Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant's amendments and remarks filed on March 20, 2026 are acknowledged. Claims 2-9, 12, 14-24, 26-30, 32-40, 42-75, 77-78, 80, 82-88, 91-111, 113-114, 116-120, and 123-131 have been canceled. Claims 1 and 90 were amended. Claims 1, 10, 11, 13, 25, 31, 41, 76, 79, 81, 89, 90, 112, 115, 121, and 122 are pending and are examined on the merits herein.
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on March 20, 2026 has been entered.
Priority
PNG
media_image1.png
110
472
media_image1.png
Greyscale
Withdrawn Objections
In view of Applicant’s amendments and response, the objection to the abstract is withdrawn.
Withdrawn Rejections
In view of Applicant’s amendments and response, the 35 U.S.C 112(b) and 35 U.S.C 112(a) new matter rejections are withdrawn.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on March 20, 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Objections
Claim 90 is objected to because of the following informality:
Claim 90 is missing a conjunction before the wherein clause.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 25 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claims 1 and 25 recite the following:
PNG
media_image2.png
106
632
media_image2.png
Greyscale
PNG
media_image3.png
236
634
media_image3.png
Greyscale
Claim 25 as currently written substitutes the sequence of independent claim 1 (SEQ ID NO: 100, 102, 106, 107, 111, and 123, with one or two mismatches) with a sequence that contains no mismatches. Therefore, claim 25 does not incorporate all of the limitations of the claim which it depends on.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 90 and 112 are rejected under 35 U.S.C. 103 as being unpatentable over Karras (US 6,159,694) in view of GenBank (Homo sapiens signal transducer and activator of transcription 3 (STAT3), transcript variant 1, mRNA, NCBI Reference Sequence: NM_139276.2, available August 7, 2019) and Seth et al. (WO 2015/179693).
Regarding claims 90 and 112, Karras teaches compositions comprising antisense oligonucleotides targeted to nucleic acids encoding STAT3 for inhibiting the expression of human STAT3 [abstract]. Karras teaches that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable wherein “specifically hybridizable” is defined as a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide [column 5, fourth and fifth full paragraphs]. Karras also teaches chemically linking oligonucleotides to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide [column 9, last paragraph]. Karras teaches SEQ ID NO: 75 (ISIS NO. 106764) which targets nucleotide positions 2569-2588 of GenBank Accession No. L29277 (locus name HUMAPRF). SEQ ID NO: 75 is a nucleotide sequence of human STAT3 phosphorothioate oligodeoxynucleotide that targets the 3’-UTR of STAT3 [column 24, Table 1]. Karras SEQ ID NO: 75 (designated as Db) is complementary to positions 2564 through 2583 of instant SEQ ID NO: 3 (designated as Qy) as shown in the alignment below.
Query Match 0.4%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 2564 GAGGCGCCTACCTGCATTCT 2583
||||||||||||||||||||
Db 20 GAGGCGCCTACCTGCATTCT 1
However, Karras does not teach an ASO comprising a nucleotide sequence of SEQ ID NO: 100 with one or two mismatches.
GenBank teaches a human STAT3 mRNA sequence, NM_139276.2. Instant SEQ ID NO: 100 (designated as Qy) is complementary to nucleotides 2600 through 2584 of GenBank NM_139276.2 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 17; DB 1; Length 4978;
Best Local Similarity 100.0%;
Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGTAGGCGCCTCAGTCG 17
|||||||||||||||||
Db 2600 GGTAGGCGCCTCAGTCG 2584
Karras SEQ ID NO: 75 (designated as Qy) is complementary to nucleotides 2608 through 2589 of GenBank NM_139276.2 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 4978;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGAATGCAGGTAGGCGCCTC 20
||||||||||||||||||||
Db 2608 AGAATGCAGGTAGGCGCCTC 2589
Therefore, Karras SEQ ID NO: 75 is directly surrounding the region that instant SEQ ID NO: 100 targets (positions 2600-2584 shown above).
Seth et al. teaches oligonucleotides comprising a hybridizing region and a terminal region wherein the hybridizing region includes one mismatch or two mismatches relative to the target nucleic acid. In certain embodiments, the terminal nucleosides are at the 3’ end and one or more of the terminal nucleosides are not complementary to the target nucleic acid [page 69, last paragraph]. Seth et al. also teaches that antisense mechanisms include any mechanism involving the hybridization of an oligonucleotide with target nucleic acid, wherein the hybridization results in a biological effect. In certain embodiments, such hybridization results in either target nucleic acid degradation or occupancy with concomitant inhibition or stimulation of the cellular machinery involving, for example, translation, transcription, or splicing of the target nucleic acid [page 70, first paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a gapmer antisense oligonucleotide that targets the 3’ UTR region of the human STAT3 gene with one or two mismatches with a reasonable expectation of success because instant SEQ ID NO: 100 is complementary to the human STAT3 mRNA at positions 2600-2584, Karras teaches specific antisense oligodeoxynucleotide sequences that target the surrounding region of the human STAT3 mRNA sequence that instant SEQ ID NO: 100 targets, and Seth et al. teaches oligonucleotides comprising one or two mismatches relative to the target nucleic acid. One of ordinary skill in the art would have been motivated to do so because Karras taught compositions comprising antisense oligonucleotides targeted to nucleic acids encoding STAT3 for inhibiting the expression of human STAT3 for treatment of inflammatory diseases and cancers associated with overexpression or constitutive activation of STAT3.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the antisense oligonucleotide of Karras, GenBank, and Seth et al. wherein a conjugate comprises the antisense oligonucleotide because Karras taught that chemically linking oligonucleotides to one or more moieties or conjugates enhances the activity, cellular distribution or cellular uptake of the oligonucleotide. One of ordinary skill in the art would have been motivated to do so because it would have amounted to combining known prior art elements to yield predictable results.
Claims 1, 10, 11, 13, 25, 89, and 115 are rejected under 35 U.S.C. 103 as being unpatentable over Karras (US 6,159,694) in view of GenBank (Homo sapiens signal transducer and activator of transcription 3 (STAT3), transcript variant 1, mRNA, NCBI Reference Sequence: NM_139276.2, available August 7, 2019), Seth et al. (WO 2015/179693), and Bleicher et al. (WO 2019/122282; reference previously cited by the Examiner).
Regarding claims 1 and 89, Karras teaches compositions comprising antisense oligonucleotides targeted to nucleic acids encoding STAT3 for inhibiting the expression of human STAT3 [abstract]. Karras teaches that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable wherein “specifically hybridizable” is defined as a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide [column 5, fourth and fifth full paragraphs]. Karras teaches SEQ ID NO: 75 (ISIS NO. 106764) which targets nucleotide positions 2569-2588 of GenBank Accession No. L29277 (locus name HUMAPRF). SEQ ID NO: 75 is a nucleotide sequence of human STAT3 phosphorothioate oligodeoxynucleotide that targets the 3’-UTR of STAT3 [column 24, Table 1]. Karras SEQ ID NO: 75 (designated as Db) is complementary to positions 2564 through 2583 of instant SEQ ID NO: 3 (designated as Qy) as shown in the alignment below.
Query Match 0.4%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 2564 GAGGCGCCTACCTGCATTCT 2583
||||||||||||||||||||
Db 20 GAGGCGCCTACCTGCATTCT 1
Regarding claim 10, Karras teaches that the invention also includes oligonucleotides which are chimeric oligonucleotides [column 10, second full paragraph]. Examples of chimeric oligonucleotides include but are not limited to gapmers wherein the central gap portion serves as a substrate for RNase H and the flanking portions are modified to have greater affinity for the target RNA molecule but are unable to support nuclease activity [column 10, third full paragraph].
Regarding claims 11 and 13, Karras teaches that modified oligonucleotides may also contain one or more substituted sugar moieties [column 8, second full paragraph].
Regarding claim 25, Karras teaches that preferred modified oligonucleotide backbones include phosphorothioates [column 7, second full paragraph].
Regarding claim 115, Karras teaches that oligonucleotide compounds may be formulated in a pharmaceutical composition, which may include pharmaceutically acceptable carriers and diluents [column 12, second full paragraph].
However, Karras does not teach an ASO comprising a nucleotide sequence of SEQ ID NO: 100 with one or two mismatches. Karras also does not teach packaging of antisense oligonucleotides into extracellular vesicles, specifically exosomes. Karras also does not teach all of the modifications or the modification pattern recited in claim 25.
GenBank teaches a human STAT3 mRNA sequence, NM_139276.2. Instant SEQ ID NO: 100 (designated as Qy) is complementary to nucleotides 2600 through 2584 of GenBank NM_139276.2 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 17; DB 1; Length 4978;
Best Local Similarity 100.0%;
Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGTAGGCGCCTCAGTCG 17
|||||||||||||||||
Db 2600 GGTAGGCGCCTCAGTCG 2584
Karras SEQ ID NO: 75 (designated as Qy) is complementary to nucleotides 2608 through 2589 of GenBank NM_139276.2 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 4978;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGAATGCAGGTAGGCGCCTC 20
||||||||||||||||||||
Db 2608 AGAATGCAGGTAGGCGCCTC 2589
Therefore, Karras SEQ ID NO: 75 is directly surrounding the region that instant SEQ ID NO: 100 targets (positions 2600-2584 shown above).
Seth et al. teaches oligonucleotides comprising a hybridizing region and a terminal region wherein the hybridizing region includes one mismatch or two mismatches relative to the target nucleic acid. In certain embodiments, the terminal nucleosides are at the 3’ end and one or more of the terminal nucleosides are not complementary to the target nucleic acid [page 69, last paragraph]. Seth et al. also teaches that antisense mechanisms include any mechanism involving the hybridization of an oligonucleotide with target nucleic acid, wherein the hybridization results in a biological effect. In certain embodiments, such hybridization results in either target nucleic acid degradation or occupancy with concomitant inhibition or stimulation of the cellular machinery involving, for example, translation, transcription, or splicing of the target nucleic acid [page 70, first paragraph].
Bleicher et al. teaches antisense oligonucleotides to be gapmers which are commonly used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, lines 10-12]. Bleicher et al. further teaches that gapmers comprise at least three distinct structural regions: a 5’-flank, a gap, and a 3’-flank [page 44, lines 12-13]. Additionally, Bleicher et al. teaches that the single stranded antisense oligonucleotide may be a gapmer, mixmer, or totalmer oligonucleotide and may be used in modulating a splicing event in a target pre-mRNA or inhibiting expression of a target microRNA with gapmer oligonucleotide explicitly disclosed to be useful for inhibiting mRNA expression [page 4, second full paragraph] (claim 10). Bleicher et al. teaches that the terms “modified nucleoside” and “nucleoside analogue” are used interchangeably and refer to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the nucleobase moiety [page 24, third full paragraph]. Bleicher et al. teaches that the antisense oligomers may comprise one or more nucleosides which have a modified sugar moiety [page 32, lines 8-9] such as a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA) or altered substituents at the 2’, 3’, 4’, or 5’ positions of the ribose ring [page 32, third and fourth full paragraphs]. Specifically, the locking of the conformation of the ribose is associated with an enhanced affinity of hybridization when the LNA is incorporated into an oligonucleotide [page 33, second full paragraph] (claim 11). Further, Bleicher et al. teaches that the 2’ modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide [page 32, last paragraph] (claim 13). Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32] (claim 89). Bleicher et al. teaches a conjugate comprising an oligonucleotide and at least one conjugate moiety covalently attached to said oligonucleotide [page 15, second paragraph]. Further, Bleicher et al. teaches that conjugation of the oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, e.g. by affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotide [page 57, second paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design an antisense oligonucleotide that targets the 3’ UTR region of the human STAT3 gene with one or two mismatches wherein the antisense oligonucleotide is a gapmer comprising one or more sugar modified nucleosides with a reasonable expectation of success because instant SEQ ID NO: 100 is complementary to the human STAT3 mRNA at positions 2600-2584, Karras teaches specific antisense oligodeoxynucleotide sequences that target the surrounding region of the human STAT3 mRNA sequence that instant SEQ ID NO: 100 targets, and Seth et al. teaches oligonucleotides comprising one or two mismatches relative to the target nucleic acid. One of ordinary skill in the art would have been motivated to do so because Karras taught compositions comprising antisense oligonucleotides targeted to nucleic acids encoding STAT3 for inhibiting the expression of human STAT3 for treatment of inflammatory diseases and cancers associated with overexpression or constitutive activation of STAT3.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to package the antisense oligonucleotide of Karras, GenBank, and Seth et al. into an exosome as disclosed in Bleicher et al. because Karras taught nucleic acid molecules that inhibit STAT3 expression, GenBank taught that human STAT3 mRNA sequence, Seth et al. taught oligonucleotides comprising one or two mismatches relative to the target nucleic acid, and Bleicher et al. taught that gapmer oligonucleotides are useful for inhibiting mRNA expression and incorporating modifications can enhance target hybridization and binding affinity. One would have made such a modification in order to achieve the predictable result of delivering therapeutic antisense oligonucleotides capable of strongly binding to the target sequence and to effectively deliver the antisense oligonucleotide because Bleicher et al. taught that antisense oligonucleotides may be effectively delivered via exosomes.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design an antisense oligonucleotide that targets the 3’ UTR region of the human STAT3 gene with the specific modification pattern as recited in claim 25 with a reasonable expectation of success because instant SEQ ID NO: 100 is complementary to the human STAT3 mRNA at positions 2600-2584 and Karras teaches specific antisense oligodeoxynucleotide sequences that target the surrounding region of the human STAT3 mRNA sequence that instant SEQ ID NO: 100 targets. One of ordinary skill in the art would have been motivated to do so because Karras taught compositions comprising antisense oligonucleotides targeted to nucleic acids encoding STAT3 for inhibiting the expression of human STAT3 for treatment of inflammatory diseases and cancers associated with overexpression or constitutive activation of STAT3 and Bleicher et al. taught that incorporating various chemical modifications enhances binding affinity and/or increases nuclease resistance.
Claims 31, 76, and 79 are rejected under 35 U.S.C. 103 as being unpatentable over Karras (US 6,159,694) in view of GenBank (Homo sapiens signal transducer and activator of transcription 3 (STAT3), transcript variant 1, mRNA, NCBI Reference Sequence: NM_139276.2, available August 7, 2019), Seth et al. (WO 2015/179693), and Bleicher et al. (WO 2019/122282; reference previously cited by the Examiner) as applied to claims 1, 10, 11, 13, 25, 89, and 115 above, and further in view of Haraszti et al. (Molecular Therapy 2018; reference previously cited by the Examiner).
Regarding claims 31, 76, and 79, the teachings of Karras, GenBank, Seth et al., and Bleicher et al. are discussed above.
However, Karras, GenBank, Seth et al., and Bleicher et al. do not teach an anchoring moiety linked to the STAT3 antisense oligonucleotide.
Haraszti et al. discloses that TEG and C7 linkers were used to conjugate cholesterol to siRNAs [page 1974, left column, last paragraph]. Haraszti et al. also discloses that cholesterol conjugation-mediated loading of siRNAs onto extracellular vesicles is among the most reproducible and scalable loading strategies [page 1973, right column, first full paragraph]. Furthermore, Haraszti et al. discloses the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and teaches that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides [page 1978, left column, fourth full paragraph]. It is noted that the hydrophobic cholesterol is a sterol and thus satisfies the limitations of instant claim 76.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of Karras, GenBank, Seth et al., and Bleicher et al. by conjugating the antisense oligonucleotide to hydrophobic cholesterol via a TEG linker because Haraszti et al. teaches that it is within the skill of the art to include an anchoring moiety. One would have made such a modification in order to achieve the predictable result of anchoring the oligonucleotide to the membrane of the extracellular vesicle for effective in vivo delivery. One would have been motivated to make such a modification to effectively mediate in vivo delivery of therapeutic oligonucleotides packaged into and anchored to extracellular vesicles.
Claim 41 is rejected under 35 U.S.C. 103 as being unpatentable over Karras (US 6,159,694) in view of GenBank (Homo sapiens signal transducer and activator of transcription 3 (STAT3), transcript variant 1, mRNA, NCBI Reference Sequence: NM_139276.2, available August 7, 2019), Seth et al. (WO 2015/179693), Bleicher et al. (WO 2019/122282; reference previously cited by the Examiner), and Haraszti et al. (Molecular Therapy 2018; reference previously cited by the Examiner) as applied to claims 1, 10, 11, 13, 25, 31, 76, 79, 89, and 115 above, and further in view of Laszlo et al. (Blood Reviews 2014; reference previously cited by the Examiner).
Regarding claim 41, the teachings of Karras, GenBank, Seth et al., Bleicher et al., and Haraszti et al. are discussed above.
However, Karras, GenBank, Seth et al., Bleicher et al., and Haraszti et al. do not teach an exogenous targeting moiety that binds to CD33 or a fragment thereof.
Laszlo et al. teaches that CD33 is a myeloid differentiation antigen with endocytic properties. It is broadly expressed on acute myeloid leukemia (AML) blasts and, possibly, some leukemic stem cells and has therefore been exploited as target for therapeutic antibodies [abstract]. Laszlo et al. also teaches that a therapeutically important characteristic of CD33 is its internalization when bound by bivalent antibodies [page 144, first full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of Karras, GenBank, Seth et al., and Bleicher et al. by incorporating an exogenous targeting moiety that binds to CD33. One would have made such a modification in order to achieve the predictable result of anchoring the oligonucleotide to the membrane of the extracellular vesicle for effective in vivo delivery. One would have been motivated to make such a modification to effectively mediate in vivo delivery of therapeutic oligonucleotides packaged into and anchored to extracellular vesicles to treat acute myeloid leukemia.
Claim 81 is rejected under 35 U.S.C. 103 as being unpatentable over Karras (US 6,159,694) in view of GenBank (Homo sapiens signal transducer and activator of transcription 3 (STAT3), transcript variant 1, mRNA, NCBI Reference Sequence: NM_139276.2, available August 7, 2019), Seth et al. (WO 2015/179693), Bleicher et al. (WO 2019/122282; reference previously cited by the Examiner), and Haraszti et al. (Molecular Therapy 2018; reference previously cited by the Examiner) as applied to claims 1, 10, 11, 13, 25, 31, 76, 79, 89, and 115 above, and further in view of Wang et al. (International Journal of Molecular Sciences 2017; reference previously cited by the Examiner) and Dorywalska et al. (Molecular Cancer Therapeutics 2016; reference previously cited by the Examiner).
Regarding claim 81, the teachings of Karras, GenBank, Seth et al., Bleicher et al., and Haraszti et al. are discussed above.
However, Karras, GenBank, Seth et al., Bleicher et al., and Haraszti et al. do not teach a linker comprising valine-alanine-p-aminobenzylcarbamate. Karras also teaches chemically linking oligonucleotides to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide [column 9, last paragraph].
Dorywalska et al. teaches that valine-citrulline-p-aminocarbamate (VC-PABC)
dipeptide is a linker that is widely used to maintain a stable covalent attachment of the drug to the antibody [page 958, right column, second full paragraph].
Wang et al. teaches that valine-alanine is a dipeptide comprising two human essential amino acids and is used in next generation antibody drug conjugates (ADCs) loading new toxins [abstract]. Wang et al. teaches that the VA peptide has an advantage in the preparation process and cost of materials and may have the potential to improve ADC stability and decrease product aggregation [page 2, first full paragraph]. Furthermore, Wang et al. teaches that VA-based ADC displays favorable potency in vitro and in vivo while not producing significant systemic toxicity during the treatment and recovery period in xenograft studies [page 16, last paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of Karras, GenBank, Seth et al., and Bleicher et al. by conjugating the antisense oligonucletoide to a linker and substituting the valine-citrulline linker of Dorywalska et al. with valine-alanine because Dorywalska et al. and Wang et al. both teach dipeptide linkers and Dorywalska et al. teaches that it is within the skill of the art to include a dipeptide linker to attach the drug to the antibody. One would have made such a substitution in order to achieve the predictable result of improving ADC stability and decreasing product aggregation as taught by Wang et al.
Claims 121 and 122 are rejected under 35 U.S.C. 103 as being unpatentable over Karras (US 6,159,694) in view of GenBank (Homo sapiens signal transducer and activator of transcription 3 (STAT3), transcript variant 1, mRNA, NCBI Reference Sequence: NM_139276.2, available August 7, 2019), Seth et al. (WO 2015/179693), and Bleicher et al. (WO 2019/122282; reference previously cited by the Examiner) as applied to claims 1, 10, 11, 13, 25, 89, and 115 above, and further in view of Williams et al. (WO 2018/039119).
Regarding claims 121 and 122, the teachings of Karras, GenBank, Seth et al., and Bleicher et al. are discussed above.
However, Karras, GenBank, Seth et al., and Bleicher et al. do not teach a kit comprising an extracellular vesicle and instructions for use.
Williams et al. teaches compositions for introducing exosomes to a subject in need thereof [0002] and compositions for the delivery of exosomes to a subject in need thereof [0004]. Williams et al. teaches that the exosomes may comprise RNA, including miRNA, siRNA, DNA, polypeptides, small molecules, and proteins [0007] – [0008]. Williams et al. also teaches compositions for the systemic delivery of therapeutic exosomes to targets of interest and reduces the amount of therapeutic exosomes delivered to the liver and spleen and greater distribution to other areas in the body [0024]. Williams et al. recites in claim 63 a kit comprising a pharmaceutical composition comprising the therapeutic exosomes of any of claims 40 to 62 and instructions for use.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to package the extracellular vesicle of Karras, GenBank, Seth et al., and Bleicher et al. in a kit with instructions for use because Williams et al. taught exosomes carrying therapeutic molecules including small molecules and inhibitory oligonucleotides. Williams et al. also taught a kit and instructions for use comprising a pharmaceutical composition to administer to a subject for systemic delivery and to reduce the amount of exosomes delivered to the liver and spleen and increase distribution to other areas of the body. One of ordinary skill in the art would have been motivated to do so because it would have amounted to combining known prior art elements to yield predictable results.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights