Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
This Office Action superseded the Office Action of 02JAN2026.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Claims 1, 15-30, and 32-34 have an effective filing date of 28AUG2019.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 6/30/2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Election/Restriction
Group I, claims 1 and 15-20, was elected.
Species – Upon further review all targeting domain sequences have been rejoined.
Status of Claims
Claims 1, 15-30, and 32-34 are currently pending.
Claims 21-30 and 32-34 are withdrawn.
Claims 15-16 are amended.
Claims 2-14 are canceled.
Objections Withdrawn
The objection to claims 15-16 are withdrawn in view of Applicant’s amendments to claims.
Rejections Withdrawn
The rejection filed under Double Patenting is withdrawn in view of Applicant’s abandonment of Application 18/023,548.
New Rejections
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 15 and 16 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
In the instant case, the claims are inclusive of a genus of gRNA comprising a targeting domain which binds a target domain of SEQ ID NOs: 1-20, 40-43, 67-177. However, the written description in this case only sets forth gRNA comprising a targeting domain comprising SEQ ID NOs: 21-30, 44-45, 239, and 257. The specification does not disclose, and the art does not teach, the genus of gRNA comprising a targeting domain which binds a target domain of SEQ ID NOs: 1-20, 40-43, 67-177 as broadly encompassed in the claims.
The specification discloses the specifications list 14 gRNAs comprising SEQ ID NOs: 21-30, 44-45, 239, and 257 as a representative number of species for the genus of gRNA comprising a targeting domain which binds a target domain of SEQ ID NOs: 1-20, 40-43, 67-177. However, the written description only reasonably conveys gRNA comprising a targeting domain comprising SEQ ID NOs: 21-30, 44-45, 239, and 257. A description of a genus may be achieved by means of a recitation of a representative number of species falling within the scope of the genus or by describing structural features common to that genus that “constitute a substantial portion of the genus.” See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997): “A description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNA, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to the members of the genus, which features constitute a substantial portion of the genus.”
The instant specification fails to provide sufficient descriptive information, such as definitive structural features that are common to the genus. That is, the specification provides neither a representative number of gRNA comprising a targeting domain which binds a target domain of SEQ ID NOs: 1-20, 40-43, 67-177 that encompass the genus of gRNA comprising a targeting domain which binds a target domain of SEQ ID NOs: 1-20, 40-43, 67-177 nor does it provide a description of structural features that are common to the genus so that one of skill in the art can ‘visualize or recognize’ the members of the genus. “[A] sufficient description of a genus . . . requires the disclosure of either a representative number of species falling within the scope of the genus or structural features common to the members of the genus so that one of skill in the art can ‘visualize or recognize’ the members of the genus.” Ariad, 598 F.3d at 1350 (quoting Eli Lilly, 119 F.3d at 1568-69). A “representative number of species” means that those species that are adequately described are representative of the entire genus. AbbVie Deutschland GMBH v. Janssen Biotech, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014).
Since the disclosure fails to describe common attributes or characteristics that adequately identify members of the genus, and because the genus is highly variant, the disclosure of gRNA comprising a targeting domain comprising SEQ ID NOs: 21-30, 44-45, 239, and 257 is insufficient to describe the genus. Thus, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus as broadly claimed.
Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111, clearly states “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” (See page 1117.) The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116). Even though Applicant may propose methods of screening for possible members of the genus, the skilled artisan cannot envision the detailed chemical structure of the encompassed genus, and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolation. The compound itself is required. See Fiers v. Revel, 25 USPQ2d 1601 at 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. See Ariad, 94 USPQ2d at 1161; Centocor at 1876 (“The fact that a fully-human antibody could be made does not suffice to show that the inventors of the '775 patent possessed such an antibody.”)
Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1, 18, and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Bentwich et al (US 9650680 B2).
With regards to claim 1, Bentwich et al teaches a polynucleotide for the treatment of cancer [Abstract]. Bentwich et al further teaches a RNA polynucleotide molecule comprising SEQ ID NO: 746459. A comparison of instant SEQ ID NO: 44 and SEQ ID NO: 746459 of Bentwich et al is shown below.
Instant SEQ ID NO: 44 and SEQ ID NO: 746459 of Bentwich et al.
Query Match 100.0%; Score 20; Length 64;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AUAUAAUCAACUCCUCUGCC 20
||||||||||||||||||||
Db 5 AUAUAAUCAACUCCUCUGCC 24
One of ordinary skill, before the effective filing date, would have been motivated to use Bentwich’s RNA polynucleotide comprising SEQ ID NO: 746459. It would have been prima facie obvious to use Bentwich’s RNA polynucleotide comprising SEQ ID NO: 746459 for a gRNA comprising a targeting domain, wherein the targeting domain comprises SEQ ID NO: 44, because Bentwich teaches the polynucleotide comprising SEQ ID NO: 746459.
With regards to claim 18, Bentwich et al further teaches the RNA guides between nucleotides pairing [Column 11, line 26].
With regards to claim 20, Bentwich et al teaches the polynucleotide comprising phosphorothioate [Column 7, line 28].
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DENNIS JOHN SULLIVAN whose telephone number is (571)272-0509. The examiner can normally be reached Mon - Fri: 7:30AM - 4:30PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached at (571) 270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DENNIS J SULLIVAN/ Examiner, Art Unit 1642
/NELSON B MOSELEY II/ Primary Examiner, Art Unit 1642
Prosecution Insights