Prosecution Insights
Last updated: April 18, 2026
Application No. 17/633,672

AMINOACYL-TRNA SYNTHETASES AND CELL LINES FOR SITE-SPECIFIC INCORPORATION OF UNNATURAL AMINO ACIDS

Non-Final OA §103§112
Filed
Sep 29, 2022
Examiner
RYAN, DOUGLAS CHARLES
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Brickbio Inc.
OA Round
1 (Non-Final)
41%
Grant Probability
Moderate
1-2
OA Rounds
3y 2m
To Grant
89%
With Interview

Examiner Intelligence

Grants 41% of resolved cases
41%
Career Allow Rate
28 granted / 68 resolved
-18.8% vs TC avg
Strong +48% interview lift
Without
With
+47.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
47 currently pending
Career history
115
Total Applications
across all art units

Statute-Specific Performance

§101
7.4%
-32.6% vs TC avg
§103
33.5%
-6.5% vs TC avg
§102
14.6%
-25.4% vs TC avg
§112
31.4%
-8.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 68 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received on 2/26/2026. Claims 1-3, 21-27, 29-30, 32-34, 36, 41, and 45-47 are pending. Claims 1-3 and 30 have been amended. Claims 4-20, 28, 31, 35, 37-40, and 42-44 have been previously cancelled. Claims 45-47 were newly added. All pending claims are currently under examination. Election/Restrictions The Applicant has elected without traverse the group consisting of the mutated protein comprising SEQ ID NO: 2 and suppressor tRNA SEQ ID NO: 19. Upon further consideration, the original restriction is hereby withdrawn. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 2 and 3 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 2, claim 2 depends from claim 1, which requires SEQ ID NO: 1 with eight specific mutations. SEQ ID NO: 1 comprising the eight specific mutations is identical to SEQ ID NO: 2. Thus, recitation of “98%” sequence identity to SEQ ID NO: 2 in claim 2 does not further limit the claim because such language expands the scope of the claim to include additional mutations not recited in claim 1. Regarding claim 3, claim 3 is drawn to a sequence comprising SEQ ID NO: 2. As discussed above, claim 1 recites SEQ ID NO: 1 with eight mutations, which are the mutations comprised in SEQ ID NO: 2. Thus, claim 3 fails to limit claim 1 because claim 1 recites, in effect, a sequence of mutant protein comprising SEQ ID NO: 2. Claim 3 therefore does not further limit claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-2, 21-27, 29-30, 32-34, 36, 41, and 45-47 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, claim 1 recites that a mutein “comprising the amino acid sequence of SEQ ID NO: 1,” and then further recites that “the tRNA synthetase mutein comprises Q2E…and H537G.” This claim language is unclear because it is unclear what the sequence is meant to comprise. For instance, it is unclear how the mutein is meant to both comprise SEQ ID NO: 1 and also, for instance, the “Q2E” residue, because a sequence comprising SEQ ID NO: 1 cannot also comprise the change “Q2E.” Furthermore, the list of mutations is not recited to be mutations (i.e., claim 1 recites “the tRNA synthetase mutein comprises Q2E…H537G,” but does not make reference to what these residues are in reference to (e.g., SEQ ID NO: 1). The structure of the claimed mutein is therefore unclear. Claims 2, 21-27, 29-30, 32-34, 36, 41, and 45-47 depend from claim 1 and do not resolve this 112(b) issue and are therefore also rejected under 112(b). Regarding claim 2, claim 2 is unclear because it depends from claim 1 and recites that the sequence is 98% identical to SEQ ID NO: 2, where SEQ ID NO: 2 is SEQ ID NO: 1 comprising the eight mutations recited in claim 1. Given that claim 2 depends from claim 1, it is unclear how a sequence comprising SEQ ID NO: 1 (claim 1) can also not comprise SEQ ID NO: 1 (i.e., a sequence with 98% identity to SEQ ID NO: 2, claim 2). Regarding claim 46, claim 46 recites “the cell line,” which lacks proper antecedent basis because no “cell line” is recited previously in the claim or the claim from which it depends. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 21-27, 29, 33-34, 36, 41, 45, and 47 are rejected under 35 U.S.C. 103 as being unpatentable over Liu (WO 2008/073184 A2) in view of Zheng (Zheng Y et al. Biochemistry. 2018 Jan 30;57(4):441-445). Regarding claim 1, claim 1 is here being interpreted to recite a mutein comprising SEQ ID NO: 2 (i.e., SEQ ID NO: 1 comprising the eight mutations recited in claim 1). Regarding SEQ ID NO: 1, SEQ ID NO: 1 is the wildtype version of E. coli LeuRS gene a taught by Liu’s SEQ ID NO: 4, which is a 100% match to instant SEQ ID NO: 1 (see alignment on page 1 of Liu, and also Figure 16, “11/47” of Liu, which identifies SEQ ID NO: 4 as wildtype E. coli LeuRS). Thus, claim 1 is properly characterized as being a wildtype LeuRS protein comprising the mutations Q2E, E20K, M40I, L41S, T252A, Y499I, Y527A, and H537G. Regarding mutated version of LeuRS, Liu is a patent document which focuses on mutated tRNA synthetases, orthogonal pairs of tRNA and aminoacyl-tRNA synthetases, and mutations thereof (Title, Abstract, and throughout). With regards to such mutated LeuRS, Liu teaches SEQ ID NO: 101, which is a 99% match to instant SEQ ID NO 2 (i.e.., a wildtype LeuRS comprising the eight mutations recited in claim 1, see alignment on page 2 of Liu). As shown in the alignment on page 2 of Liu, Liu’s SEQ ID NO: 101 is a 99% match to instant SEQ ID NO: 1 with the eight recited mutations (i.e., instant SEQ ID NO: 2), where SEQ ID NO: 101 of Liu comprises the mutations Q2E and H537G (see alignment on page 2 of Liu). Furthermore, Liu teaches that the production of mutated tRNA/synthetase and orthogonal pairing are useful because they allow for the production of proteins with unnatural amino acids, where furthermore such advantageous benefits and orthogonal pairing and mutagenesis strategies are well-known in the art (e.g., paragraph 10), where furthermore the strategy and need of mutating such synthetases for uses in other cells is also known (paragraph 12). Liu, while teaching a LeuRS that is 99% identical to SEQ ID NO: 1 with the eight mutations recited in claim 1, where the mutant of Liu comprises Q2E and H537 (i.e., Liu’s SEQ ID NO: 101), does not teach the mutations E20K, M40I, L41S, T252A, Y499I, and Y527A. Zheng is a research article that focuses on expanding the scope of single and dual noncanonical amino acid mutagenesis in mammalian cells using orthogonal polyspecific leucyl-tRNA synthetases, specifically using E. coli LeuRS and making useful mutations to wildtype E. coli LeuRS (Title, Abstract, and throughout). Zheng and Liu therefore directly overlap in subject matter, goal, and field of endeavor, because both teach the same wildtype E. coli LeuRS, and both teach the same goal of designing systems using mutations to LeuRS. Zheng teaches the mutations E20K, M40I, L41S, T252A, Y499I, and Y527A made in E. coli LeuRS (see Figure 2A, PLRS1 and PLRS2). Thus, Zheng teaches that mutations E20K, M40I, L41S, T252A, Y499I, and Y527A were already known in the art and reduced to practice (Figure 2). Furthermore, Zheng teaches that both mutant versions PLRS1 and PLRS2 “showed comparable efficiencies for charging these ncAAs,” (page 3, first paragraph). Thus, Zheng teaches that the mutations E20K, M40I, L41S, T252A, Y499I, and Y527A were not only known, but also reduced practice and shown to be useful, with demonstrated efficiency for charging non-canonical amino acids (page 3, first paragraph). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the LeuRS mutant which comprises Q2E and H537G mutations taught by Liu to include the mutations E20K, M40I, L41S, T252A, Y499I, and Y527A as taught by Zheng, as such a combination is the simple substitution for one known prior art element for another with predictable results. In the present case, a practitioner starting from SEQ ID NO: 101 of Liu would make the additional mutations/substitutions taught by Zheng (E20K, M40I, L41S, T252A, Y499I, and Y527A), where furthermore the results are predictable given that such mutations have already been reduced to practice and shown to be useful for charging non-canonical amino acids. Furthermore, aside from the rationale of a simple substitution, a practitioner would also be motivated to make such changes, as Zheng teaches that such mutants are useful for charging non-canonical amino acids, one objective of Liu. Regarding claim 2, the limitations of claim 2 broadly encompass the mutations and sequences discussed above in the rejection of claim 1, as the combination of Liu and Zheng renders obvious a sequence with at least 98% identity of SEQ ID NO: 2 and includes the eight mutations recited in claim 1. Regarding claim 3, claim 3 recites that the sequence comprises SEQ ID NO: 2. SEQ ID NO: 101 comprises 10 additional mutations compared with wildtype SEQ ID NO: 2 (see alignment of SEQ ID NO). However, given that SEQ ID NO: 2 is wildtype LeuRS with eight mutations rendered obvious by the combination of Liu and Zheng, a practitioner could also certainly envision mutations in Liu’s SEQ ID NO: 101 which would revert residues back to native wildtype LeuRS, particularly in light of the fact that Liu also teaches the known LeuRS wildtype sequence. Furthermore, such changes, where a residue would be reverted back to wildtype, would have predictable results given that the wildtype sequence is known to be functional. Regarding claim 21, Liu teaches that the elements of their systems can be encoded in a nucleic acid (e.g., paragraph 17). Regarding claim 22, Liu teaches that the nucleic acid can be in a vector (e.g., paragraph 181). Regarding claim 23, Liu teaches that nucleic acids can be introduced into the genome of a host cell (e.g., paragraphs 134 and 216, “homologous recombination,” which reasonably includes insertion into a genome). Regarding claims 24-26, Liu teaches that their systems involve host cells which comprise the components of their invention (paragraph 174). Regarding claim 27, Liu teaches the creation of stable cell lines to express tRNAs and aaRS (e.g., paragraph 263). Liu teaches that nucleic acids can be introduced into the genome of a host cell (e.g., paragraphs 134 and 216, “homologous recombination,” which reasonably includes insertion into a genome). Regarding claim 29, Liu teaches the cell can further comprise a suppressor tRNA capable of incorporating an unnatural amino acid into a protein expressed in a cell (e.g., paragraph 244). Liu teaches that the suppressor can be a suppressor leucyl-tRNA (e.g., paragraph 285). Regarding claim 33, Liu teaches that the cell can be prokaryotic or eukaryotic (e.g., paragraph 8). Regarding claim 34, Liu teaches that the leucine analog can be an azide (e.g., paragraph 158). Regarding claim 36, Liu teaches that the suppressor tRNA/aaRS system is capable of incorporating an unnatural amino acid in a protein at a position corresponding to a premature stop codon (e.g., amber stop codon, paragraph 171). Regarding claim 41, Liu teaches a method of expressing a protein containing an unnatural amino acid, the method comprising culturing or growing a cell of claim 24 under conditions that permit incorporation of the unnatural amino acid into the protein being expressed in the cell (e.g., paragraph 171, claim 27 of Liu). Regarding claim 45, per the specification, SEQ ID NO: 55 is simply the nucleic acid sequence encoding SEQ ID NO: 2 (pages 60-61 of the specification). Given that the protein sequence of SEQ ID NO: 2 is rendered obvious by the combination of Liu and Zheng, a practitioner could arrive at the nucleic acid sequence of such a protein simply by routine optimization and laboratory work. Regarding claim 47, Liu teaches the integration of synthetase mutants into a host cell genome (e.g., paragraphs 134 and 216, “homologous recombination,” which reasonably includes insertion into a genome). Claims 30, 32, and 46 are rejected under 35 U.S.C. 103 as being unpatentable over Liu (WO 2008/073184 A2) and Zheng (Zheng Y et al. Biochemistry. 2018 Jan 30;57(4):441-445) as applied to claims 1-3, 21-27, 29, 33-34, 36, 41, 45, and 47, above, and further in view of Chatterjee (WO 2020/257668, A1, published 12/24/2020 with earliest effective filing date of 6/21/2019). A discussion of Liu and Zheng is given above and incorporated herein. Furthermore, note that the effective filing date of Chatterjee pre-dates the earliest effective filing date of the present application: Chatterjee therefore qualifies as prior art. Regarding claim 30, Liu, while teaches suppressor tRNA, does not specifically teach SEQ ID NO: 19. Chatterjee is a patent application which teaches enhanced platforms for the incorporation of unnatural amino acids into mammalian cells, and therefore directly overlaps in subject matter and field of endeavor with Liu and Zheng (Title, Abstract, and throughout). Furthermore, Chatterjee teaches SEQ ID NO: 30, a sequence for a variant leucyl-tRNA, where SEQ ID NO: 30 is a 100% match of instant SEQ ID NO: 19: gcccggatggtggaatcggtagacacaagggactctaaatccctcggcgttcgcgctgtgcgggttcaagtcccgctccgggcacca – SEQ ID NO: 30, Chatterjee gcccggatggtggaatcggtagacacaagggactctaaatccctcggcgttcgcgctgtgcgggttcaagtcccgctccgggca - SEQ ID NO: 19, instant Application Furthermore, instant SEQ ID NO: 19 was taught by Chatterjee in their provisional specification 62/864,570, filed 6/21/2019 (see Figure 10b of provisional specification 6/21/2019, reproduced below). PNG media_image1.png 192 1283 media_image1.png Greyscale Thus, the effective filing date for SEQ ID NO: 30 taught by Chatterjee predates the present filing date. Furthermore, Chatterjee teaches that the variant taught in SEQ ID NO: 30 is an improved version of the wildtype version (e.g., paragraph 27 of provisional specification 62/864,570, corresponding to paragraph 49 of WO 2020/257688). It would have been obvious to a person of ordinary skill in the art before the effective filing date to modify the cells rendered obvious by Liu/Zheng to include a suppressor tRNA such as that recited in SEQ ID NO: 19 as taught by Chatterjee, where the combination is the simple substitution of one known prior art element for another to produce predictable results. In the present case, the practitioner would simply substitute the suppressor tRNAs taught by Liu for the tRNA taught by Chatterjee. Furthermore, the results are predictable because Chatterjee had already reduced the sequence to practice. In addition, the combination is also obvious because Chatterjee teaches a clear motivation and teaching to combine the elements because SEQ ID NO: 30 of Chatterjee (i.e., instant SEQ ID NO: 19) is taught to be an improvement over the wildtype sequence. The practitioner is therefore sufficiently motivated to combine the teachings. Regarding claim 32, Liu teaches that the suppressor and the components of their systems are capable of being expressed in a cell (paragraph 171). Regarding claim 46, as discussed above, Chatterjee teaches SEQ ID NO: 19. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /D.C.R./Examiner, Art Unit 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Sep 29, 2022
Application Filed
Apr 03, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12577576
SYSTEMS AND METHODS FOR PLANT GENOME EDITING USING CAS 12a ORTHOLOGS
2y 5m to grant Granted Mar 17, 2026
Patent 12480140
DIFFERENTIAL KNOCKOUT OF AN ALLELE OF A HETEROZYGOUS ELANE GENE
2y 5m to grant Granted Nov 25, 2025
Patent 12473539
RNA-GUIDED NUCLEASES AND ACTIVE FRAGMENTS AND VARIANTS THEREOF AND METHODS OF USE
2y 5m to grant Granted Nov 18, 2025
Patent 12448422
TRANSCRIPTION FACTOR NCGL0581 MUTANT AND USE THEREOF IN L-SERINE DETECTION
2y 5m to grant Granted Oct 21, 2025
Patent 12428683
A METHOD FOR THE ISOLATION OF DOUBLE-STRAND BREAKS
2y 5m to grant Granted Sep 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
41%
Grant Probability
89%
With Interview (+47.9%)
3y 2m
Median Time to Grant
Low
PTA Risk
Based on 68 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month