Prosecution Insights
Last updated: April 19, 2026
Application No. 17/640,759

METHOD FOR EVALUATING GENE EDITING THERAPY BASED ON OFF-TARGET ASSESSMENT

Non-Final OA §101§102§103§112
Filed
Mar 04, 2022
Examiner
ZAHORIK, AMANDA MARY
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Edigene (Guangzhou) Inc.
OA Round
1 (Non-Final)
61%
Grant Probability
Moderate
1-2
OA Rounds
2y 5m
To Grant
99%
With Interview

Examiner Intelligence

Grants 61% of resolved cases
61%
Career Allow Rate
36 granted / 59 resolved
+1.0% vs TC avg
Strong +53% interview lift
Without
With
+53.1%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
48 currently pending
Career history
107
Total Applications
across all art units

Statute-Specific Performance

§101
5.8%
-34.2% vs TC avg
§103
31.2%
-8.8% vs TC avg
§102
17.4%
-22.6% vs TC avg
§112
32.4%
-7.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 59 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received 07/05/2022 Claims 1-23, 26, 31 and 36 are currently pending. Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Objections to the Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see p. 36). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-2, 6-8, 12-23 and 26 are rejected under 35 U.S.C. 101 because the claimed invention is directed to an abstract idea without significantly more. Eligibility Analysis Regarding step 1 (MPEP 2106.03), the claims recite a method of determining suitability of a cell therapy, which is a process. Regarding step 2A prong one (MPEP 2106.04.II.A.1), the claim(s) recite(s) method of determining suitability of a cell therapy, comprising step a, determining occurrence of gene editing, and step b, assessing the suitability of therapy. This refers to a judicial exception because these are all mental processes which may be done in the human mind. The claims are also directed to a law of nature, which is the relationship between suitability for cell therapy (i.e., lack of genotoxicity) and the number of off-target edits present in the cell. Regarding step 2A prong two (MPEP 2106.04.II.A.2), the claim implicitly recites the additional elements of collecting a biological sample from the subject and genetically modifying a cell population in the sample. Step a also includes a step of ‘determining’, which inherently comprises analytical steps to observe the off target edits, such as through sequencing. However, these additional elements do not integrate the judicial exception into a practical application because they are merely data gathering steps, and are thus insignificant extra-solution activity. Please note that while the claim recites “wherein the cell therapy comprises administering a genetically modified cell population”, this is not interpreted as a step of the determining process. Rather, it is interpreted as describing or defining the cell therapy recited earlier in the claim. Regarding step 2B (MPEP 2106.05.B.II), the claim includes the additional elements described above, but those elements are not sufficient to amount to significantly more than the judicial exception because they are well-understood, routine and conventional steps recited at a high level of generality. For example, obtaining a biological sample and performing gene editing with CRISPR/Cas systems was well-known and routine prior to the filing date of the instant application, as demonstrated by Bauer and Humbert (discussed in the rejections of the claims under 35 U.S.C. 102/103 below). Claim 2 limits the timing on the determination step to before administration, but this does not integrate the judicial application into a practical application or amount to significantly more because it merely states when the mental process should be performed. Claims 6-8, similarly to claim 2, all recite different times when the mental process should be performed, but the timing of when the judicial exception is done does not integrate it into a practical application nor add elements that amount to significantly more, as described above. Claims 12-13 recite the additional elements of the number of off-target sites present and the amount of variation present, which themselves are natural phenomena and therefore judicial exceptions. Claims 14-20 recite additional elements of how the determination step is done, i.e., using DNA sequencing, amplification, and various in-vitro test methods. These elements do not amount to significantly more because they are all well-understood, routine and conventional. Further regarding claim 20, Fernández (Fernández et al. A history of genome editing in mammals. Mamm Genome (2017) 28:237–246.), evidences that both gene editing in general and CRISPR/Cas editing in particular were well-understood, routine and conventional procedures, stating, “Genome editing is now a routine procedure in many mammalian genetics laboratories” (Abstract) and, “The amazing plasticity and simplicity for generating CRISPR tools…along with their proven efficacy in promoting gene disruption (through NHEJ) or gene editing (through HDR, in the presence of exogenous DNA templates) has transformed the field and has positioned CRISPR as the most popular genomic-editing tool and the method of choice for gene editing.” The determination of off-target effects from CRISPR editing was likewise routine, as evidenced by the 2019 release of a commercial kit, rhAmpSeq, by Integrated DNA Technologies (Integrated DNA Technologies, Inc. “rhAmpSeq targeted amplicon sequencing system”. 2019). The brochure establishes that the system was intended to determine off-site CRISPR edits, stating, “CRISPR genome editing has recently become a dominant technology. However, CRISPR editing can produce unwanted off-target editing events. Custom rhAmpSeq Panels save time and resources by allowing you to quickly interrogate many CRISPR-edited sites simultaneously.” Lastly, the instant application evidences the routine nature of the determination step because claim 1 recites step a at such a high level of generality, reciting only the outcome without specifying how the determination is to be done, that it indicates that the procedure was sufficiently well-understood in the art that further specifics were not required. Claim 21 recites the target site, which is a natural phenomenon and therefore a judicial exception. Claim 22, similarly to claims 12-13, merely recites the naturally present off-target sites. Claims 23 and 26 recite the additional elements of identifying the off-target sites based on sequence similarity and/or using an in vitro test method. Claim 23 defines what the observed sequence variation indicates, i.e., that off-target editing has or has not occurred. The additional elements of the method steps are well-understood, routine, and conventional, as already described. Additionally, the correlation between observed sequence variation and off-target editing is a law of nature, and therefore a judicial exception. Claim 36 recites a method of treating an individual comprising determining suitability of cell therapy according to claim 1 and administering the cell population to the individual if it is suitable for cell therapy. The determination step is a mental process with steps described at a high level of generality without significantly more, as discussed above. The administration step, also as discussed above, amounts to mere instructions to apply the exception. Claims 3-4, 9-11 and 36 are excluded from the rejection because they integrate the judicial exception into a practical application which is a particular treatment or prophylaxis. Claim 5 is excluded by virtue of its dependency on claim 4. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 5, 12 and 22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 5 and 12 are unclear over recitation of the term “about at least” and “at least about”. This language is considered to be indefinite because it is a relative term and renders unclear where the lower bound of the range is. For example, claim 5 recites “about at least one month”. Does this mean that the frequency must be at least one month and no less than one month, or does this mean that it may be at least about one month, i.e., it may begin at 3 weeks or 5. Because it is the combination of “at least” and “about” in the same term that renders the claim indefinite, amending the claim to remove either “at least” or “about” would obviate this rejection. Claim 22 is indefinite because it incorporates a table by reference. MPEP 2173.05(s) states "Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim.” In the instant case, the invention may be defined in words by recitation of the specific target sequence(s). Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-3, 6, 9-23, 26, 31 and 36 are rejected under 35 U.S.C. 102(a)(1)/(2) as being anticipated by WIPO Publication 2018/218135 A1 to Bauer (published 11/29/2018, priority filing date 05/25/2017, hereinafter ‘Bauer’). Regarding claims 1 and 36, Bauer teaches a method for determining suitability of a cell therapy for an individual, the cell therapy comprising administering a genetically modified cell population from an individual to the individual, wherein the genetically modified cells are modified at a target site through gene editing: [0008] Provided here is an improved method of genome editing of the BCL11A's DHS +62, +58, and +55 functional regions, and the related reagents thereof. The improved method comprises selection-free conditions for Cas9:sgRNA ribonucleoprotein (RNP) electroporation of β-hemoglobinopathy patient-derived HSCs that induce highly efficient on-target editing, no off-target editing while lacking detectable genotoxicity. [0489] Amelioration of SCD. It was determined if this optimized BCL11A enhancer editing strategy could be effective in sickle cell disease (SCD) HSCs…Plerixafor-mobilized peripheral blood CD34.sup.+ HSPCs was obtained from a patient with SCD…94.2% indels at the BCL11A enhancer following RNP electroporation of CD34.sup.+ HSPCs was demonstrated…Similar human engraftment of edited and unedited SCD cells were observed (FIG. 15D). Edited SCD cells were competent for lymphoid, myeloid, and erythroid engraftment (FIG. 22B, 22C). Similar results when edited cells were infused 1 or 2 days following editing were observed (FIG. 22A-22D). Edited cells showed 95.1% indels after 16 weeks of bone marrow engraftment as compared to 94.2% indels in input cells (FIG. 15E)….The edited bone marrow SCD cells were able to support secondary transplantation to a similar level as unedited SCD cells, while maintaining a mean indel frequency of 98.1%, consistent with gene editing of self-renewing HSCs (FIG. 15I, 15J). [0475] Lack of detectable genotoxicity—One of the major concerns with therapeutic genome editing is the potential for off-target genotoxicity. Therefore, to test the specificity of the RNP sgRNA-1617, CIRCLE-sequencing was performed…20 potential off-target sites were defined…No identifiable or detectable off-target sites was observed for each studied Cas9-dependent indel, at the limit of detection of 0.1% allele frequency (data not shown)…In addition, amplicon deep sequencing was used to test four additional in silico predicted off-target sites not identified by CIRCLE-seq. No detectable indels was found at any of these sites (data not shown). Finally, targeted deep sequencing of edited CD34.sup.+ HSPCs was performed using a clinically approved 95-gene sequencing panel designed to identify recurrent somatically acquired hematologic malignancy associated mutations. Here again, no variant alleles was observed at any of these hematologic malignancy associated loci in the edited HSPCs (data not shown). Together these data indicate the absence of detectable genotoxicity attributable to our BCL11A enhancer editing approach. Bauer further teaches determining the occurrence of gene editing of each site in multiple off-target tagged sites in the genetically modified cells or offspring thereof, and assessing the suitability of the therapy based on the occurrence of gene editing, wherein the nonoccurrence of gene editing at any of the multiple off-target tagged sites indicates that the cell therapy is suitable for the individual (see above). Regarding claim 2, Bauer teaches wherein the determination step is conducted on the genetically modified cell before administering the genetically modified cells (see above) Regard claim 3, Bauer teaches the method further comprising administering the genetically modified cells to the individual (see above). Regarding claim 6, the broadest reasonable interpretation of the claim encompasses both simultaneous and sequential repetition. Bauer teaches the repetition of the determination and assessment steps one or more times, performing CIRCLE-seq, amplicon deep sequencing, and a gene sequencing panel. (see above). Regarding claims 9-11, Bauer teaches an intervention therapy after the assessment step, wherein the intervention therapy comprises removal of the edited cell population and administration of a second cell population from the individual (see above, the removal of edited offspring followed by secondary transplantation). Regarding claim 12, Bauer teaches wherein the multiple off-target tagged sites include at least about 10 sites (see above, and below): [0532] Amplicon deep sequencing—For indel frequencies or off-target analysis with deep sequencing, BCL11A enhancer loci or potential off-target loci were amplified with corresponding primers firstly (data S6). See also pp. 102-103, which list primers for off-target sites OT1-OT24. Regarding claim 13, Bauer teaches wherein sequence variation of less than 0.1% occurs at the off-target tagged sites, which indicates that no gene editing occurs at the off-target sites (see above) Regarding claim 14, Bauer teaches wherein the determination step is conducted through DNA sequencing (see above). Regarding claim 15, Bauer teaches wherein the determination step comprises amplifying nucleic acids comprising the off-target sites by using multiple primer sets and conducting sequence analysis on the amplified nucleic acids (see above). Regarding claim 16, Bauer teaches wherein the determination step is conducted through Circle-seq (see above). Regarding claims 17-19, Applicant regards “saturation condition” to mean “a condition that more than 90% of effective cutting occurs at the target site in vitro. This is interpreted as encompassing methods where a nuclease is used to a cut a target site, and wherein the nuclease cuts on-target, rather than off-target, at least 90% of the time. Under that interpretation, insofar as Bauer teaches that, “No identifiable or detectable off-target sites was observed”, Bauer teaches that the method is conducted under a saturation condition per Applicant’s definition. Regarding claim 20, Bauer teaches wherein the genetically modified cells are modified by the CRISPR/Cas system (see above). Regarding claim 21, Bauer teaches wherein the target sites are located at BCL11A gene loci (see above]). Regarding claim 22, Bauer teaches off-target site OT1, which has 100% identity to POT-40, a.k.a. SEQ ID NO: 158, from table 2: RESULT 1 NASEQ2_11152025_104418 Query Match 100.0%; Score 23; DB 1; Length 23; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATTACAGCTGCATTTATCACAGG 23 ||||||||||||||||||||||| Db 1 ATTACAGCTGCATTTATCACAGG 23 Regarding claim 23, insofar as Bauer teaches the method comprising determining the occurrence of gene editing of each site and teaches that sequence variation of less than 0.1% indicates that off-target gene editing has not occurred, Bauer teaches wherein, after the determination step, variation of more than 0.1% indicates that off-target editing has occurred. Regarding claim 26, Bauer teaches a method for obtaining multiple off-target tagged sites comprising identifying the sites based on their sequence similarity to the target (amplicon deep sequencing) and identifying second multiple off-target sites by using an in-vitro test method (sequencing panel, Circle-seq) (see above). Regarding claim 31, the broadest reasonable interpretation of a kit is a composition comprising the recited elements, i.e., the components of the gene editing system and primers. As discussed above, Bauer teaches composition comprising these components. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: Determining the scope and contents of the prior art. Ascertaining the differences between the prior art and the claims at issue. Resolving the level of ordinary skill in the pertinent art. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 4-5, 7-8 are rejected under 35 U.S.C. 103 as being unpatentable over U.S. PGPUB 2018/218135 A1 to Bauer, as applied to claims 1-3, 6, 9-23, 26, 31 and 36 above, in view of Humbert (Humbert et al. Therapeutically relevant engraftment of a CRISPR/Cas9-edited HSC-enriched population with HbF reactivation in nonhuman primates. Published in final edited form as: Sci Transl Med. 2019 Jul 31;11(503):eaaw3768.). Bauer anticipates the invention of claim 1, from which the instantly rejected claims depend, as described above. Bauer does not teach wherein the determination is conducted on the offspring of the modified cells after administration. Regarding claim 4, Humbert teaches a method of determining off-target editing in cells for autologous cell therapy to treat β-hemoglobinopathy, analogously to Bauer, and further teaches wherein the determination step is conducted on the offspring of the genetically modified cell after administering the genetically modified cells: Here, we evaluated the therapeutic potential of hematopoietic stem and progenitor cells (HSPCs) edited with the CRISPR/Cas9 nuclease platform to recapitulate naturally occurring mutations identified in individuals who express increased amounts of HbF, a condition known as hereditary persistence of HbF. CRISPR/Cas9 treatment and transplantation of HSPCs purified on the basis of surface expression of the CD34 receptor in a nonhuman primate (NHP) autologous transplantation model resulted in up to 30% engraftment of gene-edited cells for >1 year (Abstract). To further evaluate safety, the off-target (OT) activity of our CRISPR-Cas9 approach was measured by next-generation sequencing analysis of 35 potential OT sites determined in the rhesus macaque reference genome…Cells from the infusion product (day 0) as well as PB sampled at about 150 days after transplant were sequenced in two animals from each experimental cohort.(Safety of HBG-directed CRISPR-Cas9 gene editing, p 5/13) Regarding claims 5 and 7, Humbert teaches wherein the determination step is conducted within about at least one month after the administration, and repeated at a frequency of about once every month to about once every year (150 days, see above). Regarding claim 8, Bauer teaches the same limitations as recited in claim 23, and as described above. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the method as taught by Bauer to include multiple follow-up assessments of both on-target and off-target editing, to determine both the long-term persistence and genotoxicity of the gene therapy. While they do not teach varying the determination and assessment steps based on the sequence variation, based on common sense and sound scientific reasoning, one having ordinary skill would have recognized that if an assessment shows increased genotoxicity in a patient, then that patient should be more closely and frequently monitored than a patient which does not show increased genotoxicity. Thus in regard to the limitations of the claims, where the prior art teaches methods of assessing off-target and on-target editing after CRISPR/Cas therapy to treat a genetic disease, and teaches varying time points at which the method may be repeated, depending on individual study goals and assessment results, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp for optimization of the timing of follow-up testing. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense to provide routine optimization. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.M.Z./Examiner, Art Unit 1636 /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Mar 04, 2022
Application Filed
Nov 18, 2025
Non-Final Rejection — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12545941
MGAT1 DEFICIENT CELLS AND USES THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12533423
NEUROPROTECTIVE GENE THERAPY TARGETING THE AKT PATHWAY
2y 5m to grant Granted Jan 27, 2026
Patent 12522835
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12516332
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 06, 2026
Patent 12509677
PROBIOTIC STRAINS HAVING INCREASED STORAGE STABILITY
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
61%
Grant Probability
99%
With Interview (+53.1%)
2y 5m
Median Time to Grant
Low
PTA Risk
Based on 59 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month