DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on February 23, 2026 has been entered.
Status of Claims / Response to Amendment
This office action is in response to an amendment filed on February 23, 2026.
Claims 1-18 were previously pending. Applicant amended claims 1 and 11; cancelled claims 2-3.
Claims 1 and 4-18 are currently pending, with claims 5-18 withdrawn.
Claims 1 and 4 are under consideration.
The claim amendment filed on February 23, 2026 overcame the objection to claims 1-2.
All of the amendment and arguments have been thoroughly reviewed and considered. All of the previously presented rejections have been withdrawn as being obviated by the amendment of the claims, which included new limitations to the claims, in ways that were not considered in the previous rejections.
Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
This office action contains new grounds for rejection necessitated by amendment.
Priority -- Updated
Regarding instant claims 1 and 4, the earliest priority is 09/27/2019 because the priority document (JAPAN 2019-176891) filed that date is the first to disclose the specific probe sequences comprising mismatches (SEQ ID Nos: 90-91, 93-95, 53, 67-69, 54, 73-82, 55, 85-88), as required by the claims.
Claim Rejections - 35 USC § 101 -- New Grounds
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1 and 4 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Regarding claim 1, it recites a kit comprising a probe, comprising sequence selected from SEQ ID Nos: 90-91, 93-95, 53, 67-69, 54, 73-82, 55, 85-88; and a set of primers without any defined structural features.
Following the analysis below the claims are not patent eligible under 35 U.S.C. 101.
Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to a kit, therefore to one of the of statutory categories.
Step 2A
According to MPEP § 2106, Step 2A is a two-prong inquiry, in which examiners determine in Prong One whether a claim recites a judicial exception, and if so, then determine in Prong Two if the recited judicial exception is integrated into a practical application of that exception. Together, these prongs represent the first part of the Alice/Mayo test, which determines whether a claim is directed to a judicial exception.
Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes. The claims recite a probe comprising naturally occurring sequences, and primers without specifying any unique, markedly different characteristics compared to what occurs in nature.
As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature.
In this instant case, SEQ ID NO: 53 and SEQ ID NO: 54, disclosed by the specification in Table 5 as comprising mismatches, are naturally occurring sequences.
Acrocephalus scirpaceus scirpaceus genome assembly, chromosome: 25.
GenBank: OU383800.1
Qy 1 GAGGAGCAGAGCAGAGGACAA 21 (SEQ ID NO: 53)
|||||||||||||||||||||
Db 4168492 GAGGAGCAGAGCAGAGGACAA 4168472
Mastacembelus armatus genome assembly, chromosome: 5.
GenBank: LR535837.1
Qy 1 CAGAGGCTTAGAGGAGGCAGAG 22 (SEQ ID NO: 54)
||||||||||||||||||||||
Db 671973 CAGAGGCTTAGAGGAGGCAGAG 671994
Other claimed naturally occurring sequences include 90-91, 93-95, 67-69, 73-75, 78-80, 85-88.
The claim does not define the primers in the primer set with any structural features, thus they are classified as nature-based products because they could be either naturally occurring or they do not have markedly different characteristics compared to what occurs in nature.
It has been well-established that, single-stranded DNA fragments (i.e., oligonucleotides) such as primers and probes, as identified by the courts, are natural phenomena . See MPEP 2106.04(b). See also University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 761, 113 USPQ2d 1241, 1244 (Fed. Cir. 2014) (composition of matter claims directed to primers, which are "short, synthetic, single-stranded DNA molecules[s] that bind[] specifically to intended target nucleotide sequences[s]" are not patent eligible).
See also Roche Molecular Sys., Inc. v. Cepheid, No. 2017-1690, 2018 WL 4868033 (Fed. Cir. Oct. 9, 2018). (claims to a set of primers customized for detecting signature nucleotides for detecting M. tuberculosis were rejected under Section 101 because they have genetic sequences identical to those found in nature. ).
In this instance, the primers and probe are nature-based products because they encompass sequences that are found in nature, and do not possess any structural characteristics that are different from what is found in nature.
In conclusion, the claims recite nature-based products.
Step 2A Prong 2 - Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim as a whole do not integrates the exception into a practical application of that exception.
For a claim reciting a judicial exception to be eligible, the additional elements (if any) in the claim must “transform the nature of the claim” into a patent-eligible application of the judicial exception, Alice Corp., 573 U.S. at 217, 110 USPQ2d at 1981.
In this instant case, the claim additionally recites CALR gene mutations, such as a type 1 mutation of the CALR gene. But this element does not transform the claimed nature-based products to something that are markedly different than their naturally occurring counterparts in their natural state, nor does it integrate the recited judicial exception into a practical application of the exception.
The different types of CALR gene mutations are well-known in the art as naturally occurring, as evidenced by Keaney 1. Mere combination of natural elements does not affect a change to any of the natural elements from their natural functions. See Funk Bros. Seed v. Kalo Inoculant Co., 333 U.S. 127 (1948).
Although the claim recites a probe comprising "nucleotide mismatches within the hybridizing nucleotide sequence," as discussed above, the specification indicates that this feature is encompassed by the claimed sequences, such as SEQ ID NO: 53 and 54 (see Table 5).
The recitation regarding mismatches in hybridization, introduced by "artificial deletions not present in the wild-type CALR gene shown in SEQ ID NO: 10," does not further limit the scope of the probe. This language merely describes a process that results in hybridization mismatches, which can be achieved either by deletions within the hybridization target sequence or within the probe.
MPEP 2113 states:
"[E]ven though product-by-process claims are limited by and defined by the process, determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production."
The core issue remains that the probe sequence itself is naturally occurring. The process by which it is prepared does not alter the fact that the claimed nucleic acid sequence is found is nature.
Applicant is advised that while the claims recite nature-based products; however, if the claimed kit comprise any probes or oligonucleotides having a detectable label, such as a linker (e.g. see para. [0112] "The probes actually produced each comprise a linker (a region of continuous Ts) bound to the 5'-side of a complementary strand of the designed sequence"; Table 4), or a fluorescent dye (e.g. see para. [0072]; Table 2, fluorescence-labeled primers), that would be sufficient to overcome the 101 rejection.
Step 2B - Whether a Claim Amounts to Significantly More: No.
According to MPEP§ 2106.05, The second part of the Alice/Mayo test is often referred to as a search for an inventive concept. Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 217, 110 USPQ2d 1976, 1981 (2014) (Servs. v. citing Mayo Collaborative Prometheus Labs., Inc., 566 U.S. 66, 71-72, 101 USPQ2d 1961, 1966 (2012)). An “inventive concept” is furnished by an element or combination of elements that is recited in the claim in addition to (beyond) the judicial exception, and is sufficient to ensure that the claim as a whole amounts to significantly more than the judicial exception itself. Alice Corp., 573 U.S. at 27-18, 110 USPQ2d at 1981 (citing Mayo, 566 U.S. at 72-73, 101 USPQ2d at 1966).
In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception. The claims do not appear to add markedly different characteristics that significantly modify or use the naturally occurring oligonucleotides in a manner that is not naturally occurring.
The dependent claim 4 does not recite additional elements that amount to significantly more than the judicial exception. Claim 4 recites an additional probe with functional description "hybridizing to…" without claiming any specific structures in the claimed probe that directly support or relate to this functional language. Therefore, the probe recited in claim 4, without any clear and specific structural limitation, is interpreted under BRI to encompass any probe, including those comprising naturally occurring sequences. Thus, the dependent claim merely recites the judicial exception, without any additional element beyond the judicial exception.
In conclusion, the claims are not patent eligible under 35 U.S.C. 101.
Subject Matter Not Taught/Suggested in Prior Art
No references were found teaching or suggesting claims 1 and 4, but they are rejected for reasons given above. The claims would be allowable if rewritten to overcome the rejections under 35 U.S.C. 101 set forth in this Office action and to include all of the limitations of base claim 1.
The following subject matter is not taught or suggested in the prior art:
Claim 1 is directed to a kit product and has been amended to include a probe, whose structure is specifically defined by comprising certain SEQ ID NOs (e.g., any one of SEQ ID Nos: 90-91, 93-95, 53, 67-69, 54, 73-82, 55, 85-88), and a primer set, "wherein the CALR mutation probe hybridizes to the nucleotide sequence around the CALR gene mutation included in the region amplified by the set of primers."
Accordingly, the claim is interpreted such that the probe and primers are structurally and functionally related. Specifically, both are interpreted as comprising sequences complementary to a region of the CALR gene containing a mutation, with the primer binding sites flanking the probe binding site within that region, thereby allowing the probe to hybridize to amplicons generated by the primer set.
Keaney 2 recites primers and probes for CALR type 1-5 mutation detection in myeloproliferative neoplasms (Abstract), wherein the primers amplify the CALR gene region comprising type 1-5 mutation, and the CALR mutation probe hybridizes to the nucleotide sequence around the CALR gene mutation included in the region amplified by the set of primers (Table 1; page 663, left-hand col, lines 20-24; page 664, left-hand col, lines 1-8).
However, Keaney does not disclose any of the claimed probe sequences.
No prior art teach probes comprising the entire sequence of any of one of SEQ ID NOs 90-91, 93-95, 67-69, 54, 73-82, 55, 85-88.
Zhuo 3 teaches a probe comprising SEQ ID NO: 53 ([0029]; claim 12; SEQ ID NO: 36157, 81 nts). However, it would not have been obvious to combine the teachings of Keaney and Zhuo because there is no motivation to do so. Although Zhuo discloses SEQ ID NO: 53, it teaches the probe in a different context ꟷ namely, for identifying fusion RNA transcripts ꟷ and does not mention or suggest that its probe sequences could be applied to detection of CALR gene mutations.
No prior art teaches or fairly suggests the claimed probe sequences, together with a primer set, in the context of hybridizing to and detecting CALR gene comprising mutations.
The Applicant is reminded that, upon allowance of the kit claims (claims 1 and 4) under consideration, the withdrawn species (claim 5) and process (claim 6) claims will be eligible for rejoinder. To qualify for rejoinder, claims directed to non-elected inventions must include all the limitations of an allowable claim.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 Keaney et al. A novel molecular assay using hybridisation probes and melt curve analysis for CALR exon 9 mutation detection in myeloproliferative neoplasms. J Clin Pathol. 2017 Aug;70(8):662-668. doi: 10.1136/jclinpath-2016-204205. Epub 2017 Jan 31. PMID: 28143941; cited as NPL#4 in IDS filed 02/23/2022; entire document, see introduction for example
2 Keaney et al. A novel molecular assay using hybridisation probes and melt curve analysis for CALR exon 9 mutation detection in myeloproliferative neoplasms. J Clin Pathol. 2017 Aug;70(8):662-668. doi: 10.1136/jclinpath-2016-204205. Epub 2017 Jan 31. PMID: 28143941; cited as NPL#4 in IDS filed 02/23/2022
3 Zhuo (US20160078168A1 - Fusion transcript detection methods and fusion transcripts identified thereby; published on 2016-03-17)