Prosecution Insights
Last updated: April 19, 2026
Application No. 17/639,263

VASCULOGENIC FIBROBLASTS

Non-Final OA §103§112
Filed
Feb 28, 2022
Examiner
CHONG, KIMBERLY
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Trustees of Indiana University
OA Round
3 (Non-Final)
72%
Grant Probability
Favorable
3-4
OA Rounds
2y 7m
To Grant
85%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allow Rate
1066 granted / 1473 resolved
+12.4% vs TC avg
Moderate +12% lift
Without
With
+12.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
67 currently pending
Career history
1540
Total Applications
across all art units

Statute-Specific Performance

§101
3.9%
-36.1% vs TC avg
§103
26.8%
-13.2% vs TC avg
§102
20.6%
-19.4% vs TC avg
§112
29.5%
-10.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1473 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Request for Continued Examination A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 03/16/2026 has been entered. Status of Application/Amendment/Claims Applicant's response filed 03/16/2026 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 01/16/2026 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. With entry of the amendment filed on 03/16/2026, claims 7, 8, 11, 12 and 13 are pending and are currently under examination. Claim Rejections - 35 USC § 103 This rejection is modified slightly due to claim amendments. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claim interpretation: The claims are drawn to a method of stimulating vasculogenesis in a patients tissue comprising converting dermal fibroblast cells of said patient into vasculogenic fibroblasts by contacting dermal fibroblast cells with an anti-miRNA-200b oligonucleotide wherein the dermal fibroblasts become vasculogenic fibroblasts that express Fsp-1 and at least one or all the vascular endothelial growth factors VEGF2, CD31, eNOS and CDH5. The claims are interpreted such that the single step of contacting a dermal fibroblast cell with an anti-miRNA-200b converts the cell to a vasculogenic fibroblast that would inherently express Fsp-1 and at least one or all of VEGF2, CD31, eNOS and CDH5, exhibits endothelial cell (EC)-like morphologic shape and has enhanced uptake of acetylated low density lipoprotein (Ac-LDL) and thus stimulate neovascularization. The specification in Example 1 (pages 15-16) describe a vasculogenic fibroblast state as the single step of the application of anti-mir-200b to dermal fibroblasts cells cause the cell to undergo endothelial cell (EC)-like morphologic shape changes and upregulates the cell surface vascular endothelial growth factor receptor-2 (VEGFR2) expression. FSP- 1+/VEGFR2+ cells also upregulated expression of platelet endothelial cell adhesion molecule 1(CD31), endothelial nitric oxide synthase (eNOS), cadherin 5 (CDH5), and enhanced uptake of acetylated low density lipoprotein (Ac-LDL). Therefore any prior art that teaches contacting a dermal fibroblast with an anti-miRNA-200b would convert the cell to a vasculogenic fibroblast that expresses Fsp-1 and at least one or all the vascular endothelial growth factors VEGF2, CD31, eNOS and CDH5 and further exhibits endothelial cell (EC)-like morphologic shape and has enhanced uptake of acetylated low density lipoprotein (Ac-LDL) and be delivered to a subject. Claims 7, 8, 11, 12 and 13 is/are rejected under 35 U.S.C. 103 as being unpatentable over Sen et al. (US 2012/0214863 of record cited on IDS filed 02/28/2025), as evidenced by Yoon, Dajeong, et al. "Accelerated wound healing by fibroblasts differentiated from human embryonic stem cell‐derived mesenchymal stem cells in a pressure ulcer animal model." Stem cells international 2018.1 (2018), Sinha et al. (microRNA-200b as a Switch for Inducible Adult Angiogenesis. Antioxid. Redox Signal. 2015, Vol. 22, No. 14, p1257-1272 of record cited on IDS filed 02/28/2025), Gallego-Pérez, Daniel, et al. ("Topical tissue nano-transfection mediates non-viral stroma reprogramming and rescue." Nature nanotechnology 12.10 (2017): 974-979), Li et al. (Generation of Functional Human Cardiac Progenitor Cells by High-Efficiency Protein Transduction of record cited on IDS filed 02/28/2025), McDonald et al. (US 20130243876) and Zhang et al. ("Antisense technology." Cancer Gene Therapy. Totowa, NJ: Humana Press, 2005. 35-49). Regarding claim 7, Sen teaches a method of altering gene expression in a patient's skin cells, said method comprising the step of modulating gene expression in dermal fibroblasts comprising contacting said dermal fibroblasts with an anti-miRNA oligonucleotide (claim 1) under conditions that enhance cellular uptake of said anti-miRNA oligonucleotide (para 0126). Sen et al. teach a method of treating or preventing a condition associated with decreased wound healing in a subject, the method comprising: administering to the subject a compound comprised of an anti-miR gene product that regulates or enhances re-epithelialization, and/or wound healing in regular or compromised wounds, wherein the administering is sufficient to treat or prevent the condition in the subject (0028). As evidenced by Yoon et al., fibroblasts synthesize and secrete dermal collagen, matrix proteins, growth factors, and cytokines (abstract) and normal fibroblast cells already express a level of FSP-1 (see results 3.1). Sen does not expressly teach an anti-miRNA-200b oligonucleotide having SEQ ID No. 1 or enhanced cellular uptake of said anti-miRNA-200b oligonucleotide. Sinha teaches induction of vasculogenic properties by inhibition of miR-200b and teach downregulation of miR-200b has been reported across various tumor types, as deregulated angiogenesis is necessary for tumor development (abstract). Sinha teach transient downregulation of miR-200b in wounds drives wound angiogenesis, which is formation of new blood vessels (pg. 1261, col 2, para 2) and teach miRNAs are short noncoding RNAs of approximately 21-23 nucleotides in length (pg. 1259). Sinha et al. teach VEGF-A was validated to be a direct target of miR-200b and downregulation of miR-200b caused aberrant expression of VEGF in diabetic ECs and also teach blocking miR200b expression in diabetic wounds restored VEGF-A levels (page 1265 col. 1). Sinha et al. teach miR-200b represents a critical hub in the regulation of inducible adult angiogenesis (1262 col. 1). Sinha et al. concludes that miR-200b can regulate angiogenesis by targeting both VEGF-A and its receptors such as VEGFR2 (pg.1266 col. 1) and silencing the level of miR-200b through antagomiR delivery can help in conditions where angiogenesis is required, as in the case of wound healing (pg.1267 last para). Because Sinha teach induction of vasculogenic properties of cells by inhibition of miR-200b also inhibits transcription factors such as VEGF-A and its receptor VEFGR2, it would have been obvious to one of ordinary skill in the art that by decreasing the concentration of functional miR-200b in fibroblast cells according to Sen et al., the cells could be reprogrammed due to altered transcription program, and be induced to develop vasculogenic properties such as formation of new blood vessels. Regarding claim 8, Sen et al. does not expressly teach wherein an anti-miR-200b oligonucleotide is delivered into the cytosol of human dermal fibroblast cells via tissue nanotransfection. Sinha et al. teach mature miRNA is generated in the cytosol by Dicer cleavage of pre-miRNA (p1259), it would have been obvious to one of ordinary skill in the art that an anti-miR-200b oligonucleotide could be delivered using art known methods into the cytosol of human dermal fibroblast cells, to inhibit the mature miR-200b present in the cytosol. Gallego-Perez teach in vivo cell reprogramming has the potential to enable more-effective cell-based therapies by using readily available cell sources (for example, fibroblasts) and circumventing the need for ex vivo pre-processing and report a novel yet simple-to-implement non-viral approach to topically reprogram tissues through a nanochannelled device validated with well-established and newly developed reprogramming (see abstract). Gallego-Perez developed a novel yet simple to implement non-viral approach to topically and controllably deliver reprogramming factors to tissues through a nanochannelled device (Fig. 1). This tissue nano-transfection (TNT) approach allows direct cytosolic delivery of reprogramming factors by applying a highly intense and focused electric field through arrayed nanochannels (see page 974 col. 1). Gallego-Perez teach this tissue nano-transfection (TNT) approach can be used with oligo RNA (for example, miRs and siRNAs)-mediated reprogramming (Supplementary Fig. 18) and gene modulation (see page 978 last para). It would have been obvious for one of skill in the art to use tissue nanotransfection methods to deliver the anti-miRNA to dermal fibroblasts given Gallego-Perez teach this method is an efficient method to deliver reprogramming factors to tissues. Regarding claims 7, 11 and 12, because anti-miR-200b was applied to dermal fibroblast cells, the cells would become vasculogenic fibroblasts with the inherent properties of expression of Fsp-1, at least one or all of VEGF2, CD31, eNOS and CDH5, exhibits endothelial cell (EC)-like morphologic shape and has enhanced uptake of acetylated low density lipoprotein (Ac-LDL). It is well established that the patentability of product claims depends on the structure, not function, of the product. “[T]he patentability of apparatus or composition claims depends on the claimed structure, not on the use or purpose of that structure.” Catalina Mkt. Int’l, Inc. v. Coolsavings.com, Inc., 289 F.3d 801, 809 (Fed. Cir. 2002). That is, “[f]rom the standpoint of patent law, a compound and all of its properties are inseparable; they are one and the same thing.” In re Papesch, 315 F.2d 381, 391 (CCPA 1963). Furthermore, note that when a rejection is based on a reference teaching a product appearing to be substantially identical to the claimed product, and when the examiner presents reasoning tending to show inherency, the burden shifts to the applicant to show an unobvious difference. See MPEP 2112: “[T]he PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his [or her] claimed product. Whether the rejection is based on inherency under 35 U.S.C. 102, on prima facie obviousness under 35 U.S.C. 103, jointly or alternatively, the burden of proof is the same...[footnote omitted].” “There is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the time of invention, but only that the subject matter is in fact inherent in the prior art reference. Schering Corp. v. Geneva Pharm. Inc., 339 F.3d 1373, 1377, 67 USPQ2d 1664, 1668 (Fed. Cir. 2003) (rejecting the contention that inherent anticipation requires recognition by a person of ordinary skill in the art before the critical date and allowing expert testimony with respect to post-critical date clinical trials to show inherency); see also Toro Co. v. Deere & Co., 355 F.3d 1313, 1320, 69 USPQ2d 1584, 1590 (Fed. Cir. 2004) ("[T]he fact that a characteristic is a necessary feature or result of a prior-art embodiment (that is itself sufficiently described and enabled) is enough for inherent anticipation, even if that fact was unknown at the time of the prior invention."); Abbott Labs v. Geneva Pharms., Inc., 182 F.3d 1315, 1319, 51 USPQ2d 1307, 1310 (Fed.Cir.1999).” See MPEP 2112. Regarding claim 13, McDonald et al. teach the sequence of mir-200b (SEQ ID No.1) in Table 1, which is shown below with 14 nucleotides that are targeted by the instantly claimed SEQ ID No. 1 highlighted. CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGA UGGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGG AGCCCUGCACG (SEQ ID NO: 1) The claimed anti-miR200b SEQ ID No. is 19 nucleotides in length and it would have been obvious to use the mir-200b sequence taught in the art to make an anti-miR200b. Zhang et al. teach there are well known reliable approaches to select an optimal antisense sequence such as sequence-walking which has yielded good results or computer aided target selection which allows antisense to be designed to target regions of mRNA predicted to be free from intramolecular base pairing (see page 40). Therefore one of skill in the art would have been capable of designing and testing the oligonucleotide for inhibitory properties against miR-200b. It would have been obvious to try given there is a design need to find efficient miR-200b inhibitory sequences to use in methods of stimulating neovascularization as discussed above. Further given there was a finite number of solutions since the miR200b sequence is known and methods of gene walking are well known and a reliable approach to finding an optimal sequence. KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process. Furthermore, there is an expectation of an advantage for contacting a dermal fibroblast with an anti-miR-200b oligonucleotide and thus a motivation to combine the prior art references for stimulating neovascularization in a patient’s tissue (see MPEP 2144). Conclusive proof of efficacy is not required to show a reasonable expectation of success and obviousness does not require absolute predictability, but at least some degree of predictability is required (MPEP 2143.02). Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed. Response to Applicant’s Arguments Applicant’s arguments are acknowledged but are not persuasive. Applicant argues vasculogenesis is the de novo formation of blood vessels from non-vascular cells that primarily occurs in the embryo to create the initial vascular network. Angiogenesis is the growth of new vessels from pre-existing ones, occurring via sprouting or splitting, primarily during development and in adult tissue remodeling. Accordingly, the process of inducing angiogenesis as disclosed in Sinha is unrelated to the process of vasculogenesis. In response the specification describes in the example that administration of anti-miRNA revealed sprouting of cutaneous microvasculature (line 26 page 17) and have identified a physiologic role for miR-200b to regulate dermal fibroblast Fli1 expression during wound healing that causes a cell state change in the fibroblasts to a gain in pro-angiogenic VF functional status (lines 16-21 page 18). Thus the results appear to demonstrate some angiogenetic properties of vascular growth despite Applicant’s argument of de novo formation of blood vessels. Applicant argues vasculogenic fibroblasts are a novel cell type that is not disclosed in the prior art. In addition to acquiring vasculogenic properties, this new cell type continues to express fibroblast markers. This is not the fate change of the fibroblast to another cell type, as disclosed in the prior art, but a state change of the fibroblast to acquire vasculogenic properties. Accordingly, the cited prior art uniformly teaches "fate change", rather than a "state change" as required by the present invention. This is a fundamentally different biological outcome relative to the prior art disclosures. In response and as stated above, because anti-miR-200b was applied to dermal fibroblast cells, the cells would become vasculogenic fibroblasts with the inherent properties of expression of Fsp-1, at least one or all of VEGF2, CD31, eNOS and CDH5, exhibits endothelial cell (EC)-like morphologic shape and has enhanced uptake of acetylated low density lipoprotein (Ac-LDL). It is well established that the patentability of product claims depends on the structure, not function, of the product. “[T]he patentability of apparatus or composition claims depends on the claimed structure, not on the use or purpose of that structure.” Catalina Mkt. Int’l, Inc. v. Coolsavings.com, Inc., 289 F.3d 801, 809 (Fed. Cir. 2002). That is, “[f]rom the standpoint of patent law, a compound and all of its properties are inseparable; they are one and the same thing.” In re Papesch, 315 F.2d 381, 391 (CCPA 1963). Applicant agrees with the examiner that the fact that when anti-miR-200b is contacted with dermal fibroblast cells, the cells would become vasculogenic fibroblasts but argues that the mere fact that vasculogenic fibroblasts would be created under such circumstances would be unknown to the skilled practitioner attempting to induce vasculogenesis and the de novo formation of a vascular network. In the 103 rejection above, these properties do not have to be known because they are an inherent feature of contacting the cells with anti-miRNA-200b. Applicant further argues that Sinha provides no motivation to contact dermal fibroblasts in the absence of pre-existing vascular tissues, and would not lead to the present invention that is direct to a method of inducing vasculogenesis by taking the specific steps of either introducing vasculogenic fibroblasts produced in vitro or by converting dermal fibroblast cells of said patient into vasculogenic fibroblasts in vivo. There is nothing in the prior art that would suggest that vascular cells or tissues could be created de novo. In response, the claims do not recite a limitation wherein the method requires contacting dermal fibroblasts in the absence of pre-existing vascular tissue. Applicant again agrees that the method inherently produces vasculogenic fibroblasts but argues while vasculogenic fibroblasts may be serendipitously produced by the prior art procedures, a method specifically directed to the creation of vasculogenic fibroblasts for the express purpose of inducing vasculogenesis and the de novo formation of a vascular components was not suggested by the prior art as there was no appreciation of the capabilities of dermal fibroblasts transfected with an anti-miRNA-200b oligonucleotide. In response, the claimed method does not state the it is specifically directed to the creation of vasculogenic fibroblasts and it is not required to have an appreciation of the capability of dermal fibroblasts transfected with an anti-miRNA-200b. As stated previously, any prior art that teaches contacting a dermal fibroblast with an anti-miRNA-200b would convert the cell to a vasculogenic fibroblast that expresses Fsp-1 and at least one or all the vascular endothelial growth factors VEGF2, CD31, eNOS and CDH5 and further exhibits endothelial cell (EC)-like morphologic shape and has enhanced uptake of acetylated low density lipoprotein (Ac-LDL) and be delivered to a subject. Furthermore because Sinha teach induction of vasculogenic properties of cells by inhibition of miR-200b also inhibits transcription factors such as VEGF-A and its receptor VEFGR2, it would have been obvious to one of ordinary skill in the art that by decreasing the concentration of functional miR-200b in fibroblast cells according to Sen et al., the cells could be reprogrammed due to altered transcription program, and be induced to develop vasculogenic properties such as formation of new blood vessels. The limitation of the vasculogenic fibroblasts stimulating the de novo formation of vascular components is an inherent property that naturally flows. Applicant further argues that they have discovered that contacting cells with an anti-miRNA-200b oligonucleotide in tissue well supplied by blood does not result in the de novo formation of blood vessels. Hypoxic conditions are required for the vasculogenic cells to stimulate de novo formation of blood vessels. In response, these limitations of the tissue is well supplied by blood or hypoxic conditions are required are not claimed. Thus the rejection is maintained. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 7-8 and 11-13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for methods of administration of anti-miRNA to fibroblast that revealed sprouting of cutaneous microvasculature (line 26 page 17) and have identified a physiologic role for miR-200b to regulate dermal fibroblast Fli1 expression during wound healing that causes a cell state change in the fibroblasts to a gain in pro-angiogenic VF functional status (lines 16-21 page 18), does not reasonably provide enablement for methods of stimulating vasculogenesis in a patients tissues wherein administration of an anti-miRNA to a patients tissues caused the vasculogenic fibroblast to stimulate de novo formation of vascular components in patients in need of vasculogenesis. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims. The following factors have been considered in the analysis of enablement: (1) the breadth of the claims, (2) the nature of the invention, (3) the state of the prior art, (4) the level of one of ordinary skill, (5) the level of predictability in the art, (6) the amount of direction provided by the inventor, (7) the existence of working examples, (8) the quantity of experimentation needed to make or use the invention based on the content of the disclosure. The breadth of the claims and the nature of the invention: The claims are drawn to methods of stimulating vasculogenesis in a patients tissues comprising converting dermal fibroblast cells into vasculogenic fibroblasts by contacting the cells with an anti-miRNA-200b thereby stimulating de novo formation of vascular components in patients in need of vasculogenesis. The nature of the invention is drawn to the de novo formation of blood vessels and components. Whether the specification would have been enabling as of the filing date involves consideration of the nature of the invention, the state of the prior art, and the level of skill in the art. The state of the prior art is what one skilled in the art would have known, at the time the application was filed, about the subject matter to which the claimed invention pertains. The relative skill of those in the art refers to the skill of those in the art in relation to the subject matter to which the claimed invention pertains at the time the application was filed. See MPEP § 2164.05(b). The state of the prior art provides evidence for the degree of predictability in the art and is related to the amount of direction or guidance needed in the specification as filed to meet the enablement requirement. The state of the prior art is also related to the need for working examples in the specification. The state of the prior art: A thorough review of the patent and non-patent literature indicates that the state of the art demonstrating formation of vasculogenic fibroblasts by administering anti-miR-200b and stimulation of de novo formation of blood vessels and components was nascent. The prior of Sen (cited above) teach a method of altering gene expression in a patient's skin cells, said method comprising the step of modulating gene expression in dermal fibroblasts comprising contacting said dermal fibroblasts with an anti-miRNA oligonucleotide. Sen does not necessarily teach the anti-miRNA contacted with the dermal fibroblasts would cause vasculogenesis (i.e. the stimulation of de novo formation of blood vessels and components) but would however be advantages in wound healing. The level of one of ordinary skill: While the level of one of ordinary skill practicing said invention would be high, the level of predictability is considered variable as evident in the prior art discussed above and is not considered to provide sufficient enablement to practice the claimed invention. Because the state of the prior art does not provide evidence of the degree of predictability that the method of formation of vasculogenic fibroblasts by administering anti-miR-200b would result in stimulation of de novo formation of blood vessels and components, one of ordinary skill in the art would look for guidance or direction in the instant specification. The level of predictability in the art: “The “predictability or lack thereof” in the art refers to the ability of one skilled in the art to extrapolate the disclosed or known results to the claimed invention. If one skilled in the art can readily anticipate the effect of a change within the subject matter to which the claimed invention pertains, then there is predictability in the art. On the other hand, if one skilled in the art cannot readily anticipate the effect of a change within the subject matter to which that claimed invention pertains, then there is lack of predictability in the art. Accordingly, what is known in the art provides evidence as to the question of predictability.” (MPEP 2164.03). The amount of direction provided by the inventor: The amount of guidance or direction needed to enable the invention is inversely related to the amount of knowledge in the state of the art as well as the predictability in the art. In re Fisher, 427 F.2d 833, 839, 166 USPQ 18, 24 (CCPA 1970). The “amount of guidance or direction” refers to that information in the application, as originally filed, that teaches exactly how to make or use the invention. The more that is known in the prior art about the nature of the invention, how to make, and how to use the invention, and the more predictable the art is, the less information needs to be explicitly stated in the specification. In contrast, if little is known in the prior art about the nature of the invention and the art is unpredictable, the specification would need more detail as to how to make and use the invention in order to be enabling. >See, e.g., Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1326 (Fed. Cir. 2004). The existence of working examples: The working embodiment in the instant application describes methods of administration of anti-miRNA to fibroblast that revealed sprouting of cutaneous microvasculature (line 26 page 17) and has identified a physiologic role for miR-200b to regulate dermal fibroblast Fli1 expression during wound healing that causes a cell state change in the fibroblasts to a gain in pro-angiogenic VF functional status (lines 16-21 page 18) wherein the results appear to indicate the method can cause angiogenesis. The working embodiments do not describe embodiments of stimulating de novo formation of vascular components. While the MPEP 2164.02 states the specification need not contain an example if the invention is otherwise disclosed in such manner that one skilled in the art will be able to practice it without an undue amount of experimentation. In re Borkowski, 422 F.2d 904, 908, 164 USPQ 642, 645 (CCPA 1970), the lack of a working example, however, is a factor to be considered, especially in a case involving an unpredictable and undeveloped art. The quantity of experimentation needed to make or use the invention based on the content of the disclosure: For an enabling disclosure, one of skill in the art must be able to make and use the invention with a reasonable expectation of success and not to make and test if the invention actually works. A patent is granted for a completed invention, not the general suggestion of an idea (MPEP 2164.03 and Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1325-26 (Fed. Cir. 2004). Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm. If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov. For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199. /KIMBERLY CHONG/ Primary Examiner Art Unit 1636
Read full office action

Prosecution Timeline

Feb 28, 2022
Application Filed
Aug 22, 2025
Non-Final Rejection — §103, §112
Dec 19, 2025
Response Filed
Jan 14, 2026
Final Rejection — §103, §112
Feb 23, 2026
Examiner Interview Summary
Mar 16, 2026
Request for Continued Examination
Mar 18, 2026
Response after Non-Final Action
Mar 20, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595481
METHODS AND COMPOSITIONS FOR NEUROPROTECTION
2y 5m to grant Granted Apr 07, 2026
Patent 12590307
TRANSLATION ENHANCING NUCLEIC ACID COMPOUNDS: ASO COUPLED TRANSLATION – UPREGULATION 1 (ACT-UP1) AND USES THEREOF
2y 5m to grant Granted Mar 31, 2026
Patent 12571052
Immunomodulatory RNA
2y 5m to grant Granted Mar 10, 2026
Patent 12559750
Methods and Compositions for Treatment of Polycystic Kidney Disease
2y 5m to grant Granted Feb 24, 2026
Patent 12539309
COMPOSITIONS COMPRISING CIRCULAR POLYRIBONUCLEOTIDES AND USES THEREOF
2y 5m to grant Granted Feb 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
72%
Grant Probability
85%
With Interview (+12.5%)
2y 7m
Median Time to Grant
High
PTA Risk
Based on 1473 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month