DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 05/12/2026 has been entered.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Status of Claims
Applicant’s amendment filed 05/12/2026 is acknowledged. Claims 11, 39, and 42 have been amended. Claims 2-3, 5-6, 8, 10, 12-13, 17, 20, 22-23, 26, 30, 33, 38, 43, 46, 48, 50, 54-55, 57, and 61 have been cancelled previously.
Claims 1, 4, 7, 9, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, 44-45, 47, 49, 51- 53, 56, and 58-60 are pending in the instant application and claims 1, 4, 9, 11, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, and 44-45 are the subject of this non-final office action.
New Ground(s) of Rejections
Previous Rejections
Status of Prior Rejections/Objections:
The objection to the specification for trademarks is withdraw; see Specification section below for additional informalities identified.
The 112(b) rejections to claims 39-42 and 44 have been modified in view of the amendments.
The prior art rejection(s) under 35 USC 103 directed to claim(s) 1, 4, 9, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34, 36-37, 39-42, and 44-45 as being unpatentable over Abudayyeh in view of Webster have been modified to clarify the optimization. The rejection of claim 11 has been added. The prior art rejection under 35 USC 103 directed to claim 35 further in view of Myhrvold is maintained. The typographical error reciting “SEQ ID NO: 2671” rather than “SEQ ID NO: 2761” has been corrected.
Each of the double patenting rejections has been withdrawn upon further consideration. See new double patenting rejections over the following to reflect the updated 103 rejection(s) including claim 11. The earlier filing date of the instant relative to ‘292, ‘007, and ‘750 has been noted should these become the only remaining rejections.
Copending application 16/955,380 in view of Abudayyeh and Webster
US patents 10266887 and 11174515 in view of Abudayyeh, Webster, and Myhrvold
Copending applications 16/961,820; 16/973,061; 17/065,504; 17/264,340; 17/294,179; 17/413,802; 17/439,063; 17/761,292; 18/814,007; and 18/906,750 in view of Abudayyeh, Webster, and Myhrvold
The following double patenting rejections have been withdrawn in view of amendments to the copending application:
Copending application 17/495,219 in view of Webster and Myhrvold has been withdrawn in view of the amendment to ‘219.
The following double patenting rejections have been withdrawn and replaced with the corresponding rejection over the following patent, including over claim 11:
Copending application 16/645,571 has been replaced with US 11,898,142 B2 in view of Abudayyeh, Webster, and Myhrvold
Copending application 16/753,896 has been replaced with US 11,633,732 B2 in view of Abudayyeh, Webster, and Myhrvold
All of the amendments and arguments have been reviewed and considered. Any rejections or objections not reiterated herein have been withdrawn in light of amendments to the claims or as discussed in this office action.
Specification
The disclosure is objected to because of the following informalities:
Reference to color drawings was identified in at least para [0026], [0031], and [0037]. No color drawings were submitted.
See also Drawings objections below.
Appropriate correction is required.
Drawings
The drawings were accepted in the office action dated 02/13/2026. However, the following items have been identified. Accordingly, the drawings are objected to because:
Fig. 13 appears to be mislabeled. Para [0037] recites that Fig. 13A and 13D are CcaCas13b. However, Figs. 13A-D are labelled as LwaCas13a and Fig. 13B also labelled additionally as CcaCas13b.
If applicant determines the error is with the drawings, corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Objections
Claim 11 is objected to because of the following informalities:
Claim 11 should be indented to set forth the plurality of elements. See MPEP 608.01(m).
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
Claims 1, 4, 9, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, and 44-45 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, the claim recites “the guide molecule”. There is insufficient antecedent basis for this limitation in the claim. It is not clear how this limitation is intended to apply when more than one guide is selected, i.e., whether the claim is intended to require “each” of the one or more or “at least one” of the one or more is intended to comprise one of the SEQ ID NO.
Claims 4, 9, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, and 44-45 are indefinite for depending from claim 1 and not rectifying the deficiency.
Regarding claim 39-41, the claims recite that the one or more optimized guide molecules are generated using a training model that comprises at least one of a set of features. It is noted that such models (e.g., ML models) are black boxes. While this appears to be a product-by-process limitation, it is not clear what structures beyond what is already limited by claim 1 would be further required by these limitations, if anything. For example, it is not clear whether this is intended to place limitations on flanking sequence(s) (e.g., direct repeat) or to further limit to a subset of SEQ ID NOs of the spacers (see Remarks dated 05/12/2026, pg. 12).
Regarding claim 42, first, the claim recites “optimized guide molecules”. There is insufficient antecedent basis for this limitation in the claim. Claim 1 recites “one or more optimized guide molecules” and it is not clear if claim 42 is intending to only apply to choices of multiple or also the single guide molecules of claim 1.
Second, the claim recites “wherein the optimized guide molecules comprise ... guides selected from a population of candidate guides by identifying guides with an increase in activity relative to the median activity, or selecting guides with the highest guide activity..”.
As with the product-by-process limitations of claims 39-41, it is not clear what structure(s) of the optimized guide molecule this product-by-process functional limitation is intended to limit, if anything, beyond the previously limited structures of claim 1. The disclosure and Remarks (dated 05/12/2026, pg. 12-13) direct the optimization to the choice of the spacer SEQ ID NO, which is previously claimed.
Third, the claim is unclear because the process limitations that define the functional requirement for “highly active” or “highest ... activity” are relative to a population of candidate guides that is undefined/unanchored. Accordingly, a guide may be considered highly active under one comparative “screen” but not highly active under another. Thus, the metes and bounds of the activity requirement would not be clear to one of skill in the art. See also MPEP 2173.05(g) on the requirements of clarity in functional limitations.
Claim 44 is indefinite for depending from claim 42 and not rectifying the deficiency.
Regarding claim 44, the claim recites “each target tested”. There is insufficient antecedent basis for this limitation in the claim.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 4, 14, and 39-42 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Regarding claims 4 and 14, claim 1 recites spacers in (i) or spacer plus direct repeat sequences in (ii). See Remarks (dated 5/12/2026, pg. 12) and Table 1. Each of the spacer portions of the sequences was identified to bind to the cancer fusion gene PML-RARa using NCBI BLAST alignment. No alignment to BCR-ABL fusions for the claimed sequences was identified.
However, claim 4 recites that the cancer fusion gene can also be BCR-ABL and claim 14 recites particular BCR-ABL fusions. Because claim 1 does not include any sequence that target BCR-ABL, claims 4 and 14 broaden claim 1. Therefore, claims 4 and 14 does not further limit the claim upon which it depends.
For this reason, the claims do not comply with the requirements of 112(d).
Regarding claims 39-41, the claims are directed to a method of generating the one or more optimized guide molecules using a training model (claims 39-41) or selecting a population of candidate guides (claim 42-44).
Under the interpretation that the claims are directed to a product-by-process “optimized guide molecules designed to bind to one or more corresponding target molecules ... wherein ... the guide molecule comprises (i) SEQ ID NO ... or ... (ii) SEQ ID NO... “ for the selection/optimization of spacers as part of the guide molecules of claim 1, as described in the Remarks (dated 5/12/2026, pg. 12-13: “machine-learning optimization pipeline to identify and validate ... sequences now recited in claim 1”), further limitations solely directed to the process by which the claimed sequences are generated fail to further limit the claim as they do not impose further structural limitation on the system.
For this reason, the claims do not comply with the requirements of 112(d).
Claim Rejections - 35 USC § 103
Claims 1, 4, 9, 11, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34, 36-37, 39-42, and 44-45 are rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh (WO 2018/107129 A1; published 06/14/2018; as cited in the IDS dated 09/06/2022) in view of Webster (WO 2012/135340 A2; published 10/04/2012).
Regarding claims 1, 4, and 11, Abudayyeh teaches a nucleic acid detection system comprising:
a detection CRISPR system comprising an effector protein and one or more guide
RNAs designed to bind to corresponding target molecules; and
an RNA-based masking construct (claim 1).
Abudayyeh teaches that the effector protein may be the C2c2 [i.e., Cas13a; see para 0006] effector protein (claim 13) LwaCas13a (Example 5 and para [0488]; see also Table 1), and that the one or more guide RNAs are designed to bind to target molecules that are diagnostic for cancer (claim 38). Abudayyeh teaches that the LwC2c2, i.e., LwaCas13a, ortholog had stronger activity than others tested (para [0441]; see para [0451]).
Abudayyeh teaches that its invention may be used to detect genes and mutations associated with cancer, wherein it attempts to incorporate by reference papers related to chronic lymphocytic leukemia [a cancer of white blood cells] (para [0423]; see also para [0141]).
Abudayyeh teaches that the guide RNAs are designed to bind to one or more target molecules comprising cancer specific somatic mutations, wherein the specific mutations may be from a gene selected from BCR-Abl (instant claim 4) and EML4-ALK [i.e., cancer fusion genes] (para [0008]).
Abudayyeh teaches optimization of guide molecules/crRNAs by tiling guides across a target sequence (Fig. 71 and 99; para [0126] and [0515]), wherein LwaCas13a achieved robust/consistent signal detection across different crRNAs spaced across a target (para [0515]), wherein the level of cutting varied by position at lower levels of target nucleic acid for LwaCas13a (Fig. 71) [i.e., such that the artisan would understand guide position to be a results effective variable].
Abudayyeh further teaches LwaCas13a has a slight preference for the PFS flaking the spacer [i.e., the base adjacent to the flanking target sequence] (para [0032] and para [0488]; Fig. 2) [i.e., such that the artisan would understand the PFS preference to further influence the choice/optimization of the target window].
See also para [0482] and [0515] and Fig, 36, 57-58, and 100 for further optimization using mismatches and spacer lengths.
Abudayyeh teaches that the ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay, including assessing preferential cleavage within a target sequence and/or versus a control guide different from the test guide sequence and comparing the rate of cleavage, and that further such assays would occur to those in the art (para [0202]).
Abudayyeh teaches the crRNA sequences of Table 9, including SEQ ID NO: 114, for LwaCas13a (see Table 7 and para [0499]) and that the spacer sequence directed to the target for that test was instant SEQ ID NO: 115. These sequences share the following alignment, represented with the NCBI BLAST conventions for sequence positioning/length:
PNG
media_image1.png
72
836
media_image1.png
Greyscale
The instant specification recites that the direct repeat portion of the guide molecule/crRNA for SEQ ID NO: 3153 is SEQ ID NO: 3155 (instant Table 1, pg. 233), which has been included in the alignment above for the purposes of orientation.
Accordingly, Abudayyeh teaches the direct repeat GGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC for use with LwaCas13a immediately adjacent and 5’/upstream to the spacer (see also Fig. 77 and para [0193]; instant claims 1 [SEQ ID NO in (ii)] and 11 in part).
Regarding claims 9, 39-42, and 44, for the purposes of examination, the claims are being interpreted as a product-by-process under the BRI, particularly in view of the disclosure and Remarks dated 5/12/2026, wherein the optimization may be directed to the SEQ ID NO of the “spacer” chosen and does not further limit the structures of the one or more optimize guide molecules.
Abudayyeh teaches designing/optimizing/selecting robust/optimized crRNAs for LwaCas13a as discussed above in claim 1 (e.g., Fig. 2, 36, 57-58, 71, 91, and 100 and, e.g., para [0202]).
The applicant is advised that product-by-process claims are not limited to the manipulations of the recited steps, only the structures implied by the steps, for the purposes of examination. See MPEP 2113.
Regarding claim 15, Abudayyeh teaches that the RNA-based masking construct comprises a silencing RNA that suppresses generation of a gene product encoded by a reporting construct, wherein the gene product generates the detectable positive signal when expressed (para [0013]).
Regarding claim 16, Abudayyeh teaches that the RNA-based masking construct is a ribozyme that generates the negative detectable signal, and wherein the positive detectable signal is generated when the ribozyme is deactivated, or the ribozyme converts a substrate to a first color and wherein the substrate converts to a second color when the ribozyme is deactivated (para [0014]).
Regarding claim 18, Abudayyeh teaches that the RNA-based masking agent is an RNA aptamer (para [0015]).
Regarding claim 19, Abudayyeh teaches that the RNA-based masking agent is an RNA aptamer, or the aptamer sequesters an enzyme, wherein the enzyme generates a detectable signal upon release from the aptamer by acting upon a substrate, or the aptamer sequesters a pair of agents that when released from the aptamers combine to generate a detectable signal (para [0015]).
Thus, Abudayyeh teaches at least that the aptamer sequesters a pair of agents, one of which may be an enzyme, that when released from the aptamers combine to generate a detectable signal (para [0015]).
Regarding claim 21, Abudayyeh teaches that an existing aptamer that inhibits an enzyme with a colorimetric readout is used, such as thrombin, protein C, neutrophil elastase, and subtilisin (para [0224]).
Regarding claim 24 and 31, Abudayyeh teaches that the masking construct may comprise an RNA oligonucleotide to which are attached a detectable label and a masking agent of that detectable label (para [0230]; instant claim 24). Abudayyeh also teaches that the RNA-based masking construct comprises an RNA oligonucleotide to which a detectable ligand and a masking component are attached, wherein the detectable ligand may be a fluorophore and the masking component may be a quencher (para [0016]; instant claims 24 and 31).
Regarding claim 25, Abudayyeh teaches that RNA-based masking construct comprises a nanoparticle held in aggregate by bridge molecules, wherein at least a portion of the bridge molecules comprises RNA, and wherein the solution undergoes a color shift when the nanoparticle is disbursed in solution, wherein nanoparticle is a colloidal metal (claim 29).
Regarding claim 27, Abudayyeh teaches that the masking construct may comprise one or more RNA oligonucleotides to which are attached one or more metal nanoparticles, such as gold nanoparticles (para [0231]).
Regarding claim 28, Abudayyeh teaches that the masking construct may comprise a quantum dot, wherein quantum dot may have multiple linker molecules attached to the surface; at least a portion of the linker molecule comprises RNA; and the linker molecule is attached to the quantum dot at one end and to one or more quenchers along the length or at terminal ends of the linker such that the quenchers are maintained in sufficient proximity for quenching of the quantum dot to occur (para [0233]).
Regarding claim 29, Abudayyeh teaches that the masking construct comprises the use of intercalating dyes which change their absorbance in response to cleavage of long RNAs to short nucleotides, wherein such dyes include pyronine-Y and methylene blue (para [0235]).
Regarding claim 32, Abudayyeh teaches that the masking construct comprises an RNA oligonucleotide designed to bind a G-quadruplex forming sequence, wherein a G-quadruplex structure is formed by the G-quadruplex forming sequence upon cleavage of the masking construct, and wherein the G-quadruplex structure generates a detectable positive signal (claim 93), wherein such G-quadraplexes in DNA can complex with heme to form a DNAzyme with peroxidase activity (para [0226]).
Regarding claim 34, Abudayyeh teaches that the RNA-based masking construct comprises an RNA oligonucleotide with a detectable ligand on a first end of the RNA oligonucleotide and a masking component on a second end of the RNA oligonucleotide (para [0029]). Abudayyeh teaches the reporter constructs of Table 5 that comprise a 5’ fluorophore and a 3’ antigen/quencher.
It is noted that, broadly interpreted, a nucleotide is “a group of atoms bonded together” and so any unmodified oligonucleotide also would be encompassed by this limitation. Therefore, Abudayyeh, as previously cited, teaches all of the previously discussed RNA-based masking constructs (i.e., aptamers, ribozymes, quantum dot on an RNA linker, etc.).
Regarding claims 36 and 37, Abudayyeh, as cited in the rejection of claim 1, teaches that the Cas protein is a Cas13. Instant claim 37 teaches that Cas13 is a species of Type VI Cas.
Regarding claim 45, Abudayyeh teaches a one-pot system with RPA and C2c2 [Cas13a] detection, comprising reagents for each (para [0464]). Abudayyeh teaches that the RPA amplifies target molecules (Fig. 17).
Abudayyeh teaches that detection technologies that provide high specificity and sensitivity at low cost would be of great utility in both clinical and basic research settings (para [0003]).
Abudayyeh fails to explicitly teach:
that the cancers detected are selected from APML, CML, and/or ALL (claim 1);
the SEQ IDs of the guide molecules/the specific genes targeted are those of the claimed SEQ ID NOs (claims 1 and 11), including specific gene fusions of BCR-ABL (claim 14);
that the ribozyme performs both the negative to positive and the color conversion (claim 16);
Webster teaches diagnosing cancer (entire document, e.g., title), wherein when a fusion gene is detected the subject is diagnosed with leukemia or a specific subtype (para [15]). Webster teaches that the leukemia can be chronic myelogenous leukemia, acute myeloid leukemia or acute lymphoblastic leukemia (para [14]; instant claim 1).
Webster teaches the BRC-ABL is a known fusion gene in leukemia, and is correlated with the onset and progression of various types of leukemia (para [04]).
Webster further teaches that recurrent chromosomal translocations characterize a substantial proportion of leukemias, resulting in the formation of unique fusion genes, wherein the identification of particular fusion gene abnormalities is of considerable diagnostic and prognostic importance, and that there is a need in the art for reliable diagnostic compositions for the detection and diagnosis of leukemias and sub-types of leukemias based on gene fusion (para [03]).
Webster teaches targeting sequences that are the junction of where the two genes are fused (para [07]).
Webster teaches “target sequences” for such diagnosis including SEQ ID NO: 198, which comprises at least SEQ ID NO: 2761 and the identical sequences SEQ ID NO: 3154 and 3190, and is directed to a fusion gene isoform of PML-RARA (Table 2; instant claim 4). As disclosed in the specification, SEQ ID NO: 3153 and 3189 respectively comprise SEQ ID NO: 3154 and 3190 as the spacer of the guide molecule/crRNA (instant Table 1; instant claim 11).
PNG
media_image2.png
135
541
media_image2.png
Greyscale
In the above alignment, the query (Qy) sequence corresponds to the instant SEQ ID NO: 2761 (and identical sequences, SEQ ID NO: 3154 and 3190, corresponding to the spacers of SEQ ID NO: 3153 and 3189; instant claims 1 and 11; see Table 1) and the database (Db) sequence corresponds to Webster SEQ ID NO: 198.
For the sake of compact prosecution, it further is noted that Webster also teaches at least SEQ ID NO: 201 and 204 directed to other fusion gene isoforms of PML-RAR and BCR-Abl targets SEQ ID NO: 138, 141, 144, 147, 150, 153, and 156.
Webster teaches BCR-ABL targets corresponding to b2a2 (SEQ ID NO: 138), b3a2 (SEQ ID NO: 141), and e1a2 (SEQ ID NO: 144) in Table 2 (instant claim 14).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to utilize the nucleic acid detection system for cancer using crRNAs targeting cancer fusion genes of Abudayyeh to detect the cancer fusion gene targets of Webster and to use the methods of optimization of guide RNAs of Abudayyeh to apply the system to such targets. The artisan would have been so motivated by Webster’s teachings of the diagnostic and prognostic importance for said cancers, and the need in the art for reliable diagnostic compositions for the detection and diagnosis of leukemias and the teaching of Abudayyeh to create robust/consistent and specific signals for such a system.
In routinely optimizing the spacer/guide sequence window of the crRNA across the target sequences of Webster, as taught by Abudayyeh, there would have been a reasonable expectation of success to have arrived at the spacer of at least SEQ ID NO: 2761/3154/3190 given that various techniques and preferences of the Cas are taught by Abudayyeh, which further teaches that such methods would be known to the artisan, as the precise window of the spacer would be recognized as a results effective variable by the artisan. See MPEP 2144.05(II).
It further would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to utilize the direct repeat taught for LwaCas13a in the guide molecule/crRNA of the system to construct the guide molecule such that the entire guide would comprise the SEQ ID NO: 2760/3153/3189 (instant claim 11), motivated by the teachings of Abudayyeh that its RNA targeting effectors provide a robust CRISPR-based diagnostic (Abstract).
In so far as the high activity alternatively may be interpreted as a structural limitation, for the sake of compact prosecution, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have chosen whichever of the spacers displayed high/highest activity as Abudayyeh teaches evaluating cleavage/cleavage rate and comparing the binding rate of the test guide to that of a control guide and performing tiling assays. The artisan would have been so motivated by the desire to optimize the system, i.e., to improve the sensitivity and specificity of such a detection system, as taught by Abudayyeh.
Because Abudayyeh teaches that the ribozyme separately performs the negative to positive and the color conversion, it would have been obvious to the ordinary artisan before the effective filing date of the claimed invention to combine these as each element is taught. The artisan would be motivated by the desire to improve the sensitivity and specificity of such a detection system, as taught by Abudayyeh. There would be a strong expectation for success as both elements are taught for ribozymes in similar systems.
There would have been a strong expectation of success in applying the CRISPR-Cas system of Abudayyeh to the targets of Webster as Abudayyeh contemplates designing for targets diagnostic of a disease, including cancer specific mutations such as the cancer fusion found in leukemias BCR-Abl, as taught by Webster, and both are directed to nucleic acid detection.
The applicant is advised that product-by-process limitations are not limited to the manipulations of the recited steps (i.e., “optimized” or “top predicted”), only the structures implied by the steps for the purposes of examination. See MPEP 2113.
Claim 35 is rejected under 35 U.S.C. 103 as being unpatentable over Abudayyeh (WO 2018/107129 A1; published 06/14/2018; as cited in the IDS dated 09/06/2022) in view of Webster (WO 2012/135340 A2; published 10/04/2012) applied to claim 1 above, and further in view of Myhrvold (Myhrvold C, et al. Field-deployable viral diagnostics using CRISPR-Cas13. Science. 2018 Apr 27;360(6387):444-448.).
Regarding claim 35, in the system of Abudayyeh in view of Webster, Abudayyeh teaches a masking construct that binds to an immobilized reagent and that a labeled binding partner may be biotin and that the label on the binding partner may be any detectable label known in the art (para [0220]) but fails to teach specific fluorophores.
Myhrvold rectifies this by teaching the LF-polyU reporter comprising 5’FAM and 3’Bio [i.e., biotin] (Supplementary Material, pg. 62), used in lateral flow experiments of Fig. 2 and Fig. 4.
Myhrvold teaches that their direct detection with a colorimetric readout using lateral flow strips can directly detect their target from bodily fluids with minimal equipment (pg. 1, col 3, para 2, spanning pg. 3). Myhrvold teaches that their platform is field-deployable with high performance, is sensitive and specific, and can be easily adapted and scaled to enable multiplexed detection (pg. 5, col 1, para 1).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the masking construct of Abudayyeh for the LF-polyU reporter and lateral flow detection of Myhrvold, motivated by the desire to enable sensitive and specific field-deployable detection that requires minimal equipment, as taught by Myhrvold. There would have been a strong expectation for success as both are directed toward detection techniques with CRISPR-Cas13.
Double Patenting
Claims 1, 4, 9, 11, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, and 44-45 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 26, 29, 34, 39-40, 43, 47, 49-50, 71, 106, 109-112, 115-116, 129-136, 137-138, 140-155, 165-168, and 172 of copending Application No. 16/955,380 in view of Abudayyeh (WO 2018/107129 A1; published 06/14/2018; as cited in the IDS dated 09/06/2022) and Webster (WO 2012/135340 A2; published 10/04/2012).
Both sets of claims are drawn to a nucleic acid detection system comprising two or more CRISPR systems, each CRISPR system comprising a Cas protein (that may be a Cas13a derived from Leptotrichia) and one or more guide molecules (that can be a LwaCas13a/L. wadei C2c2 protein) capable of binding a corresponding target nucleic acid and design to form a complex with one or more Cas proteins; and a set of detection [i.e., masking] constructs. ‘380 claim 154 recites that the guide polynucleotides are designed to bind to one or more target sequences that are diagnostic for a disease state, wherein the disease state is a cancer.
Any additional limitations of the ‘380 patent are encompassed by the open claim language “comprising” found in the instant claims. As in the 103, see claim interpretation for discussion of the product-by-process limitations.
The claims of ‘380 do not discuss:
That the target is a gene fusion, particular cancers, or particular sequences (instant claims 1 and 11), and particular BCR-ABL fusion targets (claim 14)
As discussed and cited in the 103 rejection above, Abudayyeh teaches:
a direct repeat sequence comprising that which is claimed (claims 1 and 11);
optimization including tiling (claims 1, 11, 42, and 44).
Abudayyeh teaches that detection technologies that provide high specificity and sensitivity at low cost would be of great utility in both clinical and basic research settings (para [0003]).
Abudayyeh teaches that its RNA targeting effectors provide robust CRISPR-based diagnostic with attomolar sensitivity and that its embodiments can be prepared in freeze-dried format for convenient distribution and point-of-care (POC) applications (Abstract). Abudayyeh teaches that the sensitivity of its invention may allow for noninvasive detection of clonal mutations arising during [cancer] treatment and can be used to detect a recurrence in the disease (para [0425])
As discussed and cited in the 103 rejection above, Webster teaches:
that the cancers APML, CML, and ALL as detection targets (claim 1);
the gene fusion targets for diagnosing these leukemias including PML-RARA and “target” sequences comprising instant claimed SEQ ID NOs (claims 1 and 4);
particular BCR-ABL fusions including the b2a2 fusion (claim 14).
Webster teaches the BRC-ABL is a known fusion gene in leukemia, and is correlated with the onset and progression of various types of leukemia (para [04]).
Webster teaches that recurrent chromosomal translocations characterize a substantial proportion of leukemias, resulting in the formation of unique fusion genes, wherein the identification of particular fusion gene abnormalities is of considerable diagnostic and prognostic importance, and that there is a need in the art for reliable diagnostic compositions for the detection and diagnosis of leukemias and sub-types of leukemias based on gene fusion (para [03]).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the nucleic acid detection system of ‘380 with the targets, i.e., leukemias, gene fusion targets, and sequences, of Webster, wherein it further would have been obvious to utilize the optimization for selecting a spacer and combined with the direct repeat of Abudayyeh, motivated by the considerable diagnostic and prognostic importance of the uniqueness of the fusion genes and the need in the art for reliable diagnostic compositions for the detection and diagnosis of leukemias, as taught by Webster, and the desire to create detection technologies that provide high specificity and sensitivity at low cost, as taught by Abudayyeh. There would be a strong expectation for success as the gene targets already overlap and each are directed to nucleic acid detection technologies.
Claims 1, 4, 9, 11, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, and 44-45 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following patents and claims in view of Abudayyeh (WO 2018/107129 A1; published 06/14/2018; as cited in the IDS dated 09/06/2022), Webster (WO 2012/135340 A2; published 10/04/2012), and Myhrvold (Myhrvold C, et al. Field-deployable viral diagnostics using CRISPR-Cas13. Science. 2018 Apr 27;360(6387):444-448; as cited in the IDS dated 10/27/2022).
Patent:
Rejected over Application Claims:
Fails to recite:
Other notes:
10266887
1-14
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene • Cancer detected is a leukemia
Method that teaches the system limitations renders the system obvious
11174515
1-29, 31-32, 36-43, 56-60
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene (guides may be diagnostic for cancer, e.g., claim 28); • Cancer detected is a leukemia
Instant claims teach BCR-Abl a cancer fusion gene; A fusion is interpreted to be a type of mutation; Method that teaches the system limitations renders the system obvious
11633732
1-4, 6, 9, 12, 15, 21-22, 24, 26, 48-49, 55-57, 59, 64-65
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene (guides may be diagnostic for cancer; claim 26); • Cancer detected is a leukemia
Lateral flow device comprises a system with the claimed components
11898142
1-4, 7, 9-10, 15, 17, 20, 23, 25-26, 30-31, 35-36, 39, 41, 44, 46, 49, 69, 72, 74-75, 77-78, 81, 102, 105, 108, 111-114
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene (guides may be diagnostic for cancer; claim 47); • Cancer detected is a leukemia
A subset of the claims are a detection device that comprise a system with the claimed components
As discussed and cited in the 103 rejection above, Abudayyeh teaches:
a direct repeat sequence comprising that which is claimed and selecting LwaCas13a (claims 1 and 11);
optimization including tiling (claims 1, 11, 42, and 44);
the sets of masking constructs (claims 15-16, 18-19, 21, 24-25, 27-29, 31-32, and 34);
the design of guides toward cancer fusion genes by teaching BCR-ABL (claim 4).
Abudayyeh also teaches use of an RNA-based masking construct with an RNA targeting effector [Cas] (Fig. 7) and that Cas13/type IV Cas are RNA-targeting enzymes (para [0511]; [0520]).
Abudayyeh teaches that detection technologies that provide high specificity and sensitivity at low cost would be of great utility in both clinical and basic research settings (para [0003]).
Abudayyeh teaches that its RNA targeting effectors provide robust CRISPR-based diagnostic with attomolar sensitivity and that its embodiments can be prepared in freeze-dried format for convenient distribution and point-of-care (POC) applications (Abstract). Abudayyeh teaches that the sensitivity of its invention may allow for noninvasive detection of clonal mutations arising during [cancer] treatment and can be used to detect a recurrence in the disease (para [0425])
As discussed and cited in the 103 rejection above, Webster teaches:
that the cancers APML, CML, and ALL as detection targets (claim 1);
the gene fusion targets for diagnosing these leukemias including PML-RARA and “target” sequences comprising instant claimed SEQ ID NOs (claims 1 and 4);
particular BCR-ABL fusions including the b2a2 fusion (claim 14).
Webster teaches the BRC-ABL is a known fusion gene in leukemia, and is correlated with the onset and progression of various types of leukemia (para [04]).
Webster teaches that recurrent chromosomal translocations characterize a substantial proportion of leukemias, resulting in the formation of unique fusion genes, wherein the identification of particular fusion gene abnormalities is of considerable diagnostic and prognostic importance, and that there is a need in the art for reliable diagnostic compositions for the detection and diagnosis of leukemias and sub-types of leukemias based on gene fusion (para [03]).
As discussed and cited in the 103 rejection above, Myhrvold teaches:
the sets of masking constructs by teaching a reporter with FAM and BIO (claim 25).
Myhrvold teaches that their direct detection with a colorimetric readout using lateral flow strips can directly detect their target from bodily fluids with minimal equipment (pg. 1, col 3, para 2, spanning pg. 3). Myhrvold teaches that their platform is field-deployable with high performance, is sensitive and specific, and can be easily adapted and scaled to enable multiplexed detection (pg. 5, col 1, para 1).
Therefore, it would have been obvious to one the ordinary skill in the art before the effective filing date of the claimed invention to combine either of the above patents with Abudayyeh and/or substitute the masking constructs of the above patents with those of Abudayyeh and to select the obvious species of LwaCas13a given the teachings of Abudayyeh. It further would have been obvious to choose RNA-based masking constructs given a Cas13 and/or type VI Cas given the teachings of Abudayyeh in the combined method. The artisan would have been so motivated by the desire to create a robust and sensitive POC system to test for mutations throughout cancer treatment, as taught by Abudayyeh.
It also would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the masking constructs of Abudayyeh in the combination for the LF-polyU reporter and lateral flow detection of Myhrvold, motivated by the desire to enable sensitive and specific field-deployable detection that requires minimal equipment, as taught by Myhrvold.
There would have been a strong expectation for success as all are directed to nucleic acid detection and at least Abudayyeh teaches methods for constructing and optimization of such systems.
It is noted that devices, kits, and/or compositions comprising a system with all of the claimed features anticipate the system and/or render it obvious when comprising a sufficient number of features modified as described.
It is also held to be obvious to look at other elements within the same claim set, motivated by the desire to improve the method with a strong expectation of success as the inventions are directed to CRISPR-Cas systems and/or use thereof.
Claims 1, 4, 9, 11, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, and 44-45 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following copending Applications in view of Abudayyeh (WO 2018/107129 A1; published 06/14/2018; as cited in the IDS dated 09/06/2022), Webster (WO 2012/135340 A2; published 10/04/2012), and Myhrvold (Myhrvold C, et al. Field-deployable viral diagnostics using CRISPR-Cas13. Science. 2018 Apr 27;360(6387):444-448; as cited in the IDS dated 10/27/2022.). This is a provisional nonstatutory double patenting rejection.
Copending Application:
Rejected over Application Claims:
Fails to recite:
Other notes:
16961820
1-5, 10, 12-13, 17, 19-20, 39-40, 45-47, 49, 51, 54, 56, 69-72, 76
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene (guides may be diagnostic for cancer; claim 20); • Cancer detected is a leukemia
16973061
61-62, 64, 66, 68-69, 71, 73-74, 78, 80, 86-89
• The full set of masking constructs and that the masking construct is RNA-based; • Target of configured/designed guide is cancer fusion gene; • Cancer detected is a leukemia
17065504
1, 5, 21, 26, 28, 31-34, 36-37, 40-41, 48, 50, 52
• The full set of masking constructs and that the masking construct is RNA-based; • Target of configured/designed guide is cancer fusion gene (guides may be diagnostic for cancer; claim 52); • Cancer detected is a leukemia; • Amplification reagents
17264340
331, 384, 389, 393
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene; • Cancer detected is a leukemia; • Specific amplification system reagents
Method that teaches the system limitations renders the system obvious
17294179
1-2, 5, 8, 10, 12, 19, 29-34, 40-41, 44-45, 47, 59-63
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene; • Cancer detected is a leukemia
Method that teaches the system limitations renders the system obvious
17413802
1, 115-128, 130-132
• The full set of masking constructs and that the masking construct is RNA-based; • Target of configured/designed guide is cancer fusion gene; • Cancer detected is a leukemia
17439063
1, 3-7, 9-15, 17-23, 25-30, 33-35
• The full set of masking constructs; • Cancer detected is a leukemia; • Specific BCR-Abl targets
Detection construct interpreted to be a masking construct; Method that teaches the system limitations renders the system obvious; Instant claims teach BCR-Abl and PML-RARA as cancer fusion genes
17761292
1-2, 7-8, 13, 19, 22, 52, 76-77, 80, 82, 85
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene; • Cancer detected is a leukemia
Method that teaches the system limitations renders the system obvious
18814007
1-2, 5, 7-10, 13, 15-16, 21, 25-26, 33, 35-36
• The full set of masking constructs; • Target of configured/designed guide is cancer fusion gene; • Cancer detected is a leukemia
18906750
1-4, 6-8, 17-18, 21-23-25, 29, 31, 33
• The full set of masking constructs and that the masking construct is RNA-based; • Target of configured/designed guide is cancer fusion gene; • Cancer detected is a leukemia; • Lwa2Cas13a guide
As discussed and cited in the 103 rejection above, Abudayyeh teaches:
a direct repeat sequence comprising that which is claimed and selecting LwaCas13a (claims 1 and 11);
optimization including tiling (claims 1, 11, 42, and 44);
the sets of masking constructs (claims 15-16, 18-19, 21, 24-25, 27-29, 31-32, and 34);
the design of guides toward cancer fusion genes by teaching BCR-ABL (claim 4).
Abudayyeh teaches use of an RNA-based masking construct with an RNA targeting effector [Cas] (Fig. 7) and that Cas13/type IV Cas are RNA-targeting enzymes (para [0511]; [0520]).
Abudayyeh teaches that its RNA targeting effectors provide robust CRISPR-based diagnostic with attomolar sensitivity and that its embodiments can be prepared in freeze-dried format for convenient distribution and point-of-care (POC) applications (Abstract). Abudayyeh teaches that the sensitivity of its invention may allow for noninvasive detection of clonal mutations arising during [cancer] treatment and can be used to detect a recurrence in the disease (para [0425])
As discussed and cited in the 103 rejection above, Webster teaches:
that the cancers APML, CML, and ALL as detection targets (claim 1);
the gene fusion targets for diagnosing these leukemias including PML-RARA and “target” sequences comprising instant claimed SEQ ID NOs (claims 1 and 4);
particular BCR-ABL fusions including the b2a2 fusion (claim 14).
Webster teaches the BRC-ABL is a known fusion gene in leukemia, and is correlated with the onset and progression of various types of leukemia (para [04]).
Webster teaches that recurrent chromosomal translocations characterize a substantial proportion of leukemias, resulting in the formation of unique fusion genes, wherein the identification of particular fusion gene abnormalities is of considerable diagnostic and prognostic importance, and that there is a need in the art for reliable diagnostic compositions for the detection and diagnosis of leukemias and sub-types of leukemias based on gene fusion (para [03]).
As discussed and cited in the 103 rejection above, Myhrvold teaches:
the sets of masking constructs by teaching a reporter with FAM and BIO (claim 25).
Myhrvold teaches that their direct detection with a colorimetric readout using lateral flow strips can directly detect their target from bodily fluids with minimal equipment (pg. 1, col 3, para 2, spanning pg. 3). Myhrvold teaches that their platform is field-deployable with high performance, is sensitive and specific, and can be easily adapted and scaled to enable multiplexed detection (pg. 5, col 1, para 1).
Therefore, it would have been obvious to one the ordinary skill in the art before the effective filing date of the claimed invention to combine either of the above patents with Abudayyeh and/or substitute the masking constructs of the above patents with those of Abudayyeh and to select the obvious species of LwaCas13a given the teachings of Abudayyeh. It further would have been obvious to choose RNA-based masking constructs given a Cas13 and/or type VI Cas given the teachings of Abudayyeh in the combined method. The artisan would have been so motivated by the desire to create a robust and sensitive POC system to test for mutations throughout cancer treatment, as taught by Abudayyeh.
It also would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the masking constructs of Abudayyeh in the combination for the LF-polyU reporter and lateral flow detection of Myhrvold, motivated by the desire to enable sensitive and specific field-deployable detection that requires minimal equipment, as taught by Myhrvold.
There would have been a strong expectation for success as all are directed to nucleic acid detection and at least Abudayyeh teaches methods for constructing and optimization of such systems.
It is noted that devices, kits, and/or compositions comprising a system with all of the claimed features anticipate the system and/or render it obvious when comprising a sufficient number of features modified as described.
It is also held to be obvious to look at other elements within the same claim set, motivated by the desire to improve the method with a strong expectation of success as the inventions are directed to CRISPR-Cas systems and/or use thereof.
Response to Arguments
Applicant's arguments filed 05/12/2026 have been fully considered but they are not persuasive.
Applicant argues that Webster’s 76-nucleotide sequence is a DNA sequence and is a different molecular species with different chemical compositions, lengths, and fundamentally different functional roles than the instant claimed 28-nucleotide spacer sequences of claim 1 [in (i)]. Applicant argues that Webster discloses a hybridization-based detection platform, wherein the signal arises from reading the fluorescent barcode not from enzymatic activity and makes not reference to CRISPR, Case13, guide RNAs, collateral cleavage, or masking constructs. Applicant argues that the spacer sequences have no counterpart in Webster’s probe design and alleges the Office Action has failed to explain why the skilled artisan would look to a DNA hybridization probe optimized for passive thermodynamic stability as a source for RNA sequences optimized for CRISPR effector activation, as such is not one of degree but of molecular identity.
In response to applicant's argument that Webster is nonanalogous art, it has been held that a prior art reference must either be in the field of the inventor’s endeavor or, if not, then be reasonably pertinent to the particular problem with which the inventor was concerned, in order to be relied upon as a basis for rejection of the claimed invention. See In re Oetiker, 977 F.2d 1443, 24 USPQ2d 1443 (Fed. Cir. 1992). In this case, Webster is directed to reliable diagnostic compositions for the detection and diagnosis of leukemias and sub-types of leukemias based on gene fusion (para [03]) by targeting gene fusions that overlap with those of the inventor (Table 2).
Regarding the arguments that the 76-nt sequence of Webster is DNA, it is noted that Webster teaches this “target sequence” as RNA (as demonstrated by the presence of “U” in the sequence in the context of “gene isoform”) in Table 2, which was previous cited. Webster is cited for teaching targets relevant in reliable diagnostic composition for the detection and diagnosis of leukemia based on gene fusion, which Abudayyeh is also concerned with. Further, Abudayyeh teaches the design of spacers complementary to targets, such that the artisan would look to Abudayyeh for the molecule type of the guide molecule.
Likewise, in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Applicant alleges that, even if the artisan would look to Webster, the Office Action has not identified which window corresponds to the claimed sequences nor explained why the skilled artisan would select any particular window over the remaining 48 others possible. Applicant argues that not all guide sequences complementary to a target achieve equivalent collateral cleavage for LwaCas13a and that the Office Action does not provide any evidence that a particular window achieves the claimed level of activity.
Regarding the arguments directed to the window, the sequence alignment, as previously cited, identifies the position within the sequence of Webster. An explanation for the abbreviations had been added to clarify the identify each sequence in the rejection. The optimization of the window within this target sequence as results effective variable has been further clarified in the rejection. Abudayyeh teaches such “tiling” including that the level of fluorescence may be dependent on the position (e.g., Fig. 71), such the artisan would understand the position of the spacer within a putative target sequence region to be a results effective variable.
Where applicant refers to the claimed “activity level”, as has been discussed in the interpretation, the optimization is interpreted to be a product-by-process that could be met by the sequences as claimed. Claims 42 and 44 alternatively may be interpreted to recite a functional limitation directed to the activity level that may subset the sequences, but lack sufficient bounds to ground the relative activity. Further, it is noted that while the process does not clearly require a structure as claimed, in performing the routine optimization of Abudayyeh, the artisan would be expected to be optimizing for activity (see Fig. 71, para [0098] wherein targeting is interpreted as “activity”; see also para [0202]). This has been clarified in the rejection.
Applicant further argues that a subset of spacer sequences recited in claim 1, namely, SEQ ID NO: 2821-2887 have minimal overlap with SEQ ID NO: 198 of Webster.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., requirement of use of SEQ ID NO: 2821-2887) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The claims do not require use of spacers SEQ ID NO: 2821-2887. The claims recite “or”. For the sake of compact prosecution, it is also noted that Webster also teaches target sequence SEQ ID NO: 201 (Table 2), to which each of SEQ ID NO: 2821, 2824, ..., 2887 aligns (data not shown).
Applicant’s arguments, see pg. 16 with respect to the rejection(s) of claim(s) 1, 4, 9, 14-16, 18-19, 21, 24-25, 27-29, 31-32, 34-37, 39-42, and 44-45 under the double patenting rejections that did not clearly articulate the optimization of the spacer sequence, particularly 16/955,380 in view of Webster alone have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection has been made in view of to reflect the optimizations including tiling of such CRISPR-Cas spacers taught by Abudayyeh and the combination with direct repeats (claim 11 and claim 1 SEQ ID NO in (ii)).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Emma R Hoppe whose telephone number is (703)756-5550. The examiner can normally be reached Mon - Fri 11:00 am - 7:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571) 272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EMMA R HOPPE/Examiner, Art Unit 1683
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights