Prosecution Insights
Last updated: August 16, 2026
Application No. 17/640,466

METHODS OF IMPROVING SEED SIZE AND QUALITY

Non-Final OA §102§103§112
Filed
Mar 04, 2022
Priority
Sep 05, 2019 — CN PCT/CN2019/104566 +1 more
Examiner
WILLIAMS, KEITH RICHARD
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Lnstitute Of Genetics And Developmental Biology Chinese Academy Of Sciences
OA Round
4 (Non-Final)
42%
Grant Probability
Moderate
4-5
OA Rounds
0m
Est. Remaining
42%
With Interview

Examiner Intelligence

Grants 42% of resolved cases
42%
Career Allowance Rate
5 granted / 12 resolved
-18.3% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 4m
Avg Prosecution
37 currently pending
Career history
46
Total Applications
across all art units

Statute-Specific Performance

§101
16.6%
-23.4% vs TC avg
§103
31.0%
-9.0% vs TC avg
§102
11.8%
-28.2% vs TC avg
§112
38.0%
-2.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 12 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims The amendments submitted on June 12, 2025 have been entered. New claims 50-55 have been added. New claim 50 (and claims 51-55 dependent therefrom) are directed to a species (of SEQ ID NO:1) that was previously presented and was not elected by Applicant; see Applicant’s response to the Restriction/Election requirement dated 03/20/2024, page 7, penultimate paragraph. Applicant is reminded that different nucleotide sequences and different amino acid sequences are structurally distinct chemical compounds, and are thus deemed to normally constitute different inventive concepts. Since Applicant has received an action on the merits for the originally presented invention, this invention has been constructively elected by original presentation for prosecution on the merits. See 37 CFR § 1.142(b) and MPEP § 821.03. Claims 1, 4, 8, 11, 14, 17, 24, 26-28, 33, and 46-55 are pending. Claims 1, 4, 8, 11, 14, 27-28, 33, 46, and 50-55 are withdrawn from consideration. Claims 17, 24, 26, and 47-49 are examined in this Office action. Status of Objections and Rejections All previous objections and rejections not set forth below have been withdrawn in view of Applicant’s amendments and/or upon further consideration. The text of those sections of Title 35 U.S. Code, not included in this action, can be found in a prior Office action. Claim Objections New claims 53-55 recite capitalized ”Maize”, “Barley”, and “Wheat”, respectively; which is grammatically awkward. It is suggested to replace these nouns with ---wheat---, ---barley, and ---maize---, respectively. Appropriate correction is required. Claim Rejections - 35 USC § 112(a) Written Description Claims 17, 24, 26, and 47-49 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. All dependent claims are included in these rejections unless they contain a limitation that overcomes the deficiencies of the parent claim from which they depend. This is a new rejection necessitated by the claim amendments. The amended claims are broadly drawn to a genetically altered plant that expresses a nucleic acid sequence encoding an Amino Acid Transporter (AAP) protein having at least 80% sequence identity to any one of SEQ ID NOs: 2, 3, or 4; or variants thereof having at least one (but unspecified maximum) of mutations in the sequence at a position in a motif defined by SEQ ID NO:167,wherein the plant is characterized by increased expression or activity of the polypeptide, wherein the plant produces larger and heavier seeds, and wherein the plant is not Arabidopsis. Furthermore, claim 49 has been amended to recite all possible unspecified functional variants or homologs of SEQ ID NOs: 2, 3, or 4. The specification defines the term “genetically altered” as encompassing plants which are altered compared to the naturally occurring wild type (WT) plant, including those which are gene edited or transgenic (Pg. 10 Line 33 – Pg. 11 Line 10). The specification describes that increases in activity encompass increases in gene expression of the nucleic acid encoding the claimed amino acid permeases (Pg. 3, Lines 6-16). The specification describes just a single allele in the Arabidopsis thaliana AAP8 protein which confers an increased activity—a valine to alanine substitution at position 410 of SEQ ID NO:1 (Pg. 39, Lines 17-27; Figures 8, 11). Thus, the specification does not describe species within the full scope of the claimed AAP (or AAP8) proteins, and thus does not describe a representative number of species within the claimed genus of plants which have increased activity of an AAP (or AAP8) polypeptide or increased activity of a homolog of an AAP (or AAP8) polypeptide. The specification broadly describes that AAP8 proteins comprise an “Aa_trans” motif which is characteristic of amino acid transporter proteins; the length of this generally described domain is nearly the entire length of the AAP8 protein (Figure 3; Page 7 Lines 9-27; SEQ ID NO: 168). Similar to the reports published prior to the filing date of the instant invention, the specification describes that plants having loss of function mutations in AAP8 had reduced seed yield and increased seed abortion (Page 37 Line 25 – Pg. 38 Line 2; Figure 3). The specification describes only one specific substitution, which is just a single allele, related to an increase in function in AAP8 protein, corresponding to a valine to alanine substitution at position 410 of SEQ ID NO:1 (Pg. 39 Lines 17-27; Figures 8, 11). The specification also provides the corresponding position of this substitution in other amino acid permease proteins (Figure 12). However, it is not known if such a substitution would confer the function of increasing the activity of any possible AAP protein. Furthermore, this example of a single amino acid substitution which increases the activity of a single AAP8 protein does not provide an understanding of the common structural and functional features of all AAP (including all AAP8) proteins which may have increased function. The specification fails to make up for the lack of knowledge on the art at the time of filing. There is no description in the specification of how the structure of AAPs (including AAP8) known in the art and described in the instant specification relates to the structure of unspecified variants of AAP (or AAP8) which may have increased activity. No motifs or domains that are necessary and sufficient structural elements to confer increased activity to an AAP (or AAP8) protein are described in the specification. As extensively described in the Office action mailed 06/03/2024, the structure-function relationship of AAP8 proteins with increased activity was not established in the art after the time of filing. The Federal Circuit has clarified the application of the written description requirement to inventions in the field of biotechnology. The court stated that “[a] description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus.” University of California v. Eli Lilly and Co., 119 F. 3d 1559; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). The claims recite a nucleic acid sequence encoding an AAP protein having at least 80% sequence identity to any one of SEQ ID NOs: 2, 3, or 4; or variants thereof having at least one (but unspecified maximum) of mutations in the sequence, that, when expressed in a plant, produces larger and heavier seeds. For example, describing and reducing to practice a genus of polypeptides with all possible single amino acid substitutions relative to the 475-amino-acids-long polypeptide of SEQ ID NO:3 would require describing and reducing to practice 19475 polypeptide sequences. Polypeptides consisting of an amino acid sequence 80% identical to SEQ ID NO:3 would have up to 95 random amino acid substitutions relative to SEQ ID NO:3. Accordingly, 95 x 19475 amino acid sequences would need to be described and reduced to practice; most of which were not in Applicant’s possession at the time of filing. The instant Specification fails to provide guidance for which amino acids of SEQ ID NO:3 can be substituted, and to which amino acids, and also which amino acids must not be changed, to maintain the functional activity of the encoded protein. The Specification also fails to provide guidance for which amino acids can be deleted and which regions of the protein can tolerate insertions and/or additions and still produce a functional protein. Describing and reducing to practice the claimed genus of amino acid substitutions in the protein of SEQ ID NOs:2, 3, or 4 is unpredictable. While it is known that many amino acid substitutions, additions or deletions are generally possible in any given protein, the positions within the protein’s sequence where such amino acid changes can be made with a reasonable expectation of success (without altering protein function) are limited. Certain positions in the sequence are critical to the protein’s structure/function relationship, for example various sites or regions directly involved in binding, activity, and in providing the correct three-dimensional spatial orientation of binding and active sites. These regions can tolerate only relatively conservative substitutions or no substitutions at all. See Keskin et al., 2004, A new, structurally nonredundant, diverse data set of protein–protein interfaces and its implications, Protein Science 13: 1043-1055, who teach that proteins with similar structure may have different functions (Abstract; pages 1043-1044). See also Guo et al., 2004, Protein tolerance to random amino acid change, Proceedings of the National Academy of Sciences USA 101: 9205-9210, who teach that there is a probability factor of 34% that a random amino acid replacement in a given protein will lead to its inactivation (Abstract; page 9206; Table 1). In the instant case, such a probability factor will be much higher as the claims encompass more than a single amino acid change in the encoded protein of SEQ ID NO:31. Furthermore, Thornton et al., 2000, From structure to function: approaches and limitations, Nature Structural Biology, structural genomic supplement, November 2000: 991-994, teach that structural data may carry information about the biochemical function of a protein, while its biological role in the cell or organism is much more complex and additional experimentation is needed to elucidate actual biological function (page 992). Thus, the Specification fails to overcome the unpredictability of reducing to practice the large numbers of amino acid deletions/substitutions/insertions/additions in the protein of SEQ ID NOs:2, 3, or 4, as it does not provide an adequate description of the proteins with the recited large amino acid substitutions relative to SEQ ID NOs:2, 3 or 4. Similar considerations apply to the other claimed protein sequences. Applicant has not reduced to practice a representative number of the broadly claimed genus of claimed protein sequences. The Applicant fails to describe structural or functional features common to the genus of broadly claimed polypeptides allegedly responsible for the recited function(s), e.g., how exactly the myriad of possible molecules are causally related to the recited increase in expression and/or activity of the AAP protein, and in all plants, plant parts, and plant cells. Hence, Applicant fails to meet either prong of the two-prong test set forth by Eli Lilly. Given Applicant has provided very vague description of the method steps or structures that would link the expression of (i) nucleic acid constructs of AAP proteins having at least 80% sequence identity to any one of SEQ ID NOs:2, 3, 4; or (ii) variants having at least one (but unspecified maximum) of mutations in the sequence, or (iii) unspecified mutations in the AAP polypeptide, or (iv) unspecified homolog positions in unspecified homologous sequences to SEQ ID NO:1, with the recited increase in expression and/or activity of the AAP protein, resulting in larger and heavier seeds, it remains unclear what features or method steps are capable of performing the claimed function. The Specification fails to provide an adequate written description to support the breadth of the claims. Therefore, one skilled in the art would not have recognized Applicant to be in possession of the claimed invention at the time the application was filed. See Written Description guidelines published in 2008 online at https://www.uspto.gov/sites/default/files/web/menu/written.pdf. Response to Applicant’s arguments: The Applicant’s arguments in the response submitted on June 12, 2025 have been carefully considered. However, this is a new rejection necessitated by the claim amendments. Claim Rejections - 35 USC § 102/103 A rejection under 35 U.S.C. § 102 or § 103 does not require the same analysis as a rejection under 35 U.S.C. § 102 or a rejection under 35 U.S.C. § 103. The rejection is made because the Examiner cannot determine whether the prior art composition possesses characteristics that are not recited in the art. The Examiner does not have sufficient facts to determine whether the claimed compositions, polynucleotides, polypeptides and organisms are inherently the same as the prior art compositions, polynucleotides, polypeptides and organisms. In addition, the Examiner cannot conclude that the claimed subject matter would have been obvious since it cannot be determined whether the claimed and prior art compositions, polynucleotides, polypeptides and organisms differ. Where the prior art product seems to be identical, except that the prior art is silent to a characteristic or property claimed, then the burden shifts to Applicant to provide evidence that the prior art would neither anticipate nor render obvious the claimed invention. In re Best, 195 USPQ 430, 433 (CCPA 1977). Claims 17, 24, 26, and 47-49 are rejected as being anticipated under pre-AIA 35 U.S.C. § 102(b), or alternatively as being unpatentable under pre-AIA 35 U.S.C. § 103(a), over ALEXANDROV (Alexandrov and Brover, United States Patent Application Publication No. 2006/0150283 A1, published July 6, 2006). This is a new rejection necessitated by the claim amendments. The claims are drawn to a genetically altered plant that expresses a nucleic acid sequence encoding an Amino Acid Transporter (AAP) protein having at least 80% sequence identity to any one of SEQ ID NO: 2, wherein the plant produces larger and heavier seeds, and wherein the plant is not Arabidopsis; further wherein the plant is soybean; and wherein the plant part is seed. ALEXANDROV teaches sequence-determined DNA fragments and corresponding polypeptides encoded thereby (entire document; see Title, Abstract, for example). The DNA molecules are useful for specifying a gene product in cells, either as a promoter or as a protein coding sequence (entire document; see Abstract). Regarding claims 17 and 47-49, ALEXANDROV teaches a polynucleotide sequence and refers to this sequence as SEQ ID NO:81355. This sequence encodes a polypeptide sequence with 99.8% similarity to instant SEQ ID NO:2 (i.e., a variant with at least 80% sequence identity to SEQ ID NO:2; a functional variant or homolog thereof). SEQ ID NO:81355 is isolated from Arabidopsis thaliana (see alignment below: Qy = instant SEQ ID NO:2; Db = ALEXANDROV’s SEQ ID NO:81355). ALIGNMENT OF INSTANT SEQ ID NO:2 AND THE POLYPEPTIDE ENCODED BY SEQ ID NO:81355 FROM ALEXANDROV RESULT 1 US-11-056-355B-81355 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 81355, US/11056355B Publication No. US20060150283A1 GENERAL INFORMATION APPLICANT: Brover, Vyacheslav APPLICANT: Alexandrov, Nickolai TITLE OF INVENTION: Sequence Determined DNA Fragments and Corresponding TITLE OF INVENTION: Polypeptides Encoded Thereby FILE REFERENCE: 2750-1590PUS2 CURRENT APPLICATION NUMBER: US/11/056,355B CURRENT FILING DATE: 2005-02-14 PRIOR APPLICATION NUMBER: 60/544,190 PRIOR FILING DATE: 2004-02-13 NUMBER OF SEQ ID NOS: 119966 SEQ ID NO 81355 LENGTH: 1428 TYPE: DNA ORGANISM: Arabidopsis thaliana FEATURE: NAME/KEY: misc_feature LOCATION: (1)..(1428) OTHER INFORMATION: Ceres Seq. ID no. 12659423 FEATURE: NAME/KEY: misc_feature LOCATION: (1)..(1428) OTHER INFORMATION: Ortholog of Ceres SEQ ID NO 14307257 as cited in SEQ ID NO 54628 Alignment Scores: Length: 1428 Score: 2457.00 Matches: 474 Percent Similarity: 100.0% Conservative: 1 Best Local Similarity: 99.8% Mismatches: 0 Query Match: 99.9% Indels: 0 Gaps: 0 US-17-640-466-2 (1-475) x US-11-056-355B-81355 (1-1428) Qy 1 MetAspAlaTyrAsnAsnProSerAlaValGluSerGlyAspAlaAlaValLysSerVal 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGACGCATACAACAATCCCTCGGCGGTGGAGTCGGGTGACGCCGCCGTGAAAAGCGTC 60 Qy 21 AspAspAspGlyArgGluLysArgThrGlyThrPheTrpThrAlaSerAlaHisIleIle 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GACGACGATGGTCGAGAGAAGAGAACGGGAACATTTTGGACGGCGAGTGCGCACATAATC 120 Qy 41 ThrAlaValIleGlySerGlyValLeuSerLeuAlaTrpAlaIleAlaGlnLeuGlyTrp 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ACGGCGGTCATAGGCTCAGGGGTGCTGTCGTTGGCTTGGGCTATAGCACAGCTTGGTTGG 180 Qy 61 ValAlaGlyThrThrValLeuValAlaPheAlaIleIleThrTyrTyrThrSerThrLeu 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GTGGCAGGAACCACAGTTTTGGTCGCTTTCGCCATCATTACTTACTACACGTCCACCTTG 240 Qy 81 LeuAlaAspCysTyrArgSerProAspSerIleThrGlyThrArgAsnTyrAsnTyrMet 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CTCGCCGACTGTTACCGTTCGCCGGACTCCATCACCGGAACACGCAACTATAATTACATG 300 Qy 101 GlyValValArgSerTyrLeuGlyGlyLysLysValGlnLeuCysGlyValAlaGlnTyr 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GGCGTCGTCCGATCTTACCTTGGTGGTAAAAAGGTTCAGCTATGTGGAGTGGCACAGTAC 360 Qy 121 ValAsnLeuValGlyValThrIleGlyTyrThrIleThrAlaSerIleSerLeuValAla 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GTGAATCTCGTAGGGGTCACTATTGGTTACACCATCACTGCCTCCATAAGCTTAGTAGCG 420 Qy 141 IleGlyLysSerAsnCysTyrHisAspLysGlyHisLysAlaLysCysSerValSerAsn 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 ATTGGGAAATCAAATTGTTATCATGACAAGGGACATAAAGCGAAATGTTCTGTATCGAAT 480 Qy 161 TyrProTyrMetAlaAlaPheGlyIleValGlnIleIleLeuSerGlnLeuProAsnPhe 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TATCCATACATGGCGGCATTTGGGATCGTCCAGATCATTCTGAGCCAGCTTCCTAACTTC 540 Qy 181 HisLysLeuSerPheLeuSerIleIleAlaAlaValMetSerPheSerTyrAlaSerIle 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CACAAGCTCTCTTTCCTATCCATCATCGCCGCGGTTATGTCCTTCTCTTATGCGTCTATC 600 Qy 201 GlyIleGlyLeuAlaIleAlaThrValAlaSerGlyLysIleGlyLysThrGluLeuThr 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GGAATAGGCCTAGCCATCGCTACTGTAGCAAGTGGGAAGATTGGTAAGACAGAATTGACA 660 Qy 221 GlyThrValIleGlyValAspValThrAlaSerGluLysValTrpLysLeuPheGlnAla 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GGGACAGTGATAGGTGTGGACGTAACTGCGTCTGAAAAAGTTTGGAAATTGTTTCAAGCG 720 Qy 241 IleGlyAspIleAlaPheSerTyrAlaPheThrThrIleLeuIleGluIleGlnAspThr 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ATTGGAGACATTGCCTTTTCATACGCTTTTACCACTATTCTCATCGAGATTCAGGACACA 780 Qy 261 LeuArgSerSerProProGluAsnLysValMetLysArgAlaSerLeuValGlyValSer 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTGAGATCAAGCCCACCAGAGAACAAAGTGATGAAACGAGCAAGTCTTGTCGGAGTCTCA 840 Qy 281 ThrThrThrValPheTyrIleLeuCysGlyCysIleGlyTyrAlaAlaPheGlyAsnGln 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 ACCACAACTGTTTTCTACATCTTGTGTGGTTGCATCGGATATGCTGCGTTCGGCAACCAA 900 Qy 301 AlaProGlyAspPheLeuThrAspPheGlyPheTyrGluProTyrTrpLeuIleAspPhe 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GCCCCTGGTGACTTCCTTACCGATTTTGGTTTTTACGAACCTTATTGGCTCATCGACTTT 960 Qy 321 AlaAsnAlaCysIleAlaLeuHisLeuIleGlyAlaTyrGlnValTyrAlaGlnProPhe 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 GCCAATGCTTGCATTGCTCTCCATCTAATAGGTGCCTATCAGGTGTATGCGCAGCCGTTT 1020 Qy 341 PheGlnPheValGluGluAsnCysAsnLysLysTrpProGlnSerAsnPheIleAsnLys 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TTCCAGTTTGTTGAGGAAAACTGCAACAAAAAATGGCCTCAAAGCAATTTCATCAACAAA 1080 Qy 361 GluTyrSerSerLysValProLeuLeuGlyLysCysArgIleAsnLeuPheArgLeuVal 380 |||||||||||||||||||||||||||||||||||||||:::|||||||||||||||||| Db 1081 GAATACTCGTCAAAGGTTCCTTTGCTTGGAAAATGTCGTGTCAACCTCTTCAGACTGGTT 1140 Qy 381 TrpArgThrCysTyrValValLeuThrThrPheValAlaMetIlePheProPhePheAsn 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TGGAGGACATGCTATGTTGTTTTGACAACATTTGTAGCAATGATATTCCCCTTCTTCAAT 1200 Qy 401 AlaIleLeuGlyLeuLeuGlyAlaPheAlaPheTrpProLeuThrValTyrPheProVal 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GCGATCTTGGGTTTGCTAGGGGCATTCGCGTTCTGGCCACTCACAGTTTATTTTCCGGTG 1260 Qy 421 AlaMetHisIleAlaGlnAlaLysValLysLysTyrSerArgArgTrpLeuAlaLeuAsn 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCAATGCACATTGCGCAGGCTAAAGTCAAGAAGTATTCTCGTAGATGGTTGGCCTTGAAC 1320 Qy 441 LeuLeuValLeuValCysLeuIleValSerAlaLeuAlaAlaValGlySerIleIleGly 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CTCCTCGTATTGGTTTGCTTGATCGTCTCGGCCCTTGCCGCCGTAGGATCCATCATTGGC 1380 Qy 461 LeuIleAsnSerValLysSerTyrLysProPheLysAsnLeuAsp 475 ||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TTAATTAATAGTGTCAAGTCATACAAGCCCTTCAAGAATTTAGAC 1425 It is noted that, paralleling the teachings of ALEXANDROV, instant SEQ ID NO:2 is annotated as an AtAAP8Ler protein, also isolated from Arabidopsis thaliana (see Specification, page 47, lines 6-`5). ALEXANDROV teaches and claims (claim 11 of ALEXANDROV) the polypeptide (i.e., amino acid sequence) encoded by SEQ ID NO:81355, and also teaches and claims (claims 1-3 of ALEXANDROV) the nucleic acid molecule of SEQ ID NO:81355. ALEXANDROV teaches recombinant DNA constructs comprising a polynucleotide selected from the group consisting of a finite number of nucleic acid sequences, and teaches gene constructs and vector construction (pages 74-75, paragraphs 0722-0736). ALEXANDROV teaches and claims (claims 6-8 of ALEXANDROV) vector constructs comprising the nucleic acid molecule of SEQ ID NO:81355, claims host cells comprising the nucleic acid molecule of SEQ ID NO:81355 (claim 9 of ALEXANDROV), and claims host cells comprising the vector constructs (claim 10 of ALEXANDROV). ALEXANDROV teaches transformation techniques, and teaches transgenic plants, seeds or host cells (page 76, paragraphs 0746-0750). ALEXANDROV claims (claim 15 of ALEXANDROV) plants or cells of a plant, which comprise the nucleic acid molecules encoding the polypeptide of SEQ ID NO:81355, and also teaches and claims (claim 16 of ALEXANDROV) plants or cells of a plant (i.e., plant parts), which comprise the vector constructs that include the polynucleotide of SEQ ID NO:81355. ALEXANDROV teaches incorporation of the polynucleotide of SEQ ID NO:81355 into a host cell, using expression cassettes (page 73, paragraph 0676). The expression constructs can comprise exogenous genes including constitutive promoters or promoters that direct transcription only in particular cells or times (page 74, paragraphs 0717-0718). ALEXANDROV teaches an entire section on promoters (paragraphs 0619-0625, bridging pages 69-70), teaches constitutive promoters or promoters that direct expression in particular cell types, tissues, or organs or in response to environmental stimuli (page 69, paragraph 0619). ALEXANDROV teaches that the expression cassette can be introduced into other plant (i.e., the plant is not Arabidopsis) by sexual crossing, using any of a number of standard breeding techniques (paragraph 0751, bridging pages 76 -77). Plant breeding involves choosing parents, making crosses to allow gene recombination, and searching for and selecting improved forms (page 1, paragraph 0006). ALEXANDROV also teaches analyses to reveal function and roles of single genes in different species, and to extrapolate knowledge from one species to many plant species. For example, proteins from different species, capable of performing identical or similar functions, preserve many features of amino acid sequence and structure during evolution (page 6, paragraphs 0026-0027). Complete protein sequences have been compared and contrasted within and between species to determine the functionally vital domains and signatures characteristic of each of the proteins (including the polypeptide encoded by the polynucleotide of SEQ ID NO:81355). Thus, functions and characteristics of Arabidopsis proteins have been extrapolated to proteins containing similar domains and signatures of corn, soybean, rice and wheat and by implication to all other (plant, crop) species. Id. See Schematic 3 on page 7, which is also shown below, specifically indicating extrapolation of the genes/functions from one species to another. Two proteins with related structures, one from corn, a monocot (i.e., the plant is not Arabidopsis), and one from Arabidopsis, a dicot, have been concluded to be orthologs. The known characteristics of the Arabidopsis protein can then be attributed to the corn protein. Id. PNG media_image1.png 574 598 media_image1.png Greyscale ALEXANDROV teaches that the invention also resides in host cells, including bacterial or yeast cells or plant cells, and plants that harbor the described constructs. Another aspect of the invention relates to methods for modulating expression of specific genes in plants by expression of the coding sequence of the constructs, by regulation of expression of one or more endogenous genes in a plant or by suppression of expression of the polynucleotides of the invention in a plant. Methods of modulation of gene expression include (1) inserting into a host cell additional copies of a polynucleotide comprising a coding sequence; (2) modulating an endogenous promoter in a host cell; (3) inserting antisense constructs into a host cell and (4) inserting into a host cell a polynucleotide comprising a sequence encoding a variant, fragment, or fusion of the native polypeptides of the instant invention (i.e., genetically altered plant, part thereof, or plant cell) (page 10, paragraphs 0100). Further regarding claims 17 and 24, ALEXANDROV teaches the isolation of alleles from the corresponding QTL of wild relatives. Transgenic plants having various combinations of QTL alleles are then created and the effects of the combinations measured. Once desired allele combination is identified, crop improvement (i.e., crop plant; i.e., the plant is not Arabidopsis) is accomplished either through biotechnological means or by directed conventional breeding programs (page 65, ¶¶ 0557, 0564). Further regarding claims 47-49, ALEXANDROV teaches that the invention has use over a broad range of plants, including species from the genera Brassica, Glycine, Hordeum, Oryza, Triticum, and, Zea. (i.e., brassica, soybean, barley, rice, wheat, and maize) (page 76, ¶ 0750). Regarding claim 26, ALEXANDROV teaches the importance of seeds and seed production in agriculture (i.e., plant part is a seed) (pages 28-29, paragraphs 0383-0384). ALEXANDROV teaches the isolation of mRNAs from plants exposed to drought conditions, subsequent mRNA testing utilizing microarray techniques (page 20, paragraph 0305), and teaches drought responsive genes, gene components and products (page 34, paragraph 0432). The polypeptide encoded by the polynucleotide of SEQ ID NO:81355, taught by ALEXANDROV, would have inherently exhibited the recited properties of producing larger and heavier seeds, because it (SEQ ID NO:81355) contained all the structural elements recited in the instant claims. Accordingly, ALEXANDROV anticipated the claimed invention. In the alternative, it is possible that ALEXANDROV does not explicitly teach every single element of the instant claims, and perhaps this could result in a composition that is not identical to the instantly claimed composition(s). However, it would have been prima facie obvious and within the scope of an ordinary skill in the art at the time the invention was made to use the compositions and methods taught by ALEXANDROV, and to transform any desired crop plant (including rice, maize, wheat, soybean) with the polynucleotide sequence of SEQ ID NO: 81355, and this would result in the Applicant’s invention; with a reasonable expectation of success, and without any surprising results. Obviously, one of ordinary skill in the art would have been motivated to do so for the purpose of producing crop plants having improved properties and yield, and for understanding as to how the genes, gene components and product are useful for changing the properties of plants, as taught by ALEXANDROV. In the instant case, the prior art teaches compositions and methods with the exact same method step of introducing a nucleic acid encoding the identical protein into a plant. Although it is possible that the nucleic acid could have been incorporated into a location in the genome that expresses at very low levels or is silenced, it is more likely that the nucleic acid would have been incorporated into a location in the genome that allows for a substantial level of expression (i.e., over-expression); this is axiomatic in plant genetic engineering. In the event that a population of transformants would have been generated that included a variety of different levels of expression due to position effects, it would have been obvious to the ordinary artisan to screen for plants having adequate expression levels, which would have necessarily resulted in plants having larger and heavier seeds. Bioinformatic analysis, DNA isolation and identification, in silico, cDNA, and genomic library screening, recombinant DNA technology, the use of desired expression regulatory sequences, plant transformation, plant growth, seed and yields assays are techniques that were routine in the art at the time the invention was made, as taught by the cited reference and the state of the art in general. Response to Applicant’s arguments: The Applicant’s arguments in the response submitted on June 12, 2025 have been carefully considered. However, this is a new rejection necessitated by the claim amendments. It is also noted that the instant claims are composition claims. The property of the plant producing larger and heavier seeds (and any other properties that arise from the presence of the recited compositions/structures) would be inherent to the compositions (polynucleotides, polypeptides, cells, plants) taught by ALEXANDROV, which comprise the recited structure(s) that are required for the claimed function(s). As described above, ALEXANDROV highlights that SEQ ID NO: 81355 is an important polynucleotide of the invention because ALEXANDROV discloses and claims SEQ ID NO: 81355. Although ALEXANDROV does not create a transgenic plant using the polynucleotide of SEQ ID NO: 81355, ALEXANDROV teaches how to do so by providing all steps and working examples. “[A] reference can anticipate a claim even if it “d[oes] not expressly spell out” all the limitations arranged or combined as in the claim, if a person of skill in the art, reading the reference, would “at once envisage” the claimed arrangement or combination.” See Kennametal, Inc. v. Ingersoll Cutting Tool Co., 780 F.3d 1376, 1392 (Fed. Cir. 2015) (finding a reference can anticipate a claim where there is no evidence that the claimed combination was in fact created, but where the claimed combination is plainly suggested as an alternative embodiment). See also Bristol-Myers Squibb Co. v. Ben Venue Labs., Inc., 246 F.3d 1368, 1379 (Fed.Cir.2001) (“Rather, anticipation only requires that those suggestions be enabled to one of skill in the art.”). Here, the skilled artisan is taught methods to create a transgenic plant as claimed, and provided SEQ ID NO:947 as a suitable polynucleotide for use in a method to create the claimed composition(s). Using this information, the skilled artisan can “at once envisage” the claimed composition. Note also the explanation given by the Patent Trial and Appeal Board in Ex parte Christophe Reuzeau, Appeal No. 2016-000979 (decided 03/24/2017), at pages 9-18, where in a factually similar context the rejection was affirmed. Claim Rejections - 35 USC § 103 Claims 17, 24, 26, and 47-49 remain rejected under 35 U.S.C. § 103 as being unpatentable over SANTIAGO (Santiago et al., Connecting Source with Sink: The Role of Arabidopsis AAP8 in Phloem Loading of Amino Acids, Plant Physiology 171.1 (2016): 508-521; Published 25 Mar 2016) in view of NASHOLM (Nasholm et al., US 2008/0295199 A1; Published 27 Nov 2008) and taken with the evidence of UniProt Accession O80592 (“Amino Acid Permease 8”, UniProt: O80592; https://www.uniprot.org/uniprotkb/ O80592/entry; Available 01 Nov 1998); for reasons of record stated on pages 8-15 of the Office action mailed 03/18/2025. The claims are drawn to a genetically altered plant that expresses a nucleic acid sequence encoding an Amino Acid Transporter (AAP) protein having at least 80% sequence identity to any one of SEQ ID NO: 2, wherein the plant produces larger and heavier seeds, and wherein the plant is not Arabidopsis; further wherein the plant is soybean; and wherein the plant part is seed. SANTIAGO teaches the role of Arabidopsis AAP8 in phloem loading of amino acids (entire document; see Title, Abstract, for example), and teaches that amino acid transporters are important for translocating nitrogen in the form of amino acids throughout the plant (Pg. 508 left col ¶1 – Pg. 509 left col ¶2). Specifically, SANTIAGO teaches that AAP8 is important for facilitating the loading of a broad spectrum of amino acids into the phloem to supply vegetative and reproductive sinks with essential quantities of nitrogen (Pg. 509 left col ¶2). In the report by SANTIAGO, Arabidopsis thaliana plants comprising a loss-of-function mutation in the nucleic acid encoding AAP8 were analyzed for amino acid transport, nitrogen translocation, and seed yield phenotypes (Pg. 509 right col ¶4-5). SANTIAGO teaches that these mutant plants had increases in total leaf protein, but reduced export of amino acids from leaves to other tissues (Figures 3, 4, and 6). SANTIAGO also teaches that these mutant plants had decreases in the expression of nucleic acids encoding other AAP proteins including AAP1, AAP2, AAP4, and AAP6 (Figure 5). Additionally, SANTIAGO teaches that Arabidopsis thaliana plants comprising a loss-of-function mutation in the nucleic acid encoding AAP8 had reduced seed yield and reduced seeds per silique (Figure 8). It is well known in the art that, conversely, increased AAP8 expression would result in increased seed yield. SANTIAGO teaches that decreased uptake of amino acids into the seed endosperm and reduced nitrogen availability likely caused the deleterious seed yield phenotype observed in aap8 mutant plants (Pg. 516 left col ¶2). SANTIAGO teaches that AAP8 is important for the import of neutral and acidic amino acids into the phloem and N partitioning to the developing sinks, and that AAP8 function is important for source-to-sink partitioning of nitrogen in plants (Pg. 517 left col ¶2). SANTIAGO does not explicitly teach a genetically plant which has increased expression of AAP8 or a homolog thereof. However, such claimed compositions and the recited methods practiced with the compositions would have been prima facie obvious to a person of ordinary skill in the art at the time of invention for the following reasons. NASHOLM teaches the modulation of plant growth by altering amino acid uptake (entire document; see Title, Abstract, for example), and teaches that the growth and yield of plants may be increased by modifying amino acid transporters including amino acid permease 8 (AAP8) (¶0003, ¶0008, ¶0023, Claims 1-9). The AAP8 sequence taught by NASHOLM (Table 2), represented by UniProt Accession O80592, has 99.9% identity with the instant SEQ ID NO: 2. See alignment at pages 19-20 in the Office action mailed 06/03/2024. As the instant specification describes a functional variant of a given protein as encompassing proteins with as low as 25% identity to the protein of interest (Pg. 15 Line 32 – Pg. 16 Line 3), and also claims unspecified homologs comprises a myriad of possible mutations, relative to instant SEQ ID NO:2, the protein taught by NASHOLM is interpreted as being a functional variant of the protein of instant SEQ ID NO:2. See also Applicant’s admission of the sequence similarity between instant SEQ ID NOs:2, 31, 33, 35, 17, and 4 (Remarks, pages 8-11, Table 1). NASHOLM further teaches that the expression of amino acid permeases including AAP8 can be increased by operably linking the nucleic acid encoding the desired amino acid transporter to a heterologous promoter (¶0001, ¶0011, ¶0031, Claims 1-9). The nucleic acids corresponding to the amino acid transporters and promoter sequences above are taught by NASHOLM as including heterologous sequences (i.e., genetically altered) (¶0011, ¶0029, Claim 2). This enables increased expression of the gene product compared with endogenous levels (¶0106). NASHOLM teaches that variants of their claimed amino acid permeases that retain wild-type activity are also encompassed by their invention (¶0022, ¶0025). Specifically, NASHOLM teaches some examples of conservative substitutions, including the substitution of one hydrophobic residue for another hydrophobic residue, such as the substitution of isoleucine for valine (¶0028). NASHOLM teaches methods of transforming and regenerating plants having modified expression and activity of amino acid permeases including AAP8 (¶0039 – ¶0045). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to modify the aap8 mutant plants taught by SANTIAGO to instead have increased expression of a nucleic acid encoding AAP8, as taught by NASHOLM. One of ordinary skill in the art would be motivated to do so to increase the growth and yield of a plant, as taught by both SANTIAGO and NASHOLM. SANTIAGO teaches that Arabidopsis thaliana plants comprising a loss-of-function mutation in the nucleic acid encoding AAP8 had reduced seed yield and reduced seeds per silique (Figure 8). SANTIAGO thus teaches that AAP8 is important for facilitating the loading of a broad spectrum of amino acids into the phloem to supply seeds with the essential quantities of nitrogen (page 509, left col ¶2). Given this important role of AAP8 in mobilizing nitrogen within the plant, NASHOLM teaches that the growth and yield of plants may be increased by increasing the expression of a nucleic acid encoding AAP8 protein with 99.9% identity to the instant SEQ ID NO:2 (¶0003, ¶0008, ¶0023, Claims 1-9; Table 2). It is axiomatic in plant biotechnology and agriculture that larger and heavier seeds are correlated with increased yield; or that increased yield is correlated to seed size and mass/weight. NASHOLM teaches that the expression of AAP8 may be increased through the operable linkage of a nucleic acid encoding AAP8 to a constitutive promoter, followed by the subsequent transformation of a plant with the resulting recombinant nucleic acid vector (i.e., genetically altered plant) (¶0001, ¶0011, ¶0031, ¶0039 – ¶0045, Claims 1-9). Increasing the yield of a plant is beneficial for seed collection and propagation. As such, one of ordinary skill in the art would be motivated to increase the activity of protein associated with the mobilization of nutrients in a plant to the seed in an attempt to increase the yield of a plant (including producing larger and heavier seeds). Such an approach is likewise taught by NASHOLM, which teaches that the activity of AAP8 may be increased to increase the growth of a plant (Claims 1-9; ¶0023). As the generation of recombinant nucleic acids and the transformation and cultivation of plants transformed therewith is routine in the art of plant biotechnology, and is accordingly taught by NASHOLM (¶0031, ¶0039 – ¶0045), one of ordinary skill in the art would be able to create such plants with a reasonable expectation of success. Thus, one of ordinary skill in the art would arrive at a plant transformed with a nucleic acid which encodes a functional variant of the AAP8 polypeptide of SEQ ID NO:2 and which is operably linked to a promoter which facilitates its constitutive expression, and thus results in increased activity. Thus, one of ordinary skill in the art would arrive at the inventions set forth in the instant claims 17, 24, 26, and 47-49. The compositions – transgenic plants expressing the polypeptides taught by SANTIAGO and NASHOLM – would produce larger and heavier seeds, because they contained all the structural elements recited in the instant claims. Further with respect to claim 24, increasing the activity of AAP8 in a crop plant is made obvious to one of ordinary skill in the art because NASHOLM teaches plants—including maize, wheat, and soybean—to which the methods of their invention are applicable (¶0112 – ¶0113). Further with respect to claim 26, seeds from plants which have increased activity of AAP8 is made obvious to one of ordinary skill in the art because NASHOLM teaches plant parts, including seeds, are encompassed by their inventions (¶0112), and because Santiago et al teaches that AAP8 is important for translocating nitrogen-containing amino acids to the phloem tissue for transport to the seeds (Pg. 508 left col ¶1 – Pg. 509 left col ¶2). Bioinformatic analysis, in silico and cDNA library screening, isolation and identification of DNA clones, recombinant DNA methodology including biolistic and Agrobacterium-mediated plant transformation, allele identification, and site-directed mutagenesis are techniques that were routine in the art at the time the application was filed, as taught by the cited references and the state of the art in general. Response to Applicant’s arguments: The Applicant’s arguments in the response submitted on June 12, 2025 have been carefully considered. Applicant contends that they have surprisingly determined that increasing the permease activity of AAP8 can increase seed weight and quality; and that an increase in AAP8 activity can be achieved through a point mutation in the amino acid transporter motif of an AAP polypeptide (Remarks, paragraph bridging pages 12-13). Applicant argues that the clams as amended reflect these surprising discoveries (Id.). Applicant describes work published in a scientific journal (Id., pages 14-15). Applicant argues that the present specification differs from the prior art (Id., pages 15-16). Applicant argues that NASHOLM does not provide information relative to seeds (Id., paragraphs bridging pages 13-14). The Examiner disagrees with Applicant’s characterization of the cited prior art, and of the state of the art in general, vis-à-vis the instant claims. Initially, it is noted that the amended claims are broadly and reasonably interpreted to be drawn to a genetically altered plant that expresses a nucleic acid sequence encoding an AAP protein having at least 80% sequence identity to SEQ ID NO: 2,wherein the plant is characterized by increased expression or activity of the polypeptide, wherein the plant produces larger and heavier seeds, and wherein the plant is not Arabidopsis (see claim 17, for example). For example, a fairer reading of SANTIAGO shows that the reference extensively teaches about the importance and the positive correlation of the expression of AAP transporters with seed yield, seed number, and seed phenotypes – all in the context of amino acid and nitrogen transport and import into the seed endosperm/embryo (page 509, left col.). Furthermore, referencing the work of Zhang et al., SANTIAGO teaches that overexpression of the endogenous AAP1 transporter in the leaf phloem led to increased source-to-sink allocation of amino acids and to improved seed yield (Id.; copy of reference not provided herein). Similarly, and also in the context of amino acid and nitrogen transport, NASHOLM teaches that improving the acquisition of nitrogen by plants is an important objective in increasing crop yields (¶0003), and further teaches and claims that the activity of AAP8 may be increased to increase the growth of a plant (Claims 1-9; ¶0023). Of course, it is axiomatic in the art that crop yield is correlated with plant growth and seed weight. The main issue in the present obviousness analysis is the concept of increasing the growth and yield of a plant, as taught by both SANTIAGO and NASHOLM, by expressing an AAP protein (for example, the AAP8 sequence taught by NASHOLM, represented by UniProt Accession O80592, which has 99.9% identity with the instant SEQ ID NO: 2). It is in this context that the combined teachings of SANTIAGO and NASHOLM precisely teach, suggest, and provide motivation for the instantly claimed compositions and methods. In response to Applicant’s argument that describes exemplary research data, it cannot be considered probative as it is not presented in the form of a declaration or affidavit, and as such is only argument that cannot be used to refute the basis of the rejection. The arguments of counsel cannot take the place of evidence in the record. See MPEP § 716.01(c). Applicant is reminded that the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). Applicant is reminded that prima facie obviousness is not rebutted by merely recognizing additional advantages or latent properties present but not recognized in the prior art. See MPEP § 2145. Mere recognition of latent properties in the prior art does not render nonobvious an otherwise known invention. Id.; In re Wiseman, 596 F.2d 1019, 201 USPQ 658 (CCPA 1979). Indeed, courts have held that “[t]he fact that appellant has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious.” Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985). Applicant is also reminded that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, one of ordinary skilled in the art would have arrived at the Applicant’s invention by combining the teachings of the cited art as discussed above. Therefore, for at least the reasons of record, and those reasons indicated above, the rejection is maintained. Summary No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR§ 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR § 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Examiner’s Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to BRATISLAV STANKOVIC whose telephone number is (571) 270-0305. The examiner can normally be reached Monday-Friday, 08:00-17:00 h EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. BRATISLAV STANKOVIC, PhD, JD Primary Patent Examiner Art Unit 1663 /BRATISLAV STANKOVIC/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Show 6 earlier events
Feb 27, 2025
Request for Continued Examination
Mar 02, 2025
Response after Non-Final Action
Mar 18, 2025
Non-Final Rejection mailed — §102, §103, §112
Jun 12, 2025
Response Filed
Aug 27, 2025
Final Rejection mailed — §102, §103, §112
Nov 26, 2025
Request for Continued Examination
Dec 01, 2025
Response after Non-Final Action
May 29, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12612641
RICE MALE FERTILITY REGULATORY GENE, MUTANT OF RICE MALE FERTILITY REGULATORY GENE, USE THEREOF AND A METHOD FOR REGULATING RICE FERTILITY
3y 5m to grant Granted Apr 28, 2026
Patent 12584141
Method for Improving Wheat Resistance To Fusarium Head Blight (FHB) By Genome Editing
2y 4m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 2 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

4-5
Expected OA Rounds
42%
Grant Probability
42%
With Interview (+0.0%)
2y 4m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 12 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month