DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Application
2. Claims 1-14, 16-22, and 24 are pending.
3. Claims 1-14, 16-22, and 24 are examined herein.
4. The objection to claim 4 is withdrawn in view of Applicant’s amendments to the claim.
Election/Restrictions
5. Applicant’s election of SEQ ID NO: 2 and the W1999S substitution as species in the reply filed on January 17, 2024 is acknowledged. Because Applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Given that the examination uncovered art applicable to substitution W1999C, which is the substitution present in the plant of elite sorghum line BTX430-CHR-ACC1, the line that is recited in the instant claims, that substitution was also examined in the previous Office Actions.
Claim Interpretation
6. The following is noted with regard to claim interpretation.
The claims are drawn to a plant of “elite sorghum line BTX430-CHR-ACC1,” its seeds, parts and method of using it. The specification teaches that said line was obtained from inbred sorghum variety “BTX430” by applying herbicide selection pressure and regenerating, from the surviving calli, sorghum plants that were tolerant to ACCase inhibitors (Example 1). From Example 1, including paragraph 0156, it appears that the plants obtained by EMS mutagenesis were not selected for a deposit.
The specification teaches sequencing the CT domain of the endogenous ACCase gene for mutations and identifying the TGG to TGC mutation that resulted in the W1999C substitution in the ACCase. The nucleic acid comprising said mutation and encoding the mutant CT domain is SEQ ID NO: 2 (paragraph 0160). Applicant appears to have identified a number of plants comprising the W1999C substitution either in heterozygous or homozygous form (Examples 2 and 3). The specificaiton also teaches that plants homozygous for said mutation showed “complete herbicide resistance” to a 2x rate of Assure (Figures 13-14 and figure legend on page 14).
The specificaiton does not appear to teach whether in the deposited plants BTX430-CHR-ACC1 the mutation is present in homozygous or heterozygous form, nor which one of the mutagenizes lines taught in Examples 1 and 2 was chosen for the deposit and designated “BTX430-CHR-ACC1.” Moreover, the specification does not describe any traits or any structures present in sorghum designated BTX430-CHR-ACC1 besides the presence of the W1999C substitution.
In view of the above, it is understood that a sorghum plant that differs from the starting line BTX430 by the presence of a mutation that results in the W1999C substitution would read on the sorghum plant BTX430-CHR-ACC1.
With regard to the sequences, the specification teaches that SEQ ID NO: 1 represents the wild-type (unmodified) ACCase sorghum gene from sorghum line BTX430 (paragraph 0160). Thus, SEQ ID NO: 1 will be inherently present in a sorghum plant of line BTX430. SEQ ID NO: 2 differs from SEQ ID NO: 1 solely by a single nucleotide substitution TGG to TGC that results in the tryptophan to cysteine amino acid substitution at the relative position 1999 in the encoded ACCase (paragraph 0160).
The amended claims refer to SEQ ID NO: 7. The specification teaches that SEQ ID NO: 7 is the amino acid sequence of the CT domain of the sorghum ACCase, which CT domain already comprises the W1999C substitution (see page 30). While the specification does not expressly refer to position 297, the sequence listing entry for SEQ ID NO: 7 indicates the presence of a cysteine in that position. Thus, SEQ ID NO: 7 is understood to represent the mutated CT domain of the full-length sorghum ACCase, wherein the wild-type ACCase is encoded by SEQ ID NO: 1, with position 297 corresponding to position 1999 in the blackgrass numbering. It is also noted that the specification does not appear to have supplied the amino acid sequence for the wild-type or mutated full-length ACCase of sorghum.
Claim Rejections - 35 USC § 103
7. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
8. Claims 1-14, 16-22, and 24 remain rejected under 35 U.S.C. 103 as being unpatentable over Tuinstra et al (US Patent Publication US 2010/0293628, published November 18, 2010, issued as US Patent 9,617,530 on April 11, 2017), Hawkes et al (WIPO Publication WO 98/54330, published December 3, 1998), Xu et al (Pest Manag. Sci. (2014) 70:1894-1901), and Trieu et al (US Patent Publication 2013/0025003, published January 24, 2013). Applicant’s arguments submitted on February 6, 2026 were fully considered but they are not persuasive.
Tuinstra et al teach wild sorghum plant and sorghum hybrid plants comprising a mutant ACCase with the tryptophan to cysteine substitution at the position corresponding to position 2027 of blackgrass (Examples 1-3; claims 1-5). Tuinstra et al teach, at SEQ ID NO: 1, a nucleic acid of the sorghum ACCase gene comprising a mutation that results in the W2027C substitution in the encoded ACCase (Example 3). Tuinstra et al teach introducing a transgene encoding a mutant ACCase directly into a sorghum plant via transformation, and teach various transformation methods (paragraphs 0073-0082, for example). Tuinstra et al also teach introgressing said ACCase from a wild sorghum into elite lines (Examples 1-2). Tuinstra et al teach plants heterozygous for said mutation and teach standard backcrossing techniques to obtain homozygous plants (paragraphs 0052-0057). Tuinstra et al teach ACCase inhibitor herbicides that can be used in methods of weed control, including fenoxaprop-p-ethyl (paragraph 0049).
Tuinstra et al teach applying herbicide selection pressure to Tx2783, an herbicide susceptible elide sorghum genotype, wherein the ACCase inhibitor clethodim was applied with the surviving plants selected (Example 1). Tuinstra et al teach selecting the surviving mutated plants and sequencing their ACCase to determine the presence of specific herbicide tolerance mutations (Examples 1 and 3). Tuinstra et al teach crossing one of the wild herbicide tolerance sorghum plants obtained after herbicide pressure screening with elite sorghum lines to obtain F1 hybrids (Example 2).
Tuinstra et al teach, at SEQ ID NO: 1, a nucleic acid sequence of the conserved CT domain of sorghum ACCase, which besides the wild-type TGG codon at the position encoding tryptophan 1999 and the unidentified nucleotide “N” is otherwise identical to the portion of the instant SEQ ID NO: 2 that encodes the domain of the enzyme that comprises W1999. As discussed in the Claim Interpretation section above, position 1999 corresponds to position 297 of SEQ ID NO: 7. The sequence alignment is set forth below.
Sequence 1, US/12013142C
Patent No. 9617530
GENERAL INFORMATION
APPLICANT: Kansas State University Research Foundation
APPLICANT: Tuinstra, Mitchell
APPLICANT: Al-Khatib, Kassim
TITLE OF INVENTION: Acetyl-CoA Carboxylase Herbicide Resistant Sorghum
FILE REFERENCE: KSURF-13408/US-1/ORD
CURRENT APPLICATION NUMBER: US/12/013,142C
CURRENT FILING DATE: 2016-03-11
PRIOR APPLICATION NUMBER: US 60/880125
PRIOR FILING DATE: 2007-01-12
NUMBER OF SEQ ID NOS: 13
SEQ ID NO 1
LENGTH: 1664
TYPE: DNA
ORGANISM: Sorghum bicolor
FEATURE:
NAME/KEY: misc_feature
LOCATION: (13)..(13)
OTHER INFORMATION: N = a, c, t or g
Query Match 59.3%; Score 1105.4; Length 1664;
Best Local Similarity 99.8%;
Matches 1106; Conservative 0; Mismatches 2; Indels 0; Gaps 0;
Qy 756 TGGCAGAGCAAAGCTTGGAGGAATTCCTGTGGGTGTCATAGCTGTGGAGACACAGACCAT 815
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Db 1 TGGCAGAGCAAANCTTGGAGGAATTCCTGTGGGTGTCATAGCTGTGGAGACACAGACCAT 60
Qy 816 GATGCAGCTTGTCCCTGCTGATCCAGGTCAGCTTGATTCCCATGAGCGATCCGTTCCTCG 875
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GATGCAGCTTGTCCCTGCTGATCCAGGTCAGCTTGATTCCCATGAGCGATCCGTTCCTCG 120
Qy 876 GGCTGGACAAGTGTGCTTCCCAGATTCTGCAACCAAGACAGCTCAGGCATTATTAGACTT 935
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Db 121 GGCTGGACAAGTGTGGTTCCCAGATTCTGCAACCAAGACAGCTCAGGCATTATTAGACTT 180
Qy 936 CAACCGTGAAGGATTGCCTCTGTTTATCCTGGCTAACTGGAGAGGTTTCTCTGGTGGACA 995
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CAACCGTGAAGGATTGCCTCTGTTTATCCTGGCTAACTGGAGAGGTTTCTCTGGTGGACA 240
Qy 996 GAGAGATCTCTTTGAAGGAATTCTTCAGGCTGGGTCAACAATTGTCGAGAACCTTAGGAC 1055
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GAGAGATCTCTTTGAAGGAATTCTTCAGGCTGGGTCAACAATTGTCGAGAACCTTAGGAC 300
Qy 1056 ATATAATCAGCCTGCGTTTGTCTACATTCCTATGGCTGGAGAGCTTCGTGGAGGAGCTTG 1115
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 ATATAATCAGCCTGCGTTTGTCTACATTCCTATGGCTGGAGAGCTTCGTGGAGGAGCTTG 360
Qy 1116 GGTTGTGGTCGATAGCAAAATAAATCCAGACCGCATTGAGTGTTATGCTGAGAGGACTGC 1175
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 GGTTGTGGTCGATAGCAAAATAAATCCAGACCGCATTGAGTGTTATGCTGAGAGGACTGC 420
Qy 1176 CAAAGGTAATGTTCTCGAACCTCAAGGGTTAATTGAAATCAAGTTCAGGTCAGAGGAACT 1235
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 CAAAGGTAATGTTCTCGAACCTCAAGGGTTAATTGAAATCAAGTTCAGGTCAGAGGAACT 480
Qy 1236 CCAAGACTGTATGGGTAGGCTTGACCCCGAGTTGATAAATCTGAAAGCAAAACTCCAAGA 1295
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 CCAAGACTGTATGGGTAGGCTTGACCCCGAGTTGATAAATCTGAAAGCAAAACTCCAAGA 540
Qy 1296 TGTAAAGCATGGAAATGGAAGTCTACCAGACATAGAATCCCTTCAGAAGAGTATAGAAGC 1355
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 TGTAAAGCATGGAAATGGAAGTCTACCAGACATAGAATCCCTTCAGAAGAGTATAGAAGC 600
Qy 1356 ACGTACGAAACAGTTGCTGCCTTTATATACCCAGATTGCAATACGGTTTGCTGAATTGCA 1415
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 ACGTACGAAACAGTTGCTGCCTTTATATACCCAGATTGCAATACGGTTTGCTGAATTGCA 660
Qy 1416 TGATACTTCCCTAAGAATGGCAGCTAAAGGCGTGATTAAGAAAGTTGTAGACTGGGAAGA 1475
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 TGATACTTCCCTAAGAATGGCAGCTAAAGGCGTGATTAAGAAAGTTGTAGACTGGGAAGA 720
Qy 1476 ATCACGCTCTTTCTTCTATAAAAGGCTACGGAGAAGGATCTCTGAAGATGTTCTTGCAAA 1535
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 ATCACGCTCTTTCTTCTATAAAAGGCTACGGAGAAGGATCTCTGAAGATGTTCTTGCAAA 780
Qy 1536 AGAAATAAGACATATAGTCGGTGACAACTTCACTCACCAATCAGCAATGGAGCTCATCAA 1595
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 AGAAATAAGACATATAGTCGGTGACAACTTCACTCACCAATCAGCAATGGAGCTCATCAA 840
Qy 1596 GGAATGGTACCTGGCTTCTCCAGCCACAGCAGGAAGCACTGGATGGGATGACGATGATGC 1655
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 GGAATGGTACCTGGCTTCTCCAGCCACAGCAGGAAGCACTGGATGGGATGACGATGATGC 900
Qy 1656 ATTTGTTGCCTGGAAGGACAGTCCTGAAAACTACAATGGATATATCCAAGAGCTAAGGGC 1715
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 ATTTGTTGCCTGGAAGGACAGTCCTGAAAACTACAATGGATATATCCAAGAGCTAAGGGC 960
Qy 1716 TCAAAAAGTGTCTCAGTCGCTCTCTGATCTCACTGACTCCAGTTCAGATCTACAAGCATT 1775
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 961 TCAAAAAGTGTCTCAGTCGCTCTCTGATCTCACTGACTCCAGTTCAGATCTACAAGCATT 1020
Qy 1776 CTCGCAGGGTCTTTCTACGCTATTAGATAAGATGGATCCCTCTCAAAGAGCGAAGTTTGT 1835
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 CTCGCAGGGTCTTTCTACGCTATTAGATAAGATGGATCCCTCTCAAAGAGCGAAGTTTGT 1080
Qy 1836 TCAGGAAGTCAAGAAGGTCCTTGGTTGA 1863
||||||||||||||||||||||||||||
Db 1081 TCAGGAAGTCAAGAAGGTCCTTGGTTGA 1108
Hawkes et al teach a chimeric oligonucleotide-based method of producing herbicide resistant plants by modifying in a plant cell, in situ, an endogenous gene responsible for herbicide resistance, including an ACCase gene (Hawkes et al, claims 1, 6, 8). Hawkes et al teach applying said method to sorghum (page 3, lines 13-18; claim 16). Hawkes et al teach using the resultant plants in a method of controlling weeds, which comprises applying to the field where said plants are growing a herbicide to which said plants have been rendered resistant (Hawkes et al, claims 18 and 19).
Xu et al teach the W1999C substitution is naturally occurring in herbicide tolerant population of the Japanese foxtail (Alopecurus japonicus), and teach that plants comprising it were tolerant to fenoxaprop, including wherein the plants were treated with the recommended dose of 62 g ai/ha (69 g/L) of fenoxaprop (page 1896, left col.; Fig. 2; Fig. 5). Xu et al teach that the W1999C substitution conferred tolerance only to fenoxaprop and moderate tolerance to pinoxaden, and not to other ACCase inhibitors (pg. 1900, left col.). Xu et al teach that fenoxaprop is commonly used to control grass weed species (pg. 1898, right col.). Xu et al teach using primers directed against conserved regions of the ACCase gene to detect the mutation encoding the W1999C amino acid substitution (pg. 1895, right col.).
Trieu et al teach a method of transforming sorghum calli and successfully regenerating plants form said transformed calli (Examples 1-4; claims 1-15). Trieu et al teach using in their methods transformation vectors encoding polypeptides conferring herbicide resistance, including there the resistance is conferred by an altered ACCase (paragraphs 0059-0061). Trieu et al teach using said method with the BTX430 inbred sorghum line (paragraph 0004; Example 1).
Trieu et al teach introducing a number of transgenes of interest using the methods of their invention, including wherein a transgene encodes a polypeptide conferring pest resistance or male sterility (paragraphs 0063-0065, for example).
At the time of filing, it would have been prima facie obvious to one of ordinary skill in the art to modify the teachings of Tuinstra et al, using the method of Hawkes et al, and introduce a mutation encoding the W1999C substitution taught by Xu et al into the endogenous ACCase gene of a sorghum plant, including a plant of the BTX430 line taught by Trieu et al. It would have been obvious to use the sequence information and/or the primers taught by Tuinstra et al to determine the nucleic acid sequence of the CT domain of an endogenous ACCase gene in any sorghum line, including BTX430.
Given the evidence of the instant specification that the BTX430 line comprises the wild-type version of the instant SEQ ID NO: 2 (SEQ ID NO: 1), the BTX430-derived plant thus obtained will necessarily comprise a nucleic acid sequence identical to the full-length SEQ ID NO: 2 of the instant claims, wherein the mutant nucleic acid will encode the ACCase comprising the W1999C substitution. It is noted that tryptophan has only one codon, TGG, while cysteine only two codons, TGT and TGC. Therefore, there would have been only two possible nucleotide substitutions at the third nucleotide to produce the mutation at issue. The resultant plant and their parts or seeds would read on the subject matter of the instant claims 1, 3, 4, and 12.
It would have been obvious to use the resultant plant in a method of isolating nucleic acids, including the nucleic acid encoding the mutant ACCase (said nucleic acid being identical to the instant SEQ ID NO: 2) - for example, in order to screen for the presence of said substitution, using the methods and primers taught by Tuinstra et al and Trieu et al (instant claims 21 and 22).
It would have been further prima facie obvious to use said plant in a breeding program, including introgression breeding, to obtain F1 hybrid plants when crossed with a second line (including the subsequent harvesting of the F1 seeds), or to introgress a transgene of interest, including a transgene conferring a pest resistance or male sterility, as suggested by Trieu et al. Moreover, it would have been obvious to introgress, via backcrossing, the mutant ACCase gene comprising the W1999C substitution into a different elite sorghum line, such as Tx2783, an herbicide susceptible line taught by Tuinstra et al, thus obtaining an inbred variety that would comprise the ACCase tolerance trait from said modified BTX430 line (instant claims 5, 8-11, 13, 14, 16, 17, 20, and 24). .
Obtaining a commodity product, such as grain, would have been obvious given that sorghum is a grain crop. Obtaining a composition wherein said resultant plant or its part is comprised soil or growth media would have been similarly obvious in view of Trieu et al and as matter of standard practice (instant claims 6, 7, and 18-19).
One would have been motivated to combine said teachings, given the teachings of Xu et al and the desirability of an ACCase inhibitor tolerant sorghum, as taught by Tuinstra et al. One would have been motivated to specifically introduce the W1999C substitution in order to be able to selectively use fenoxaprop, for example, a common herbicide, to control grass weeds in sorghum fields. One would have been motivated to use BTX430 given that it is a well-known herbicide susceptible variety, and is expressly taught by Trieu et al.
Given the fact that Hawkes et al, Tuinstra et al and Trieu et al reduced their inventions to practice, and given the teachings of Xu et al regarding the herbicide tolerance characteristics of the plants comprising the W1999C substitution, one would have had reasonable expectation of success.
Response to Arguments
Applicant argues as follows: “the sorghum line BTX430-CHR-ACC1 is distinct from sorghum parent line BTX430. In particular, the sorghum line BTX430-CHR-ACC1 possesses distinct physiological and morphological characteristics that are different from those of the sorghum parent line BTX430, which are characteristics that are in addition to the herbicide tolerance characteristics and comprising a mutation in the ACC gene. Applicant respectfully submits that the sorghum parent line BTX430 is an established line and its physiological and morphological characteristics are well-known to those skilled in the art. See Office Action mailed August 8, 2025, Page 9 ("Trieu et al teach using said method with the BTX430 inbred sorghum line."). As acknowledged by the Office, Applicant provided two Declarations Under 37 C.F.R. § 1.132 of inventor Scott Staggenborg describing inherited physiological and morphological characteristics of sorghum deposited line BTX430-CHR-ACC1 plants, which is an inbred line that is uniform and stable. Thus, those skilled in the art would readily understand that the sorghum deposited line BTX430-CHR-ACC1 is distinguishable from BTX430 plants, beyond the herbicide tolerance characteristic. Accordingly, the different traits of the sorghum deposited line BTX430-CHR-ACC1 are non-obvious over the cited art” (pages 7-8 of the Remarks).
Applicant’s argument is not found to be persuasive. To the extent that the Applicant’s remarks reiterate previously submitted arguments, those remain not persuasive for the reasons of record. This includes the arguments based on the Declarations previously submitted under 37 C.F.R. 1.132 which Declarations were found not sufficient to overcome the rejection.
The Examiner maintains that neither the evidence in the Declarations nor elsewhere in the record, including the instantly submitted Remarks, explain how or whether the traits listed in the table in the first Declaration differ from the traits of the wild-type sorghum variety BTX430, a known variety. More importantly, there is no showing anywhere in the record that even if present, such differences in traits would be considered non-obvious over the cited art. See MPEP 716.02. This is contrary to Applicant’s argument, above, that “those skilled in the art would readily understand that the sorghum deposited line BTX430-CHR-ACC1 distinguishable from BTX430 plants beyond the herbicide tolerance characteristic.” Applicant provides no explanation of the reasoning supporting that conclusion.
The Examiner maintains that the presence of the W1999C substitution and the resultant is the only trait that the specificaiton provides for the deposited line, and the only apparent difference from a commercial variety. Introducing a known herbicide tolerance substitution into a known inbred sorghum line would have been desirable and readily achievable using methods known in the art at the time of filing. This is sufficient for the prima facie finding of obviousness.
The rejection need not address any existent or non-existent differences between the resultant prima facie obvious sorghum and the BTX430 line – other than the presence of the W1999C substitution, the only trait described in the specification for the claimed plants. To the extent that Applicant is attempting to rely on any such differences to support the argument of non-obviousness, the applicable legal precedent states that the burden is on Applicant, not Examiner, to establish that any such differences are “in fact unexpected and unobvious and of both statistical and practical significance." Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992). MPEP 716.02(d). No such showing has been made by Applicant in the instant case.
The Examiner also maintains that the previously addressed argument directed to the fitness costs of introducing the W1999C substitution into sorghum was submitted by Applicant during the prosecution history of the parent application 15/993,081, of which the instant one is a continuation. That argument was addressed by the Patent Trial and Appeal Board in the Decision issued on July 30, 2025 in the parent application. In that Decision, the Board affirmed the Examiner’s prima facie finding of obviousness and rejected Applicant’s argument based on the fitness costs of the mutation. The Board’s decision and Examiner’s reasoning in that case directly apply to the instant application.
Specifically, the Board held as follows: “Liu, at best, suggests that when selective pressure, i.e. herbicidal application, is removed a homozygous W1999C mutation in sorghum could incur a significant fitness penalty on a plant carrying the mutant allele affecting its persistence in wild population (see Liu 3631). A person of ordinary skill in this art would not consider such a fitness penalty particularly relevant in crops that are not intended for persistence in a wild population or for removal of herbicidal application, e.g., selective pressure. This is consistent with Xu’s disclosure that “herbicide application patterns rather than a fitness cost were considered to be more important for the selection of specific mutations in grass weeds under herbicide pressure” (Xu 1900).” In addition, as discussed above, Liu infers that Tuinstra’s W2027C mutation would exhibit a similar fitness cost as observed with the W1999C mutations, yet Tuinstra established a reasonable expectation of success in producing a sorghum plant carrying a homozygous W2027C mutation that was resistant to aryloxyphenoxypropionate family herbicides, such as quizalofop-p-ethyl and fenoxaprop-p-ethyl. … Prior art is presumed to be enabled. See In re Antor Media Corp., 689 F.3d 1282, 1288 (Fed. Cir. 2012) (“[A] prior art printed publication cited by an examiner is presumptively enabling barring any showing to the contrary by a patent applicant or patentee”’) (pages 10-11 of the Board Decision issued on July 30, 2025, some original citations and emphasis omitted)
The Board further held as follows: “We are also not persuaded by Appellant’s contention regarding Wu’s disclosure “that no homozygous resistant (RR) individuals were found, and all resistant individuals were heterozygous (RS),” because of a “‘suspected ... fitness cost of homozygous W1999C mutations in Japanese foxtail may be more evident and RR individuals even can’t survive’” (Appeal Br. 11 (citing Wu pp. 657, 661, Figure 1; emphasis omitted)). Wu based its statements on results of “dCAPS procedures to identify the genotypes of biotype individuals based on the expression of two ACCase isoforms” (Wu p. 657). As discussed above, Xu, who also studied W1999C mutations in Japanese foxtail, disclosed the deficiencies in dCAPS procedures in identifying homozygous W1999C mutations, concluding “[t]his once again shows that it is not possible to discriminate true (allelic) heterozygotes from homoeoallelic heterozygotes in polyploid species simply by PCR-based gene-specific molecular markers designed against conserved regions of herbicide target genes” (Xu 1900; see generally Ans. 14-17)” (page 11 of the Board Decision, some original citations and emphasis omitted).
The Board’s reasoning with regard to the teachings of Xu et al, Liu et al, and the importance of herbicide selection pressure applies to Applicant’s argument based on Alarcon-Reverte as well. Moreover, the Examiner addressed that argument in the Final Office Action issued in the parent application on August 29, 2025. The Examiner maintains that the rarity of the W1999C substitution in the wild-type weed populations (including as taught in the Alarcon-Reverte article) would not have taught away from the instant sorghum plants.
In the teaching away analysis, a nature of teachings is highly relevant. For example, “the prior art’s mere disclosure of more than one alternative does not constitute a teaching away from any of these alternatives because such disclosure does not criticize, discredit, or otherwise discourage the solution claimed….” In re Fulton, 391 F.3d 1195, 1201, 73 USPQ2d 1141, 1146 (Fed. Cir. 2004) (emphasis supplied). See MPEP 2145.
In the instant case, while the prior art does provide some evidence regarding the negative effects of the W1999C mutation in non-sorghum weeds, it cannot be reasonably interpreted as discouraging one of skill in the art from introducing said mutation into sorghum. The Examiner also notes that “Obviousness does not require absolute predictability of success. Indeed, for many inventions that seem quite obvious, there is no absolute predictability of success until the invention is reduced to practice. ... For obviousness under § 103, all that is required is a reasonable expectation of success” (In re O'Farrell, 853 F1894, 903-904 (Fed. Cir. 1988). The rejection is maintained.
Conclusion
9. No claims are allowed.
10. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
11. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MYKOLA V KOVALENKO whose telephone number is (571)272-6921. The examiner can normally be reached Mon.-Fri. 9:00-5:30 PST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at (571)270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
12. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MYKOLA V. KOVALENKO/Primary Examiner, Art Unit 1662
Prosecution Insights