-18 as described in the rejection of Claim 4 above. Therefore, Claim 19 is obvious over Albert and Braun in further view of Aznarez.
Claims 9 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Albert, S. et. al., The American Journal of Human Genetics, Vol. 102, p. 517-527, April 5, 2018 and Braun, T. et. al., Human Molecular Genetics, Vol. 22, No. 25, p. 5136-5145, Aug. 4, 2013 and Aznarez, I. and Nash, H., WO 2017/106370 A1, published June 22, 2017. as applied to Claim 8 above, and further in view of Danis R., et. al., Current Eye Research, Vol. 26, No. 1, p. 45-54, Jan. 11, 2003.
Regarding Claims 9 and 10, Claim 8 is obvious over Albert and Braun in further view of Aznarez.
Aznarez teaches intravitreal administration of the pharmaceutical composition comprising of a antisense oligonucleotide (p. 9, [0016]).
Albert, Braun and Aznarez do not teach a pharmaceutical composition for intravitreal administration that is dosed in an amount ranged from 0.05 mg and 5 mg of total AON or dosed 0.1 to 1 mg of total AON per eye.
Danis teaches the administration of antisense oligonucleotides to pigs receiving 0.180 mg per eye (p. 46, col. 2), which is between 0.1 and 1 mg of total AON per eye with respect to Claim 10. The total dose is 0.360 mg of antisense oligonucleotide for two eyes, which is between 0.05 mg and 5 mg total AON with respect to Claim 9. Danis teaches their method had activity in vivo and “significantly inhibited the neovascular response compared to control injections” (p. 49, col. 1).
Regarding Claims 9 and 10, it would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to have further substituted the invention into the pharmaceutical composition taught by Aznarez and modified the dosage of AON as taught by Danis to create the invention of Claims 9 and 10. One would be motivated to do so because Danis shows those dosages have activity in vivo and have predictable results. Therefore, Claims 9 and 10 are obvious over Albert and Braun in further view of Aznarez and Danis.
Claims 5 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Albert, S. et. al., The American Journal of Human Genetics, Vol. 102, p. 517-527, April 5, 2018 and Braun, T. et. al., Human Molecular Genetics, Vol. 22, No. 25, p. 5136-5145, Aug. 4, 2013, as applied to Claim 1 above, and further in view of Cummins, L. et. al., Nucleic Acids Research, Vol. 23, No. 11, p. 2019-2024, June 11, 1995.
Regarding Claim 5 and 20, Claim 1 is obvious over Albert and Braun.
Albert and Braun do not teach 2’-O-propyl modified ribose.
Cummins teaches 2’-O-propyl modifications: “Our data suggests that fully modified 2'-O-methyl and 2'-O-propyl oligoribonucleotides possess a desirable mix of nuclease resistance and enhanced duplex stability” (p. 2024, col. 2).
Regarding Claims 5 and 20, it would have been obvious to one skilled in the art before the effective filing date to have modified the AON of Albert to target the psuedoexon taught by Braun to create the invention of Claim 1 and to substitute into the AON the 2’-O-propyl ribose modifications taught by Cummins. Albert teaches antisense oligonucleotides, and Cummins teaches modification in RNA oligonucleotides. The results of the substitution would have been predictable because Cummins tested the properties of 2-O’-propyl modifications in RNA oligonucleotide. One skilled in the art would have been motivated to do so because Cummins teaches the modification provides enhanced stability and nuclease resistance. Therefore, Claims 5 and 20 are obvious over Albert and Braun in further view of Cummins.
RE: Applicants’ Arguments, 35 USC § 103
Applicant argues “Claim 1 as amended now requires the antisense oligonucleotide to bind to SEQ ID NO: 10 and induce skipping of a pseudoexon to restore wild-type splicing”, which Aznarez does not teach. This argument is moot as the obviousness rejection of Claim 1 cites Albert and Braun, not Aznarez.
Applicant further argues that the “’obvious to try’ rationale is flawed … designing an effective AON is not simply a matter of selecting any complementary sequence within a target region. The specific AON sequences claimed were identified through systematic screening and testing”. This argument is not persuasive because it does not address the elements of an obvious to try rationale for rejection. MPEP 2143.I.E provides that an obvious to try rejection must have a finding that there is a recognized problem, a finding of finite number of predictable solutions to the problem, and a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success. The rejection of Claims 4, 18 and 19 contain each of these elements. The applicants’ arguments that the sequences “were identified through systematic screen and testing” is what the rejection is stating is obvious to try per the screening method of Aznarez. The argument references the data presented in the specification on p. 7-8: “AON2 and AON3 seemed to be most potent” but does not identify the results as “unexpected results”. The quotation appears on page 20 of the instant specification, and the full phrase provides some uncertainty to the results: “AON2 and AON3 seemed to be most potent, at least in the PPCs”. Figure 4 provides evidence of AON2 and AON3’s activity in PPCs, but the instant specification does not provide evidence that the results would be unexpected.
Applicant further argues, “With respect to claims 9 and 10, which are rejected over Aznarez in view of Danis…” This argument is moot as the rejections of Claims 9 and 10 are over Albert, Braun Aznarez and Danis.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.R./Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
