DETAILED ACTION
This Action is in response to the communication filed on 07/18/2025.
Claims 1-14 are pending.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election of Group I (claims 1-5, 10-12) in the reply filed on 07/18/2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
It is noted that the amendment filed 07/18/2025 added new claims 13-14, drawn to a method of decreasing migratory and invasive capacity of tumor cells using the chimeric complex of claim 1. New claims 13-14 are grouped with claims 6-9 in previously identified Group II as the method of claims 13-14 are similar to claims 6-9 which are drawn to a method for the treatment of a tumor disease using the chimeric complex of claim 1.
Claims 6-9, 13-14 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 07/18/2025.
Clams 1-5, 10-12 are examined herein.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Applicant cannot rely upon the certified copy of the foreign priority application to overcome rejection(s) because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. Since a translation of the certified copy of the foreign priority application has not been filed, the effective filing date of the claimed invention is August 31, 2020, the filing date of the PCT application.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 07/26/2022 is acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-5, 10-12 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Quirico (Doctoral Thesis, March 2018, of record).
Quirico teaches a chimeric complex comprising an aptamer directed towards AXL receptor tyrosine kinase, said aptamer comprising: augaucaaucgccucaauucgacaggaggcucac (SEQ ID NO: 1), XXXX (where Quirico defines X as “C3 carbon linker”, thus XXXX would be 4xC3s = 12 carbon unsubstituted linear alky chain), guacauucuagauagcc (SEQ ID NO: 2, a sticky sequence), a miRNA comprising a guide strand consisting of agucagugcaucacagaacuuugucuuu (SEQ ID NO: 3) and passenger strand consisting of aggugaaguucuguuauacacucaggcu (SEQ ID NO: 4) and ggcuaucuagaauguac (SEQ ID NO: 5 a sticky sequence complementary to SEQ ID NO; 2), see page 26 of Quirico under “Aptamer-miRNA conjugate preparations”: GL21.T-sticky (axl aptamer), 3P of miR-148b, and 5P of miR-148b. Quirico teaches “All RNAs were modified with 2’-F pyrimidines” [2’-fluoro pyrimidines], and “Sticky sequence, consisting of 2’F-Py and 2’-OMe-Pu, is underlined.” Thus Quirico teaches one or more pyrimidine bases in SEQ ID NO: 2 and SEQ ID NO: 5 are substituted with a corresponding 2’-fluropyrimidine, and one or more purine bases in SEQ ID NO: 2 and SEQ ID NO: 5 are substituted with a corresponding 2’-O-methylpurine, rendering the chimeric complex nuclease resistant. Quirico also teaches that the axl-148b (the chimeric complex comprising the axl-specific aptamer linked to miR-148 as described above) was injected into tumors in mice, in vivo (see Quirico page 32, second paragraph), thus indicating that the axl-148b chimeric complex was formulated as a pharmaceutical composition comprising at least a pharmaceutically acceptable vehicle, excipient or diluent, wherein the pharmaceutical composition is in a form suitable for intratumoral administration.
Therefore, Quirico anticipates the instant claims.
Claims 1-5, 10-12 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Quirico et al International Journal of Biological Sciences (Feb, 10, 2020), of record – IDS citation).
Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. As indicated above, in view of the fact that a certified translation of the foreign priority document has not been received, the effective filing date of the claimed invention is August 31, 2020; therefore, Quirico (Feb 2020) is applicable as prior art under 35 USC 102(a)(1).
Quirico teaches a chimeric complex comprising an aptamer directed towards AXL receptor tyrosine kinase, said aptamer comprising: augaucaaucgccucaauucgacaggaggcucac (SEQ ID NO: 1), XXXX (where Quirico defines X as “C3 carbon linker”, thus XXXX would be 4xC3s = 12 carbon unsubstituted linear alky chain), guacauucuagauagcc (SEQ ID NO: 2, a sticky sequence), a miRNA comprising a guide strand consisting of agucagugcaucacagaacuuugucuuu (SEQ ID NO: 3) and passenger strand consisting of aggugaaguucuguuauacacucaggcu (SEQ ID NO: 4) and ggcuaucuagaauguac (SEQ ID NO: 5 a sticky sequence complementary to SEQ ID NO; 2), see page 1240 under “Aptamer-miRNA conjugate preparations and binding”: GL21.T-sticky (AXL aptamer), miR-148b guide strand (3P), and miR-148b passenger strand (5P). Quirico teaches “All RNAs included modified 2’-F pyrimidines (2’F-Py) to improve stability” [2’-fluoro pyrimidines], and “Sticky sequences, consisting of 2’F-Py and 2’-O-Methylpurine (2’-OMe-Pu), are underlined.” (See page 1240). Thus Quirico teaches one or more pyrimidine bases in SEQ ID NO: 2 and SEQ ID NO: 5 are substituted with a corresponding 2’-fluropyrimidine, and one or more purine bases in SEQ ID NO: 2 and SEQ ID NO: 5 are substituted with a corresponding 2’-O-methylpurine, rendering the chimeric complex nuclease resistant. Quirico also teaches that the axl-148b (the chimeric complex comprising the axl-specific aptamer linked to miR-148 as described above) was injected into tumors in mice, in vivo (see page 1242, under In vivo tumor growth and metastasis assays), thus indicating that the axl-148b chimeric complex was formulated as a pharmaceutical composition comprising at least a pharmaceutically acceptable vehicle, excipient or diluent, wherein the pharmaceutical composition is in a form suitable for intratumoral administration.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-5, 10-12 are rejected under 35 U.S.C. 103 as being unpatentable over Russo et al. (Molecular Therapy Nucleic Acids (December 7, 2018), in view of Orso et al. (Cancer Research 2016, of record – IDS citation).
Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. As indicated above, in view of the fact that a certified translation of the foreign priority document has not been received, the effective filing date of the claimed invention is August 31, 2020; therefore, Russo et al. is applicable as prior art.
Russo teaches a chimeric complex comprising an aptamer directed towards AXL receptor tyrosine kinase, said aptamer comprising: augaucaaucgccucaauucgacaggaggcucac (SEQ ID NO: 1), XXXX (where Russo defines X as “C3 carbon linker”, thus XXXX would be 4xC3s = 12 carbon unsubstituted linear alky chain), guacauucuagauagcc (SEQ ID NO: 2, a sticky sequence), a miR-34c guide strand and miR-34c passenger sticky strand having ggcuaucuagaauguac (SEQ ID NO: 5 a sticky sequence complementary to SEQ ID NO; 2), see page 343 under “Aptamer-miRNA Chimera.” Russo teaches “All RNAs are modified with 2’-F pyrimidines” and “Stick sequences, consisting of 2’-F-Py and 2’-O-Me purine (2’-OMe-Pu), are underlined.” (See page 343). Thus Russo teaches one or more pyrimidine bases in SEQ ID NO: 2 and SEQ ID NO: 5 are substituted with a corresponding 2’-fluropyrimidine, and one or more purine bases in SEQ ID NO: 2 and SEQ ID NO: 5 are substituted with a corresponding 2’-O-methylpurine, rendering the chimeric complex nuclease resistant. Russo also teaches that the axl-miR-34c (the chimeric complex comprising the axl-specific aptamer linked to miR-34c as described above) was administered to cancer cells in vitro and resulted in inhibition of cell proliferation (see page 338, under “GL21.T/miR-34c Effects on Cell Growth and Migration” ad Figure 4).
Russo does not teach that the chimeric AXL-miRNA complex comprises miR-148b with guide strand SEQ ID NO: 3 and passenger strand SEQ ID NO: 4, or that the chimeric AXL-miRNA complex is formulated in a pharmaceutical composition comprising a pharmaceutically acceptable vehicle, carrier or diluent, and also formulated in a pharmaceutical form for intratumor administration.
Orso teaches that the miR-148b miRNA sequence can be used as an anticancer agent to inhibit cancer metastasis in mice (e.g., see abstract, page OF3 right column, Figure 1, page OF5 right column, etc.).
Therefore, it would have been prima facie obvious to one of ordinary skill in the art prior to the date the claimed invention was filed to modify the AXL aptamer/miRNA chimeric complex taught by Russo by substituting the miR-34c of Russo with the miR-148b taught by Orso, with a reasonable expectation of success. Furthermore, although Orso does not explicitly teach the nucleotide sequence of miR-148b, official notice is taken that the miR-148b sequence was well known prior to the date the invention was filed. Additionally, although the references do not explicitly teach formulation into a pharmaceutical composition with a pharmaceutical acceptable vehicle, carrier or diluent and in a pharmaceutical form suitable for intratumoral administration, official notice is also taken that formulation anticancer agents into pharmaceutical composition with a pharmaceutical acceptable vehicle, carrier or diluent and in a pharmaceutical form suitable for intratumoral administration was also well known prior to the filing of the claimed invention. It is noted that it would have been a matter of simple substitution of a known anticancer miRNA (miR-148b) for another (miR-34c) and there would have been a reasonable expectation of success based on the positive results reported by Russo and Orso. Furthermore one of ordinary skill in the art would have been formulated the AXL-miRNA chimeric complex into a pharmaceutical composition with a pharmaceutically acceptable carrier, vehicle or diluent and in a form suitable for intratumoral delivery so as to make an anticancer formulation that could be delivered to tumor cells in vivo with a reasonable expectation of success.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
J. E. Angell
Primary Examiner
Art Unit 1637
/J. E. ANGELL, Ph.D./Primary Examiner, Art Unit 1637