Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 04 September 2026 has been entered.
Claim Status
Claims 1, 7, 10-12, 20, 24-26, 28, 30-31, 36-37, 117-119 and 121-125 are pending. Claims 1, 7, 10-12, 20, 24-26, 28, and 117 are withdrawn. Claims 30-31, 36-37, 118-119 and 121-125 are examined to the extent of the elected species CKX3.
All previous rejections not set forth below have been withdrawn.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claim Rejections - 35 USC § 112(a)
Claims 30-31, 36-37, 118-119 and 121-125 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 30-31, 36-37, 118-119 and 121-125 are broadly drawn to mutating an endogenous soybean CKX3 gene having as little as 80% sequence identity to the nucleotide sequence of SEQ ID NO:78, comprises a sequence having as little as 80% sequence identity to the nucleotide sequence of SEQ ID NO:79, or encodes a polypeptide having as little as 80% sequence identity to the amino acid sequence of SEQ ID NO:80, wherein the target site is within a region of the CKX3 gene, the region of the CKX3 gene comprising a sequence having as little as 80% sequence identity to a sequence comprising: nucleotide 692 to nucleotide 826 of the nucleotide sequence of SEQ ID NO:78 or nucleotide 35 to nucleotide 169 of the nucleotide sequence of SEQ ID NO:79.
For clarification, SEQ ID NO:78 is the genomic DNA for the endogenous CKX3 sequence, and SEQ ID NO:79 is the cDNA sequence encoding the polypeptide of SEQ ID NO:80. SEQ ID NO:95 is the target site spanning positions 35-169 of SEQ ID NO:79 or positions 692-826 of SEQ ID NO:78.
The claim further comprises a null mutation in at least one additional endogenous CKX1, CKX2, CKX4, and/or CKX6 gene and wherein the soybean plant exhibits increased seed number, increased height, increased nodes on the mainstem, increased number of pods on the mainstem, and/or decreased number of pods on branches as compared to a control soybean plant.
The specification describes mutations of six soybean (Glycine max) CKX genes (CKX1-6) from six different loci, the start position of the deletion corresponding to the wild-type CKX gene, and the deletion length (see Example 1),
In Example 2, mutant plant CE20600 (CKX2 and CKX3 knock-outs) had an increase in the number of seeds per pod. CE20600 plants were taller and had an increase in the number of pods and the number of nodes on the mainstem (due to being taller). However, there was no difference in the number of seeds per plant, number of branches, number of nodes or the number of pods between CE20600 and control. Additionally, the seed weight of 100 seeds for the mutant CE20600 was less than that of the control.
In Example 3, mutant plants CE48101 (CKX1, CKX3, and CKX6 knock-outs), and CE48659 (CKX1, CKX3, and CKX5 knock-outs) were analyzed for phenotypes. There were no differences between CE48101 and CE48659 when compared to control, except for the decrease in the number of nodes on the mainstem in the CE48659 (CKX1/3, CKX1/3/5, and CKX3/5 knock-outs) segregating family.
In Example 5, mutant plants CE29267 (CKX3 and CKX4 knock-outs), CE27443 (CKX2 and CKX3 knock-outs), and CE29257 (CKX2, CKX3, and CKX4 knock-outs) were analyzed for phenotypes. There was no difference of seeds per pod when comparing the mutant plants against the control. For CE29267, there was an increase of number of pods per node on the mainstem and total pods on the mainstem, however, there was a decrease in the pods on branches as compared to control. There was no increase in total pod count or plant height for any of the lines CE29267, CE27443 or CE29257 compared to control. Mutant plant CE29267 (CKX3 and CKX4 knock-outs) shows architectural changes in the plant habit.
In Example 6, mutant plants CE31532 and CE31492 (CKX1, CKX3, and CKX6 knock-outs) were analyzed for phenotypes. There was no difference in the average number of seeds per pod when comparing CE31532 or CE31492 to control. There was a lower seed count per plant and a lower pod count per branch compared to control. CE31532 showed an increase in number of nodes on the mainstem and increase in height, which accounts for the increase in the number of nodes compared to control. Mutant plants CE31532 and CE31492 (CKX1, CKX3, and CKX6 knock-outs) show architectural changes in the plant habit.
In Example 7, mutant plants CE48618, CE48108, and CE48637 (CKX1, CKX3, CKX5, and CKX6 knock-outs) were analyzed for phenotypes. There was no difference in the number of seeds per plant or in number of seeds per pod. CE48108 (CKX1, CKX3, CKX5, and CKX6 knock-outs) shows architectural changes in plant habitat, however, sample size was too small to reach conclusive results.
In Example 8, mutant plant CE20753 (CKX1 and CKX3 knock-outs) was analyzed for phenotypes. There was lower average number of seeds per pod and the number of seeds per plant compared to the control line. There was no difference in total number of pods per plant, average number of pods per node on the mainstem, or number of pods on the mainstem. The mutant plant CE20753 (CKX1 and CKX3 knock-outs) showed no difference in count of pods on branch or for plant height between edited progeny and control.
In Example 9, mutant plant CE29233 (CKX1, CKX2, CKX3, and CKX4 knock-outs) was analyzed for phenotypes. For the segregated mutant plant CE29233 (CKX2 and CKX4 knock-outs) there was an increase in the average number of pods per node on the mainstem, number of pods on the mainstem and number of nodes on the mainstem compared to the control. There was a decrease in the average number of seeds per pod, number of seeds per plant, and number of pods on branches for segregated mutant plant CE29233 (CKX2 and CKX4 knock-outs). Mutant plant CE29233 (CKX2/4 and CKX1/2/4 knock-outs) showed an increase in the number of pods and nodes on the mainstem, however, there was a decrease in number of pods on branches compared to the control. The results for CE29233 (CKX2/4 and CKX1/2/4 knock-outs) segregating family did not include the elected CKX3 gene.
In Example 10, mutant plant CE31638 (CKX1, CKX3, CKX5, and CKX6 knock-outs) was analyzed for phenotypes. For CE31638 (CKX1, CKX3, CKX5, and CKX6 knock-outs) there was no increase in any of the traits. For CE31638 (CKX1, CKX5, and CKX6 knock-out genes) segregating family there was a reduction in the number of pods on branches and the number of pods per plant but did not include CKX3. Mutant plant CE31638 (CKX1/3/5/6 and CKX1/5/6 knock-outs genes) segregating family shows changes in the plant habit.
The written description requirement may be satisfied through sufficient description of a representative number of species by disclosing relevant and identifying characteristics such as structural or other physical and/or chemical properties, by disclosing functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the invention as claimed. See Eli Lilly,119 F.3d at 1568, 43 USPQ2d at 1406.
Here, the claims encompass a vast genus of CKX3 genes as they may have as little as 80% sequence identity to SEQ ID NO: 78 or 79 or as little as 80% sequence identity to the amino acid sequence of SEQ ID NO: 80. Moreover, the claims fail to even recite the structure CK1, 2, 4 and 6 genes and thus encompass an exhaustive genus of structures for said genes.
Moreover, aside from describing the starting material of a CKX3 gene corresponding to “Glyma.17G054500” and which when targeted is expected to inhibit expression of SEQ ID NO: 78 (e.g., see Table 2; see also Example 2, ¶ 1), the specification fails to, in fact, describe, a representative number of structures from the exhaustive genus of CKX3 genes as broadly encompassed by the claims that are functional such that when they are mutated yield a plant with the phenotypes as claimed (e.g., see alignments in sequence search results).
Here, the claims encompass a nucleic acid sequence having as little as 80% identity to SEQ ID NO: 78 or 79, or encoding a polypeptide having as little as 80% identity to SEQ ID NO: 80 and thus requires the specification to describe nucleic acid sequences encoding such polypeptides.
These polynucleotide and polypeptides would encompass 31153, 31608 and 19107 distinct gene and protein variants, respectively. In the absence of describing where in the sequence of SEQ ID NO: 78, 79 and 80 such variations can be sustained, the skilled practitioner would not be of the opinion that Applicant possess the vast genus of CKX3 variants that are functional such when they are mutated produce plants with the traits as claimed.
This description is critical because the art describes that not all CKX3 genes when mutated would expect to predictably yield plants with the phenotypes as claimed. For example, Liu et al. describes how CKX3 genes differ in structure, function, expression levels and tissue location (Frontiers in Plant Science, Vol. 12, No. 749902, pp. 1-16, 29 Nov. 2021; See Figures 3, 4, Table 2, Results pages 6-9).
Specifically, Liu et al. describes that while 23 conserved motifs were identified GmCKX5 had no specific motifs, and the other GmCKX families had some specific motifs, i.e., motif15 is specific to GmCKX3a proteins, and motif19 is specific to GmCKX3b proteins, and that these specific motifs may be related to their specific functions (p. 7, col. 2, last ¶ bridging p. 8)
Liu et al. further describes GmCKX3b-1 is hardly expressed in each tissue, while GmCKX3a, GmCKX7-2, and GmCKX6-1 were expressed mainly in flowers, and GmCKX3b-2 and GmCKX3b-3 were expressed in root (p. 8, col. 1, ¶ 1).
Liu et al. also describes that Medtr4G126160 in Medicago truncatula has the highest homology with GmCKX3b-2 and GmCKX3b-3 and that the Medtr4G126160 mutant significantly reduced main root length and increased the number of lateral roots indicating an important role root development. Similarly, CKX3b in soybean and Medicago truncatula, the CKX3b genes were highly expressed in roots, which may play an important role in root development, while, in cowpea and kidney bean, the CKX3b genes were hardly expressed in various tissues (p. 8, col. 1, last ¶).
Liu et al. describes high expression of four CKX3a and no expression of two CKX5 and three CKX3 tandem-duplication-derived genes (CKX3b) in flowers (p. 13, col. 2, ¶ 2).
Or see Li et al. describing as recently as 2025 that while a great array of CKXs have been reported in various plants, including 7 CKXs in Arabidopsis, 11 CKXs in rice , 13 CKXs in maize, 11~14 CKXs in wheat, and 11 CKXs in barley a comprehensive functional characterization of most of these CKXs remains incomplete (Plants, 2025, (14) 2207:1-17; see p. 2, ¶ 1).
Furthermore, while the use of the full-length CKX sequences of Arabidopsis and rice as queries in a BLAST search uncovered 17 putative CKX genes soybean genome, there is little data elucidating the detailed mechanism through which GmCKXs impact the yield-related traits by regulating CKs in soybean (see p. 2, last ¶ bridging p. 3).
Thus, the art makes clear that not all CKX3 genes as broadly encompassed by the claims when mutated will confer the traits as claimed as CKX3b is found in roots and CKX5 is not expressed at all, and because the structure function correlation for CKX genes remains to be resolved.
Furthermore, and as noted above, the claims encompass additional endogenous CKX1, CKX2, CKX4, and/or CKX6 genes that are not claimed by any particular structure. The specification does not describe a representative number of species from the broad genus of other CKX gene structures that have functionality, and further fails to describe that when this genus of structures in mutated in conjunction with the genus of CKX3 gene structures as broadly claimed predictably results in plants with the phenotypes as claimed.
Therefore, in light of the breadth of the claims, the lack of working examples, the state of the art which fails to describe CKX structures required for function and that not all CKX3 genes are expected to influence the traits as claimed, the skilled practitioner would not be of the opinion that Applicant was in possession of the plants as broadly claimed.
Accordingly, there is lack of adequate description to inform a skilled artisan that Applicant was in possession of the claimed invention at the time of filing. See Written Description guidelines published in Federal Register/ Vol.66, No. 4/ Friday, January 5, 2001/ Notices; p. 1099-1111.
Response to Arguments
As the rejection of the claims is being reintroduced, and as courtesy to Applicant, the Office is responding to Applicant’s reply dated 28 July 2025 traversing the rejection of the claims for failing to comply with the requirements pursuant to 35 U.S.C. 112(a) in order to expedite prosecution.
Applicant traverses the rejection because the claims recite a structure for CKX3 (Applicant reply dated 28 July 2025, p. 13, ¶ 1).
This argument is not persuasive as the specification fails to describe, in fact, a representative number of species from the exhaustive genus of structures having as little as 80% sequence identity to SEQ ID NO: 78 or 79 or as little as 80% sequence identity to the amino acid sequence of SEQ ID NO: 80 that retain functional activity such that when they are mutated will predictably yield a plant with the traits as claimed.
Applicant argues that Liu describes that there are significant number of shared motifs amongst CKX3 genes and all CKX genes (Applicant reply dated 28 July 2025, p. 13, ¶ 2).
This argument is not persuasive because the specification fails to describe which domains or motifs are critical for functionality such that the skilled artisan would be unable to predictably mutate a CKX3 gene in the claimed region when it is not clear whether the CKX3 genes as broadly claimed retain functional activity. Moreover, Liu fails to describe the specific domains and motifs in CKX3 that confer function.
Applicant argues the claims comply with the written description requirement based on Example 11 of the Written Description Guidelines (Applicant reply dated 28 July 2025, p. 14, ¶ 1).
This argument is not persuasive because the claims are not merely directed to a structure without a recited function but are drawn to a genus of structures having implicit function that when mutated confer traits. As the Guidelines indicate, such a claim is not adequately described (e.g., see analysis for claim 2).
Applicant argues that the specification describes at least 30 plants comprising 39 distinct null alleles or knockout alleles of the gene (Applicant reply dated 28 July 2026, p. 14, last ¶).
This argument is not persuasive because it pertains to whether the mutated target regions are described and not to whether sequences having as little as 80% sequence identity to SEQ ID NO: 78, 79 or 80 are described.
Applicant asserts the specification provides genomic, protein and coding sequences for each additional CKX gene (Applicant reply dated 28 July 2026, p. 15, ¶ 1).
This argument is not persuasive because (1) it does not address the failure of the specification to describe sequences having as little as 80% sequence identity to SEQ ID NO: 78, 79 or 80 and (2) it does not address that single examples of additional CKX genes as it not representative of the entire genus of CKX genes as broadly claimed.
Claim Rejections - 35 USC § 112(a)
6. Claims 30-31, 36-37, 118- 119 and 121-125 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while arguably being enabling for introducing specific mutations into the region as claimed in “Glyma.17G054500”, does not reasonably provide enablement for making and using the genus of nucleic acid and amino acid structures as broadly claimed. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make/use the invention commensurate in scope with these claims.
In In re Wands (8 USPQ2d 1400 (CAFC 1988)), the CAFC considered the issue of enablement in molecular biology. The CAFC summarized eight factors to be considered in a determination of "undue experimentation". These factors include: (a) the quantity of experimentation; (b) the amount of guidance presented; (c) the presence or absence of working examples; (d) the nature of the invention; (e) the state of the prior art; (f) the predictability of the prior art; (g) the breadth of the claims; and (h) the relative skill in the art. The factors are analyzed in turn for the instant case as follows:
Here, the claims are broadly drawn to mutating an endogenous soybean CKX3 gene having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:78, comprises a sequence having at least 80% sequence identity to the nucleotide sequence of SEQ ID NO:79, or encodes a polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:80, wherein the target site is within a region of the CKX3 gene, the region of the CKX3 gene comprising a sequence having at least 80% sequence identity to a sequence comprising: nucleotide 692 to nucleotide 826 of the nucleotide sequence of SEQ ID NO:78 or nucleotide 35 to nucleotide 169 of the nucleotide sequence of SEQ ID NO:79.
For clarification, SEQ ID NO:78 is the genomic DNA for the endogenous CKX3 sequence, and SEQ ID NO:79 is the cDNA sequence encoding the polypeptide of SEQ ID NO:80. SEQ ID NO:95 is the target site spanning positions 35-169 of SEQ ID NO:79 or positions 692-826 of SEQ ID NO:78.
The claim further comprises a null mutation in at least one additional endogenous CKX1, CKX2, CKX4, and/or CKX6 gene and wherein the soybean plant exhibits increased seed number, increased height, increased nodes on the mainstem, increased number of pods on the mainstem, and/or decreased number of pods on branches as compared to a control soybean plant.
Meanwhile specification teaches mutations of six soybean (Glycine max) CKX genes (CKX1-6) from six different loci, the start position of the deletion corresponding to the wild-type CKX gene, and the deletion length (see Example 1),
In Example 2, mutant plant CE20600 (CKX2 and CKX3 knock-outs) had an increase in the number of seeds per pod. CE20600 plants were taller and had an increase in the number of pods and the number of nodes on the mainstem (due to being taller). However, there was no difference in the number of seeds per plant, number of branches, number of nodes or the number of pods between CE20600 and control. Additionally, the seed weight of 100 seeds for the mutant CE20600 was less than that of the control.
In Example 3, mutant plants CE48101 (CKX1, CKX3, and CKX6 knock-outs), and CE48659 (CKX1, CKX3, and CKX5 knock-outs) were analyzed for phenotypes. There were no differences between CE48101 and CE48659 when compared to control, except for the decrease in the number of nodes on the mainstem in the CE48659 (CKX1/3, CKX1/3/5, and CKX3/5 knock-outs) segregating family.
In Example 5, mutant plants CE29267 (CKX3 and CKX4 knock-outs), CE27443 (CKX2 and CKX3 knock-outs), and CE29257 (CKX2, CKX3, and CKX4 knock-outs) were analyzed for phenotypes. There was no difference of seeds per pod when comparing the mutant plants against the control. For CE29267, there was an increase of number of pods per node on the mainstem and total pods on the mainstem, however, there was a decrease in the pods on branches as compared to control. There was no increase in total pod count or plant height for any of the lines CE29267, CE27443 or CE29257 compared to control. Mutant plant CE29267 (CKX3 and CKX4 knock-outs) shows architectural changes in the plant habit.
In Example 6, mutant plants CE31532 and CE31492 (CKX1, CKX3, and CKX6 knock-outs) were analyzed for phenotypes. There was no difference in the average number of seeds per pod when comparing CE31532 or CE31492 to control. There was a lower seed count per plant and a lower pod count per branch compared to control. CE31532 showed an increase in number of nodes on the mainstem and increase in height, which accounts for the increase in the number of nodes compared to control. Mutant plants CE31532 and CE31492 (CKX1, CKX3, and CKX6 knock-outs) show architectural changes in the plant habit.
In Example 7, mutant plants CE48618, CE48108, and CE48637 (CKX1, CKX3, CKX5, and CKX6 knock-outs) were analyzed for phenotypes. There was no difference in the number of seeds per plant or in number of seeds per pod. CE48108 (CKX1, CKX3, CKX5, and CKX6 knock-outs) shows architectural changes in plant habitat, however, sample size was too small to reach conclusive results.
In Example 8, mutant plant CE20753 (CKX1 and CKX3 knock-outs) was analyzed for phenotypes. There was lower average number of seeds per pod and the number of seeds per plant compared to the control line. There was no difference in total number of pods per plant, average number of pods per node on the mainstem, or number of pods on the mainstem. The mutant plant CE20753 (CKX1 and CKX3 knock-outs) showed no difference in count of pods on branch or for plant height between edited progeny and control.
In Example 9, mutant plant CE29233 (CKX1, CKX2, CKX3, and CKX4 knock-outs) was analyzed for phenotypes. For the segregated mutant plant CE29233 (CKX2 and CKX4 knock-outs) there was an increase in the average number of pods per node on the mainstem, number of pods on the mainstem and number of nodes on the mainstem compared to the control. There was a decrease in the average number of seeds per pod, number of seeds per plant, and number of pods on branches for segregated mutant plant CE29233 (CKX2 and CKX4 knock-outs). Mutant plant CE29233 (CKX2/4 and CKX1/2/4 knock-outs) showed an increase in the number of pods and nodes on the mainstem, however, there was a decrease in number of pods on branches compared to the control. The results for CE29233 (CKX2/4 and CKX1/2/4 knock-outs) segregating family did not include the elected CKX3 gene.
In Example 10, mutant plant CE31638 (CKX1, CKX3, CKX5, and CKX6 knock-outs) was analyzed for phenotypes. For CE31638 (CKX1, CKX3, CKX5, and CKX6 knock-outs) there was no increase in any of the traits. For CE31638 (CKX1, CKX5, and CKX6 knock-out genes) segregating family there was a reduction in the number of pods on branches and the number of pods per plant but did not include CKX3. Mutant plant CE31638 (CKX1/3/5/6 and CKX1/5/6 knock-outs genes) segregating family shows changes in the plant habit.
Aside from these examples, the specification fails to teach the critical domains or motifs of CKX3 that confer functional activity such that when the protein is mutated in the claimed region the resulting plant has the traits as claimed.
As noted above, the claims encompass a vast genus of CKX3 genes as they may have as little as 80% sequence identity to SEQ ID NO: 78 or 79 or as little as 80% sequence identity to the amino acid sequence of SEQ ID NO: 80. Moreover, the claims fail to even recite the structure CK1, 2, 4 and 6 genes and thus encompass an exhaustive genus of structures for said genes.
Moreover, aside from teaching the starting material of a CKX3 gene corresponding to “Glyma.17G054500” and which is expected to inhibit expression of SEQ ID NO: 78 (e.g., see Table 2; see also Example 2, ¶ 1), the specification fails to, in fact, teach, that the genus of sequences as encompassed by the claims comprise the structures necessary for CKX3 function such that when they are mutated in the claimed region the resulting plant has the traits as claimed.
Here, the claims encompass a nucleic acid sequence having as little as 80% identity to SEQ ID NO: 78 or 79, or encoding a polypeptide having as little as 80% identity to SEQ ID NO: 80 and thus requires the specification to teach nucleic acid sequences encoding such polypeptides.
These polynucleotide and polypeptides would encompass 31153, 31608 and 19107 distinct gene and protein variants, respectively. In the absence of guidance indicating where in the sequence of SEQ ID NO: 78, 79 and 80 such variations can be sustained, the skilled practitioner would be unable to predictably make or use soybean plants comprising the traits as claimed.
This guidance is critical because the art teaches that not all CKX3 genes when mutated would expect to predictably yield plants with the phenotypes as claimed. For example, Liu et al. teaches how CKX3 genes differ in structure, function, expression levels and tissue location (see Figures 3, 4, Table 2, Results pages 6-9).
Specifically, Liu et al. teaches that while 23 conserved motifs were identified GmCKX5 had no specific motifs, and the other GmCKX families had some specific motifs, i.e., motif15 is specific to GmCKX3a proteins, and motif19 is specific to GmCKX3b proteins, and that these specific motifs may be related to their specific functions (p. 7, col. 2, last ¶ bridging p. 8)
Liu et al. further teaches GmCKX3b-1 is hardly expressed in each tissue, while GmCKX3a, GmCKX7-2, and GmCKX6-1 were expressed mainly in flowers, and GmCKX3b-2 and GmCKX3b-3 were expressed in root (p. 8, col. 1, ¶ 1).
Liu et al. also teaches that Medtr4G126160 in Medicago truncatula has the highest homology with GmCKX3b-2 and GmCKX3b-3 and that the Medtr4G126160 mutant significantly reduced main root length and increased the number of lateral roots indicating an important role root development. Similarly, CKX3b in soybean and Medicago truncatula, the CKX3b genes were highly expressed in roots, which may play an important role in root development, while, in cowpea and kidney bean, the CKX3b genes were hardly expressed in various tissues (p. 8, col. 1, last ¶).
Liu et al. teaches high expression of four CKX3a and no expression of two CKX5 and three CKX3 tandem-duplication-derived genes (CKX3b) in flowers (p. 13, col. 2, ¶ 2).
Or see Li et al. teachings as recently as 2025 that while a great array of CKXs have been reported in various plants, including 7 CKXs in Arabidopsis, 11 CKXs in rice , 13 CKXs in maize, 11~14 CKXs in wheat, and 11 CKXs in barley a comprehensive functional characterization of most of these CKXs remains incomplete (p. 2, ¶ 1)
Furthermore, while the use of the full-length CKX sequences of Arabidopsis and rice as queries in a BLAST search uncovered 17 putative CKX genes soybean genome, there is little data elucidating the detailed mechanism through which GmCKXs impact the yield-related traits by regulating CKs in soybean (see p. 2, last ¶ bridging p. 3).
Thus, the art makes clear that not all CKX3 genes as broadly encompassed by the claims when mutated will confer the traits as claimed as CKX3b is found in roots and CKX5 is not expressed at all, and because the structure function correlation for CKX genes remains to be resolved.
Furthermore, and as noted above, the claims encompass additional endogenous CKX1, CKX2, CKX4, and/or CKX6 genes that are not claimed by any particular structure. As with CKX3, the specification fails to teach the structures of other CKX gene that confer functionality, and further fails to describe that when this genus of structures in mutated in conjunction with the genus of CKX3 gene structures as broadly claimed predictably results in plants with the phenotypes as claimed.
Applicant should note that In Enzo Biochem, Inc. v. Calgene, Inc., 188 F.3d 1362, 52 USPQ2d 1129 (Fed. Cir. 1999), the court held that two patents with claims directed to genetic antisense technology (which aims to control gene expression in a particular organism), were invalid because the breadth of enablement was not commensurate in scope with the claims. Both specifications disclosed applying antisense technology in regulating three E. coli genes. Despite the limited disclosures, the specifications asserted that the "[t]he practices of this invention are generally applicable with respect to any organism containing genetic material which is capable of being expressed … such as bacteria, yeast, and other cellular organisms." Thus, the court construed the claims to encompass the application of antisense methodology in a broad range of organisms.
Ultimately, the court relied on the fact that (1) the amount of direction presented and the number of working examples provided in the specification were very narrow compared to the wide breadth of the claims at issue, (2) antisense gene technology was highly unpredictable, and (3) the amount of experimentation required to adapt the practice of creating antisense DNA from E. coli to other types of cells was quite high, especially in light of the record, which included notable examples of the inventor’s own failures to control the expression of other genes in E. coli and other types of cells.
Thus, the teachings set forth in the specification provided no more than a "plan" or “invitation” for those of skill in the art to experiment using the technology in other types of cells. See MPEP 2164.06(b)(I).
Here, the instant specification provides no more than a plan for one to practice the claimed invention in light of the breadth of the claims, the lack of working examples, the state of the art which fails to teach CKX structures required for function and that not all CKX3 genes are expected to influence the traits as claimed, and the failure of the specification to teach a structure function relationship for CKX.
Therefore, the skilled practitioner would be required to resort to excessive and undue trial and error experimentation to arrive at the instant invention.
Response to Amendment
Applicant traverses the rejection because any enabled use that would reasonably correlate with the entire scope of the claims is sufficient to preclude a rejection (Applicant reply dated 28 July 2025, p. 15, last ¶).
This argument is not persuasive because a reasonable use as exemplified does not, in fact, correlate with the scope of the claims which are immensely broad and unpredictable in light of the state of the art and the lack of guidance provided in the specification as discussed above.
Applicant argues multiple examples have been provided demonstrating compliance with the scope of enablement requirement and that have shown the claimed phenotypes (Applicant reply dated 28 July 2025, p. 16, ¶ 1 and 2).
This argument is unpersuasive and not commensurate in scope with what is claimed. In fact, the examples only pertain to mutations in a limited region of CKX3 and do not address the fact that the claims encompass a vast genus of genes that may or may not have functionality and thus cannot be predictably mutated.
Applicant cites case law to support the proposition that in vitro testing leads to in vivo testing, that particular results are not required to comply with the scope of enablement requirement and that CKX3 mutations show a trend to improved yield traits (Applicant reply dated 28 July 2025, p. 16, last ¶ and p. 17, ¶ 1).
This argument is not persuasive because as with previous arguments it is not commensurate in scope with what is claimed. The examples only pertain to mutations in a limited region of CKX3 and do not address the fact that the claims encompass a vast genus of genes that may or may not have functionality and thus cannot be predictably mutated.
Claim Rejections – 35 USC § 103
Claims 30-31, 36, 118-119, 121-122 and 124-125 REMAIN rejected under 35 U.S.C. 103 as being unpatentable over Lammertyn et al. (US Pub. No. 2019/0153456 A1) and Schmulling et al. (US Pub. No. 2014/0380526 A1 (Previously cited)) and in view of Zou et al. (GenBank accession no. JQ582834.1, 2012, June 29) and Schmutz et al. (UniProt accession no. H7BRI4, 2012).
With regard to claims 30, 31 and 124, Lammertyn teaches an Arabidopsis and Brassica plant cell comprising a knock-out endogenous CKX3 gene, wherein the knock-out mutation is introduced using an editing system that comprises a nucleic acid binding domain that binds to a target site in the CKX gene, specifically the signal peptide (transmembrane motif) (para. [0088], [0096], and [0098]).
Lammertyn teaches a knock-out CKX3 gene in Brassica (B. napus) and further suggests a knock-out orthologous CKX gene in other pod-bearing species including soybean and suggests that full knock out mutants are made by targeting the FAD domain of CKX3 or other critical domains (e.g., see ¶ 0098).
Additionally, Lammertyn teaches that “A significant reduction in or complete abolishment of the biological activity of the CKX3 or CKX5 protein refers herein to a reduction in or abolishment of the substrate binding activity and/or the catalytic capacity of the CKX3 or CKX5 protein, such that flower number, pod number and/or TSW of a plant expressing the mutant CKX3 or CKX5 protein is increased as compared to a plant expressing the corresponding wild type CKX3 or CKX5 protein” (pg. 14 paragraph [0190]), specifically stating that if one skilled in the art disrupts these regions or activity one would expect increased flower number, pod number and/or total seed weight (TSW) with a reasonable expectation of success.
Lammertyn highlights the conserved regions of CKX3 regions in Arabidopsis and Brassica, (see table 1), which one skilled in the art can use a computer program, such as BLAST to find the conserved region in soybean as Lammertyn suggested, (pg. 7 paragraph [0092]).
With regard to claim 36, Lammertyn teaches the use of a homologous recombination editing system, which inherently utilizes an endonuclease (a nuclease) for gene editing, and cites WO2006/105946 for teaching an endonuclease for gene editing (see paragraph [0096]).
In regard to claim 118, Lammertyn teaches on the mutation being deletions (see paragraph [0196]).
In regard to claim 119, Lammertyn teaches on the deletion resulting in a premature stop codon (see paragraph [0199]).
In regard to claim 121, Lammertyn teaches increasing the planting density (see paragraph [0453]).
In regard to claim 122, Lammertyn teaches using site directed mutagenesis (see paragraphs [0096] and [0150]), which uses guide nucleic acids that bind to a target site.
With regard to claim 125, Lammertyn teaches a sequence alignment between Arabidopsis thaliana and B. napus to determine the structure of the B. napus CKX3 and CKX5 protein (see figures 1-3). Lammertyn further discloses conserved target regions for CKX3 and CKX5 proteins for B. napus (see table 1 and 2, respectively), specifically identifies the amino acid region between 1-24 as a target region. This region has overlapping positions with the Applicants SEQ ID NO:95 nucleotide positions of 60-101 (amino acids 20-33) (see paragraphs [0088]-[0089] and Tables 1-2).
It would appear that Applicant’s target site having SEQ ID NO: 97 to produce a knock-out CKX5 gene in soybean is a conserved region among G. max plants and corresponds to the B. napus target site of the transmembrane region of the CKX5 gene, similar to the example above, absent evidence to the contrary.
Furthermore, the primary objective is to disrupt CKX5 activity. Any significant deletion on or near these motifs (transmembrane and/or FAD binding region) would cause a frameshift mutation, thereby changing the entire downstream amino acid sequence. This inevitably result in a non-functional and unstable CKX5 protein. Therefore, one skilled in the art would predictably identify the target regions of CKX5 and its conserved motif’s with a reasonable expectation of success. Reduction to practice is not required.
With regard to claims 30, 31 and 124, Schmulling teaches that “simultaneous disruption of at least CKX3 and one further endogenous gene encoding for a cytokinin oxidase/dehydrogenase, preferably of CKX1, CKX2, CKX4, CKX5, CKX6 or CKX7 leads to transgenic plants with improved productivity and/or growth characteristics” (pg. 1 para. [0011]).
Additionally, Schmulling teaches the combination of CKX3 and CKX5 knocked out and saw an increase of siliques, plant height, petal surface, ovules, and seed yield (see figs 4-6). Overall, Schmulling teaches how the combination of knocking out multiple CKX genes improve crop yield, biomass and architecture.
Thus, while each Lammertyn and Schmulling reasonably teach suggest and provide motivation for making CKX3 nulls or knockouts in addition to making nulls or knockouts of other CKX genes in a soybean plant, the issue is whether one would have targeted the particularly claimed regions for mutations.
To this point, Zou teaches that the sequence for the Glycine max cultivar Jungery cytokinin dehydrogenase 3 (CKX3) JQ582834 having 100% sequence identity to SEQ ID NO: 79 and 80 (see Office action dated 27 October 2025).
Or see Schmutz which teaches the CKX3 gene, specifically the H7BRI4 entry, which shows 100% sequence identity to Applicants SEQ ID NO: 80 (Office action dated 27 October 2025). UniProt indicates that the region between amino acid positions 6-23 is a transmembrane region, and when H7BRI4 is aligned with the Applicants sequence, the region from nucleotide 35-169 (amino acids 12-57) also corresponds to a transmembrane motif.
The alignment also provides that the domain of residues 66 to 248 is a FAD binding domain and thus overlaps in scope with the instantly claimed target region of SEQ ID NO: 79.
Therefore, prior to the effective filing date of the instant invention it would have been prima facie obvious to one of ordinary skill in the art to follow the teachings of Lammertyn and Schmulling to produce a soybean plant cell comprising a null or knockout in the claimed target region of CKX3 gene because it is a design choice in so far as Lammertyn specifically teaches targeting the FAD domain to knock out gene function and because there is only one soybean CKX3 gene known in the art (e.g. see Zou) and which comprises a FAD domain (e.g. see Schmutz).
One would have reasonable expectation of success in doing so because the sequences need to arrive at the invention were known in the art, because mutagenesis is a well known and routinely used methodology, and because CKX5/CKX3 Brassica mutants were shown to have an increase in the number of flowers, more pods and more seeds (see Lammertyn ¶ 0426; see also ¶ 0432-0435). In this way, one would increase yield in soybean, a commercially important crop that can be used for food, feed or oil production.
Response to Arguments
Applicant argues the Office does not provide a showing that soybean CKX3 in NCBI or Uniprot has the same expression and/or function as the CKX3 gene in Arabidopsis or Brassica or the CKX1 of Arabidopsis has the same function of soybean CKX1 (Applicant reply dated 27 July 2026, p. 13, penultimate ¶).
Applicant’s argument is not persuasive because the Office need not demonstrate these results. Namely, the Office must provide a reasonable expectation of success of following the teachings for following the teachings of Lammertyin and Schmulling to arrive at the instant claims.
Here, the Office has done so: inhibiting CKX3 and CKX5 in Brassica provides the same traits as instantly claimed. Coupled with the fact that there is only one known CKX3 gene in soybean, and the FAD domain is known, one would reasonably expect that targeting this region would create a null, and in turn, yield the traits as claimed.
Applicant argues what Lammertyin does or does not teach and suggests that the expression/function of any particular CKX gene and its role in any particular developmental process in any particular plant is complex and without more direction and guidance there would be no motivation or reasonable expectation of arriving at the instant invention (Applicant reply dated 27 July 2026, p. 13, last ¶ bridging p. 14).
This argument is not persuasive because (1) it is not commensurate in scope with what is claimed and (2) supports the position of the Office that the claims are not described or enabled.
Here, Applicant’s claims encompass a vast genus of structures yet the specification only teaches that it is a particular gene with various mutations in specific regions that allegedly provide the traits as claimed.
Moreover, the claims encompass this genus of structures of any particular CKX gene and its role in any particular developmental process for which the instant specification has neither described nor taught. Thus, one would be unable to predictably make and thus use the plant as claimed, or one would not be of the opinion Applicant possesses the plants as claimed.
In other words, if one needs more guidance or direction to make and use CKX genes, then the instant specification has failed to make up for this deficiency in the art to predictably make and use the claimed genus of structures and which retain function.
Applicant argues the Office has failed to establish why one would choose the specific sequences as claimed and the art does not teach the combinations as claimed (Applicant reply dated 27 July 2026, p. 14, ¶ 1 and last ¶). This argument is not persuasive because as indicated above Lammertyn specifically teaches targeting the FAD domain to knock out gene function and because there is only one soybean CKX3 gene known in the art (e.g. see Zou) and which is known to have a FAD domain (e.g. see Schmutz).
One would have reasonable expectation of success in doing so because the sequences need to arrive at the invention were known in the art, because mutagenesis is a well known and routinely used methodology, and because CKX5/CKX3 Brassica mutants were shown to have an increase in the number of flowers, more pods and more seeds (see Lammertyn ¶ 0426; see also ¶ 0432-0435).
Moreover, Applicant’s arguments are not persuasive and are not commensurate in scope with what is claimed as there are no particular regions targeted for mutation in the other CKX genes as encompassed by instant claims 30, 31, 36, 118, 119, 121, 122 and 124, and there are no particular “combination” of mutations recited in claim 30.
Applicant urges the withdrawal of the rejection based on the prosecution history of application number 14/451,235 as the Examiner found the claims non-enabling and that the art does not teach the combination of cited references show that extrapolating protein function in other plants is predictable (Applicant reply dated 27 July 2026, p. 15, ¶ 1).
This argument is not persuasive because (1) the art is cited for what it teaches and the Office is not bound to follow the prosecution history of other applications and (2) it supports the position of the Office that the instant claims are not enabled or described.
Namely, if a previous Examiner found that variants of mutated CKX3 and CKX5 genes were not found to be enabled or described then the same would apply to the instant claims which also encompass variants of mutated CKX3 and CKX5 genes.
Moreover, the standard for determining whether claims are obvious is not whether combining the art achieves predictable results. Rather, the issue is whether one has a reasonable expectation of success in the claimed results.
Here, inhibiting CKX3 and CKX5 in Brassica provides the same traits as instantly claimed. Coupled with the fact that there is only one known CKX3 gene in soybean, and the FAD domain is known, one would reasonably expect that targeting this region would create a null, and in turn, yield the traits as claimed.
Applicant argues there is no reasonable expectation of success in knocking out the genes as claimed (Applicant reply dated 27 July 2026, p. 16, ¶ 1).
This argument is not persuasive because mutagenesis is a well known and routinely used methodology and because the cited art instructs one as to how to do so.
Claim 37 is NOW rejected under 35 U.S.C. 103 as being unpatentable over Lammertyn et al. (US Pub. No. 2019/0153456 A1) and Schmulling et al. (US Pub. No. 2014/0380526 A1) in view of Zou et al. (GenBank accession no. JQ582834.1, 2012, June 29) and Schmutz et al. (UniProt accession no. H7BRI4, 2012) as applied to claim 30 above, and in further in view of Huang et al. (Patent No. US 7,230,168 B2).
The teachings of Lammertyn, Schmulling, Zou, and Schmutz as applied to claim 30 above are noted above. However, Lammertyn, Schmulling, Zou, and Schmutz do not teach the CKX1 gene having SEQ ID NO: 93.
To this point, Huang et al. teach the expression of a CKX1 gene in a plant and that the gene may be derived from soybean (col. 6 at line 30; see also col. 7 at line 9). This sequence corresponds to SEQ ID NO: 13 and has 100% sequence identity to SEQ ID NO: 93 of the instant invention:
Sequence 13, US/10326184
Patent No. 7230168
GENERAL INFORMATION
APPLICANT: Monsanto Company
TITLE OF INVENTION: REVERSIBLE MALE STERILITY IN TRANSGENIC PLANTS BY EXPRESSION OF CYTOKININ
TITLE OF INVENTION: OXIDASE 1
FILE REFERENCE: MTC6781.1
CURRENT APPLICATION NUMBER: US/10/326,184
CURRENT FILING DATE: 2002-12-20
PRIOR APPLICATION NUMBER: US 60/343,129
PRIOR FILING DATE: 2001-12-20
NUMBER OF SEQ ID NOS: 24
SEQ ID NO 13
LENGTH: 525
TYPE: DNA
ORGANISM: Glycine max
Query Match 100.0%; Score 177; Length 525;
Best Local Similarity 100.0%;
Matches 177; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACATACTTCATCCTCCTGTTCATAACCATAACACGTTTGATCTCCACAGTGGGCAAAACC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 106 ACATACTTCATCCTCCTGTTCATAACCATAACACGTTTGATCTCCACAGTGGGCAAAACC 165
Qy 61 TCCCAATGGACGAAGGCCCTGTCGCTGCCTCCGGAACTCGCCTCCGTCTCCCTCGACGAC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 166 TCCCAATGGACGAAGGCCCTGTCGCTGCCTCCGGAACTCGCCTCCGTCTCCCTCGACGAC 225
Qy 121 ACCATCTTCTGCAAGCTCCGTGACGACCCAGAGGCCCTCCAGGGAAGGGCCTCCAGG 177
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 226 ACCATCTTCTGCAAGCTCCGTGACGACCCAGAGGCCCTCCAGGGAAGGGCCTCCAGG 282
Therefore, prior to the effective filing date of the instant invention, it would have been prima facie obvious to one skilled in the art to modify the teachings of Lammertyn, Schmulling, Zou, and Schmutz to produce a soybean plant cell comprising both a CKX3 and CKX1 knockout because Lammertyn and Schmulling teach targeting conserved motifs to create knockouts of CKX3 and CKX1 to disrupt gene activity and improve plant yield, and because Huang et al. teach that the soybean CKX1 gene was known in the art.
One of ordinary skilled in the art would have had a reasonable expectation of success in doing so because the sequences need to arrive at the invention were known in the art, because mutagenesis is a well known and routinely used methodology, and because CKX5/CKX3 Brassica mutants were shown to have an increase in the number of flowers, more pods and more seeds (see Lammertyn ¶ 0426; see also ¶ 0432-0435). In this way, one would increase yield in soybean, a commercially important crop that can be used for food, feed or oil production.
Response to Arguments
Applicant traverses the rejection for the same reasons as above and because the secondary reference fails to remedy these deficiencies (Applicant reply dated 27 July 2026, p. 16, section B).
This argument is not persuasive because one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Here, the Office has provided motivation and a reasonable expectation of success for arriving at the plant of claim 30. The current rejection is rejected for being obvious to modify the rejection of claim 30 by instead using particular guide nucleic acids in light of the teachings of Huang. Applicant has failed to provide any argument to rebut this particular position.
Claim 123 REMAINS rejected under 35 U.S.C. 103 as being unpatentable over Lammertyn et al. (US Pub. No. 2019/0153456 A1) and Schmulling et al. (US Pub. No. 2014/0380526 A1) and in view of Zou et al. (GenBank accession no. JQ582834.1, 2012, June 29) and in light of Schmutz et al. (UniProt accession no. H7BRI4, 2012) as applied to claims 30 and 122 above, and further in view of Montague et al. (CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. 2014. Nucleic Acids Res. 42, W401–7).
The teachings of Lammertyn, Schmulling, Zou, and Schmutz as applied to claims 30 and 122 above is discussed above. However, Lammertyn, Schmulling, Zou, and Schmutz do not teach spacer sequences.
Montague teaches a blueprint on how to use the computer program “CHOPCHOP, a web-based tool that allows users to easily and rapidly select the optimal TALEN or CRISPR/Cas9 target sequences in genes from a variety of organisms” (see page W402), which helps one skilled in the art to “easily” to identify the “optimal” spacer sequences (target sequences). Therefore, one skilled in the art would yield spacer sequences of SEQ ID NOs: 105-107 and reduction to practice is not required.
Therefore, prior to the effective filing date of the instant invention it would have been prima facie obvious to one of ordinary skill in the art to modify the teachings of Lammertyn and Schmulling and in view of Zou and Schmutz to produce a soybean plant cell comprising a null or knockout CKX3 gene and an additional CKX1 gene because Lammertyn teach improving yield via CKX3 knockouts, Schmulling teach combining CKX3 and CKX1, Zou discloses the CKX3 gene JQ582834 having 100% sequence identity to SEQ ID NO: 79 and 80 and making guide nucleic acids was known in the art, for example, as taught by Montague et al.
Namely, using one mutagenesis method versus another is an obvious design choice as each is a method to inhibit expression of the CKX3 gene to increase yield in soybean for the reasons as previously set forth.
One of ordinary skilled in the art would have a reasonable expectation of success in doing so because Montague et al. explicitly provides a blueprint for using CHOPCHOP to select target spacer sequences, making the routine design and selection of these specific guide sequences obvious to try with a reasonable expectation of success.
Response to Arguments
Applicant traverses the rejection of the claims for the same reasons as above and because Montague fails to remedy these deficiencies (Applicant reply dated 27 July 2026, p. 16, section C).
This argument is not persuasive because one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Here, the Office has provided motivation and a reasonable expectation of success for arriving at the plant of claim 30. The current rejection is rejected for being obvious to modify the rejection of claim 30 by instead using particular guide nucleic acids in light of the teachings of Montague. Applicant has failed to provide any argument to rebut this particular position.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTIAN JOSE ORDAZ whose telephone number is (703)756-1967. The examiner can normally be reached 8:30 am-5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.J.O./Examiner, Art Unit 1663
/JASON DEVEAU ROSEN/Primary Examiner, Art Unit 1662
