DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1, 7, 10-12, 20, 24-26, 28, 30-31, 36-37, and 117-125, are pending. Claims 1, 7, 10-12, 20, 24-26, 28, and 117, are withdrawn. Claims 2-6, 8-9, 13-19, 21-23, 27, 29, 32-35, and 38-116, are cancelled. Claims 30-31, 36-37, and 118-125, are examined to the extent of the elected species CKX3.
All previous rejections not set forth below have been withdrawn.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Response to Amendments
Status of Rejections from action:
In regard to Claims 30-31, 36-37, and 118-125 under 112(b) is added in view of amendments.
In regard to Claims 30-31, 36, 118-122 and 124-125 under 103 is modified in view of amendment.
In regard to Claim 37 under 103 is added in view of amendment.
In regard to Claim 123 under 103 is modified in view of amendment.
Priority
This application is claiming the benefit of Provisional Application No. 63/148439 filed February 11, 2021.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 30-31, 36-37, and 118-125, are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In claim 30, it is unclear whether the mutation in the CKX1, CKX2, CKX4 or CKX6 gene also results in a null allele or knockout gene.
In claim 31, “the” should be inserted before “endogenous CKX1 gene” for proper antecedence.
Claims 120 and 121 do not recite a proper comparative basis. Claim 30 requires mutations in at least two CKX genes. The control plant of claims 120 and 121 only requires one unmutated CKX gene.
In claim 122, it is unclear what “the CKX gene” refers to, because multiple CKX genes are recited in claim 30.
In claims 124 and 125, it is unclear whether Applicant intends for these claims to encompass mutations to at least three CKX genes: CKX3, CKX5 and at least one of CKX1, CKX2, CKX4 and CKX6 genes, or Applicant intends for CKX5 to replace the at least one of CKX1, CKX2, CKX4 and CKX6 genes. If Applicant intends the latter, claims 124 and 125 do not further limit claim 30.
Clarification and/or correction is required.
Claim Rejections – 35 USC § 103(amended)
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 30-31, 36, 118-122 and 124-125, are rejected under 35 U.S.C. 103 as being unpatentable over Lammertyn et al. (US Pub. No. 2019/0153456 A1 (previously cited)), Schmulling et al. (US Pub. No. 2014/0380526 A1 (A)), in view of Zou et al. (GenBank accession no. JQ582834.1, 2012, June 29 (previously cited)), and in light of Schmutz et al. (UniProt accession no. H7BRI4, 2012 (previously cited)).
With regard to claims 30, 31, 120 and 124, Lammertyn teaches an Arabidopsis and Brassica plant cell comprising a knock-out endogenous CKX3 gene, wherein the knock-out mutation is introduced using an editing system that comprises a nucleic acid binding domain that binds to a target site in the CKX gene, specifically the signal peptide (transmembrane motif) (see paragraphs [0088], [0096], and [0098]). Lammertyn teaches a knock-out CKX3 gene in Brassica (B. napus) and further teaches a knock-out orthologous CKX gene in other pod-bearing species including soybean (Glycine max) (see paragraphs [0088]). Additionally, Lammertyn teaches that “A significant reduction in or complete abolishment of the biological activity of the CKX3 or CKX5 protein refers herein to a reduction in or abolishment of the substrate binding activity and/or the catalytic capacity of the CKX3 or CKX5 protein, such that flower number, pod number and/or TSW of a plant expressing the mutant CKX3 or CKX5 protein is increased as compared to a plant expressing the corresponding wild type CKX3 or CKX5 protein” (see page 14 paragraph [0190]), specifically stating that if one skilled in the art disrupts these regions or activity one would expect increased flower number, pod number and/or total seed weight (TSW) with a reasonable expectation of success. Lammertyn, highlights the conserved regions of CKX3 regions in Arabidopsis and Brassica, (see table 1), which one skilled in the art can use a computer program, such as BLAST to find the conserved region in soybean as Lammertyn suggested, (see page 7 paragraph [0092]). Lammertyn even takes it a step further, by pointing out all the specific positions required to create a full knock-out CKX3 mutant, specifically mentions that “protein or truncated CKX3 protein lacking at least one conserved motif, such as the signal peptide comprising the amino acid residues at positions corresponding to positions 1-31 of AtCKX3” (para. [0088]). Overall, Lammertyn teaches a blueprint to how to target CKX genes to create full knock-out mutants.
With regard to claims 30, 31, 120 and 124, Lammertyn does not teach the combination of CKX3 and CKX1. Additionally, Lammertyn does not teach CKX3 gene having at least 80% sequence identity to SEQ ID NO: 78-80.
With regard to claims 30, 31, 120 and 124, Schmulling teaches that “simultaneous disruption of at least CKX3 and one further endogenous gene encoding for a cytokinin oxidase/dehydrogenase, preferably of CKX1, CKX2, CKX4, CKX5, CKX6 or CKX7 leads to transgenic plants with improved productivity and/or growth characteristics” (pg. 1 para. [0011]). Additionally teaches the combination of CKX3 and CKX5 knocked out and saw an increase of siliques, plant height, petal surface, ovules, and seed yield (see figs 4-6). Overall, Schmulling, teaches how the combination of knocking out multiple CKX genes improve crop yield, biomass and architecture.
With regard to claims 30, 31, 120 and 124, Both Lammertyn and Schmulling validate that disrupting multiple CKX genes result in improve plant performance. However, neither Lammertyn or Schmulling teach on CKX3 gene having at least 80% sequence identity to SEQ ID NO: 78-80.
In regard to claims 30, 31, 120 and 124, Zou teaches the sequence Glycine max cultivar Jungery cytokinin dehydrogenase 3 (CKX3) JQ582834 having 100% sequence identity to SEQ ID NO: 79 and 80 (see alignment in previous Office Action).
With regard to claims 30, 31, 120 and 124, neither Lammertyn, Schmulling or Zou teach on the different motif sites for soybean CKX3 gene, specifically on positions 35-169 in SEQ ID NO: 79 and how they relate to Lammertyn.
In regard to claims 30, 31, 120 and 124, Schmutz provides information on the CKX3 gene, specifically the H7BRI4 entry, which shows 100% sequence identity to Applicants SEQ ID NO: 80 (see alignment in previous Office Action). UniProt indicates that the region between amino acid positions 6-23 is a transmembrane region (see previous Office Action). When aligning H7BRI4 with the Applicants sequence, the region from nucleotide 35-169 (amino acids 12-57) also corresponds to a transmembrane motif. Even though Lammertyn identifies this region is a signal peptide while UniProt calls it is a transmembrane region, UniProt uses a prediction tool known as Phobius to distinguish between the two. Phobius classifies positions 6-23 as being more likely a transmembrane region than a signal peptide (indicated by purple region in the image below). Especially, a comparison of Lammertyn’s AtCKX3 (SEQ ID NO:3) and the Applicant’s GmCKX3 (SEQ ID NO: 80) clearly shows they both share the same transmembrane motif (see images below). Therefore, regardless of the precise classification (signal or transmembrane), this region is an important motif that Lammertyn identifies as a target for creating a knock-out mutant and one skilled in the art could target.
PNG
media_image1.png
682
642
media_image1.png
Greyscale
PNG
media_image2.png
680
646
media_image2.png
Greyscale
Given Lammertyn’s teaching of modifying CKX3 gene resulting in a null or knock out which in turn result in improved yield, along with the combination of CKX3 and CKX1 as taught by Schmulling, in view of Zou’s teaching of disclosing the CKX3 gene JQ582834 having 100% sequence identity to SEQ ID NO: 79 and 80. Additionally, in light of Schmutz/UniProt teach the conserved regions of the GmCKX3, specifically teaches on the transmembrane region positions 6-23. Both Lammertyn and Schmutz/UniProt teach on over-lapping conserved regions 12-57 and 6-23, respectively. Lammertyn also points out that one skilled in the art would want to target these motif’s to create full knock-outs. This would have been obvious to target the same region since the prior art teaches that one skilled in the art to target these motif’s to create a knock-out resulting inhibited activity. It is the Office’s position, based on the teachings, is that producing a null or knockout CKX3 and CKX1 gene, is well-known and well characterized in the art make it a well-known option to produce a soybean plant cell with inhibited CKX3 activity specifically at positions 35-169 (amino acids 12-57) and an additionally CKX1 gene. Furthermore, the primary objective is to disrupt CKX3 and CKX1 activity. Any significant deletion on or near these motifs (transmembrane and/or FAD binding region) would cause a frameshift mutation, thereby changing the entire downstream amino acid sequence. This inevitably result in a non-functional and unstable CKX3 protein. It is a well-established principle that any large deletion of this nature will lead to the disruption of gene activity.
Therefore, the Office’s position is that it would be obvious for those ordinary skill in the art to produce a soybean plant cell with a CKX3 and CKX1 knockout, using a blueprint on how to make CKX3/CKX1 knockouts, the gene and conserved region through the use of computer programs such as BLAST, Zou’s teaching of disclosing the CKX3 gene JQ582834 sequence, and UniProt’s transmembrane location would have been an obvious for one skill in the art to try with a reasonable expectation of success to produce a soybean plant cell comprising a CKX3 knock-out, specifically targeting said region.
With regard to claim 36, Lammertyn teaches the use of a homologous recombination editing system, which inherently utilizes an endonuclease (a nuclease) for gene editing, and cites WO2006/105946 for teaching an endonuclease for gene editing (see paragraph [0096]).
In regard to claim 118, Lammertyn teaches on the mutation being deletions (see paragraph [0196]).
In regard to claim 119, Lammertyn teaches on the deletion resulting in a premature stop codon (see paragraph [0199]).
In regard to claim 121, Lammertyn teaches increasing the planting density (see paragraph [0453]).
In regard to claim 122, Lammertyn teaches using site directed mutagenesis (see paragraphs [0096] and [0150]), which uses guide nucleic acids that bind to a target site.
With regard to claim 125, Lammertyn teaches a sequence alignment between Arabidopsis thaliana and B. napus to determine the structure of the B. napus CKX3 and CKX5 protein (see figures 1-3). Lammertyn further discloses conserved target regions for CKX3 and CKX5 proteins for B. napus (see table 1 and 2, respectively), specifically identifies the amino acid region between 1-24 as a target region. This region has overlapping positions with the Applicants SEQ ID NO:95 nucleotide positions of 60-101 (amino acids 20-33) (see paragraphs [0088]-[0089] and Tables 1-2). It would appear that Applicant’s target site having SEQ ID NO: 97 to produce a knock-out CKX5 gene in soybean is a conserved region among G. max plants and corresponds to the B. napus target site of the transmembrane region of the CKX5 gene, similar to the example above, absent evidence to the contrary. Furthermore, the primary objective is to disrupt CKX5 activity. Any significant deletion on or near these motifs (transmembrane and/or FAD binding region) would cause a frameshift mutation, thereby changing the entire downstream amino acid sequence. This inevitably result in a non-functional and unstable CKX5 protein. Therefore, one skilled in the art would predictably identify the target regions of CKX5 and its conserved motif’s with a reasonable expectation of success. Reduction to practice is not required.
Response to Applicant's Remarks:
Since the rejections have been modified to reflect the amendment to the claims, only the arguments that are relevant to the current rejections are responded below:
To the extent Applicant’s traversals apply to the above rejection, Applicant traverses primarily that the prior art does not teach a soybean plant with a knock out or null allele of CKX3 and at least one additional endogenous CKX1, CKX2, CKX4, or CKX6 gene. Secondly, that Lammertyn’s mutants are not true knock out or null alleles, because they still maintain activity they could have moonlighting effects. Thirdly, that “fails to describe increased planting density compared to a control plant as claimed in claim 121. Fourth, that Lammertyn does not specifically teach on guide nucleic acid “has at least two components, namely at least one spacer sequence that is complementary to (and hybridizes to) a target DNA and at least one repeat sequence (e.g., of a CRISPR-Cas system)”. (Remarks, 01/21/2026, pages 11-15).
This argument has been fully considered but not found persuasive.
MPEP says, "the Board stated that when there is motivation to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. KSR, 550 U.S. at 402-03, 82 USPQ2d at 1390” (MPEP, 2143/section E).
In regard to the 1st argument that the prior art does not teach a soybean plant with a knock out or null allele of CKX3 and at least one additional endogenous CKX1, CKX2, CKX4, or CKX6 gene is unpersuasive. Lammertyn explicitly teaches that its methods apply to soybean. Since CKX function is highly conserved, a person skilled in the art would have reasonable expectation of success in applying the multi-gene knock out strategies to soybean to increase yield. The combination of Lammertyn and Schmulling provides a clear roadmap. Both references suggest that the reduction of CKX activity, specifically knocking out both CKX3 and CKX1, is a known strategy to enhance plant productivity. Therefore, it is well known to disrupt the activity of multiple CKX genes.
In regard to the 2nd argument that Lammertyn’s mutants are not true mutants is unpersuasive. The Applicant’s analyses between a “null allele” and a “truncated protein” is a matter of design choice. The prior art teaches the disruption of CKX activity to achieve the desired phenotype. Targeting the gene to stop its primary function is obvious objective, especially since both Lammertyn and Schmulling teach disrupting activity, regardless of whether a non-functional protein fragment remains.
In regard to the 3rd argument that Lammertyn does not teach increasing planting density is unpersuasive. Lammertyn discloses the link between these mutations and higher planting density. Optimizing crop spacing to maximize the yield of a new variety is routine experimentation for a person skilled in the art. Lammertyn provides the motivation to use higher planting density to mitigated side-branching yield decreases, making it an obvious optimization strategy.
In response to Applicant's 4th argument that the references fail to show certain features of the invention, it is noted that the features upon which Applicant relies (i.e., guide nucleic acid “has at least two components, namely at least one spacer sequence that is complementary to (and hybridizes to) a target DNA and at least one repeat sequence (e.g., of a CRISPR-Cas system)”) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The Applicant is arguing narrow definitions (such as specific CRISPR structures) that are not present in the claims. Under the broadest reasonable interpretation, the cited art’s teaching of the gene targeting and site-directed mutagenesis reads on the claim requirements of an endonuclease or nucleic acid.
At least for these reasons, the rejection is maintained.
Claim Rejections - 35 USC § 103(new)
Claim 37, is rejected under 35 U.S.C. 103 as being unpatentable over Lammertyn et al. (US Pub. No. 2019/0153456 A1 (previously cited)), Schmulling et al. (US Pub. No. 2014/0380526 A1 (A)), in view of Zou et al. (GenBank accession no. JQ582834.1, 2012, June 29 (previously cited)), in light of Schmutz et al. (UniProt accession no. H7BRI4, 2012 (previously cited)) as applied to claim 30 above, and in further in view of Shoemaker et al. (GenBank accession no. BU926889, 2004 (U)).
In regard to claim 37, and the teachings of Lammertyn, Schmulling, Zou, and Schmutz as applied to claim 30 above.
In regard to claim 37, Lammertyn, Schmulling, Zou, and Schmutz do not teach on SEQ ID NO: 93.
In regard to claim 37, Shoemaker teaches the GenBank accession no. BU926889 having 100% sequence identity to Applicants SEQ ID NO: 93(see alignment below). The primary objective is to disrupt CKX1 activity. Any significant deletion on or near these motifs (transmembrane and/or FAD binding region) would cause a frameshift mutation, thereby changing the entire downstream amino acid sequence. This inevitably result in a non-functional and unstable CKX1 protein. Therefore, one skilled in the art would predictably identify the target regions of CKX1 and its conserved motif’s with a reasonable expectation of success. Reduction to practice is not required.
RESULT 1
BU926889
LOCUS BU926889 525 bp mRNA linear EST 01-JUL-2004
DEFINITION sas92h09.y1 Gm-c1036 Glycine max cDNA clone SOYBEAN CLONE ID:
Gm-c1036-11874 5' similar to TR:O81158 O81158 CYTOKININ OXIDASE.
[1], mRNA sequence.
ACCESSION BU926889
VERSION BU926889.1
DBLINK BioSample: SAMN00158662
KEYWORDS EST.
SOURCE Glycine max (soybean)
ORGANISM Glycine max
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
kb inversion clade; NPAAA clade; indigoferoid/millettioid clade;
Phaseoleae; Glycine; Glycine subgen. Soja.
REFERENCE 1 (bases 1 to 525)
AUTHORS Shoemaker,R., Keim,P., Vodkin,L., Erpelding,J., Coryell,V.,
Khanna,A., Bolla,B., Marra,M., Hillier,L., Kucaba,T., Martin,J.,
Beck,C., Wylie,T., Underwood,K., Steptoe,M., Theising,B., Allen,M.,
Bowers,Y., Person,B., Swaller,T., Gibbons,M., Pape,D., Harvey,N.,
Schurk,R., Ritter,E., Kohn,S., Shin,T., Jackson,Y., Cardenas,M.,
McCann,R., Waterston,R. and Wilson,R.
TITLE Public Soybean EST Project
JOURNAL Unpublished
COMMENT Contact: Shoemaker R/Public Soybean EST Project
Public Soybean EST Project
Washington University School of Medicine
4444 Forest Park Parkway, Box 8501, St. Louis, MO 63108, USA
Tel: 314 286 1800
Fax: 314 286 1810
Email: est\@watson.wustl.edu
When it has been determined, an EST from the other end of this
clone is listed in the 'Other ESTs on clone' field. This clone is
available through: Biogenetic Services, 801 32nd Ave. Brookings, SD
57006 USA (phone: 800 423 4163; email: info\@biogeneticservices.com)
Seq primer: -40RP from Gibco
High quality sequence stop: 447.
FEATURES Location/Qualifiers
source 1..525
/organism="Glycine max"
/mol_type="mRNA"
/cultivar="Jack"
/db_xref="taxon:3847"
/clone="SOYBEAN CLONE ID: Gm-c1036-11874"
/tissue_type="somatic embryos cultured on MSD 20"
/clone_lib="SAMN00158662 Gm-c1036"
/lab_host="DH10B"
/note="Vector: pSPORT1; Site_1: NotI; Site_2: SalI; This
cDNA library was constructed from mRNA isolated from
somatic embryos (age ranging from 2 months to 9 months)
cultured on MSD 20. The library was prepared using the
Life Technologies pSuperScript cDNA library construction
kit. Complementary DNA was synthesized from mRNA using a
poly (dT) sequence with a NotI restrictions site. SalI
linkers adapters were ligated to the blunt-ended cDNA
fragments followed by NotI digestion. The cDNA fragments
were directionally cloned into the NotI-SalI restriction
site of the pSPORT1 vector. The ligated cDNA fragments
were transformed into E.coli ElectroMax DH10B host cells.
This library was constructed in the laboratory of Dr. Lila
Vodkin by Anu Khanna at the University of Illinois at
Urbana-Champaign. e-mail: l-vodkin\@uiuc.edu"
ORIGIN
Query Match 100.0%; Score 177; Length 525;
Best Local Similarity 100.0%;
Matches 177; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACATACTTCATCCTCCTGTTCATAACCATAACACGTTTGATCTCCACAGTGGGCAAAACC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 106 ACATACTTCATCCTCCTGTTCATAACCATAACACGTTTGATCTCCACAGTGGGCAAAACC 165
Qy 61 TCCCAATGGACGAAGGCCCTGTCGCTGCCTCCGGAACTCGCCTCCGTCTCCCTCGACGAC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 166 TCCCAATGGACGAAGGCCCTGTCGCTGCCTCCGGAACTCGCCTCCGTCTCCCTCGACGAC 225
Qy 121 ACCATCTTCTGCAAGCTCCGTGACGACCCAGAGGCCCTCCAGGGAAGGGCCTCCAGG 177
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 226 ACCATCTTCTGCAAGCTCCGTGACGACCCAGAGGCCCTCCAGGGAAGGGCCTCCAGG 282
Given the teachings of Lammertyn, Schmulling, Zou, and Schmutz/UniProt as taught above would utilize BLAST to identify the sequence of the endogenous CKX1 in soybean to knock out as taught by Shoemaker teaching GenBank accession no. BU926889 having 100% sequence identity to Applicants SEQ ID NO: 93. Lammertyn also points out that one skilled in the art would want to target these motif’s to create full knock-outs. This would have been obvious to try targeting CKX3 along with CKX1 since the prior art teaches that one skilled in the art to target these to create a knock-out resulting inhibited activity and improve plant performance. It is the Office’s position, based on the teachings, is that producing a null or knockout CKX3 and CKX1 gene, is well-known and well characterized in the art make it a well-known option to produce a soybean plant cell with inhibited CKX3 activity specifically at positions 35-169 (amino acids 12-57) and an additionally CKX1 gene. Furthermore, the primary objective is to disrupt CKX3 and CKX1 activity. Any significant deletion on or near these motifs (transmembrane and/or FAD binding region) would cause a frameshift mutation, thereby changing the entire downstream amino acid sequence. This inevitably result in a non-functional and unstable CKX3 and CKX1 protein. It is a well-established principle that any large deletion of this nature will lead to the disruption of gene activity.
Therefore, the Office’s position is that it would be obvious for those ordinary skill in the art to produce a soybean plant cell with a CKX3 and CKX1 knockout, using a blueprint on how to make CKX3/CKX1 knockouts, the gene and conserved region through the use of computer programs such as BLAST, Zou’s teaching of disclosing the CKX3 gene JQ582834 sequence, and Shoemaker teaching GenBank accession no. BU926889 would have been an obvious for one skill in the art to try with a reasonable expectation of success to produce a soybean plant cell comprising a CKX3/CKX1 knock-out.
Claim Rejections - 35 USC § 103(amended)
Claim 123, are rejected under 35 U.S.C. 103 as being unpatentable over Lammertyn et al. (US Pub. No. 2019/0153456 A1 (previously cited)), Schmulling et al. (US Pub. No. 2014/0380526 A1 (A)), in view of Zou et al. (GenBank accession no. JQ582834.1, 2012, June 29 (previously cited)), and in light of Schmutz et al. (UniProt accession no. H7BRI4, 2012 (previously cited)), as applied to claims 30 and 122 above, and further in view of Montague et al. (CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. 2014. Nucleic Acids Res. 42, W401–7 (W)).
a. In regard to claim 123, and the teachings of Lammertyn, Schmulling, Zou, and Schmutz as applied to claims 30 and 122 above.
b. In regard to claim 123, Lammertyn, Schmulling, Zou, and Schmutz do not teach on the spacer sequences.
c. In regard to claim 123, Montague teaches a blueprint on how to use the computer program “CHOPCHOP, a web-based tool that allows users to easily and rapidly select the optimal TALEN or CRISPR/Cas9 target sequences in genes from a variety of organisms” (see page W402), which helps one skilled in the art to “easily” to identify the “optimal” spacer sequences (target sequences). Therefore, one skilled in the art would yield spacer sequences of SEQ ID NOs: 105-107 and reduction to practice is not required.
d. Given Lammertyn’s teaching of modifying CKX3 gene resulting in a null or knock out which in turn result in improved yield, along with the combination of CKX3 and CKX1 as taught by Schmulling, in view of Zou’s teaching of disclosing the CKX3 gene JQ582834 having 100% sequence identity to SEQ ID NO: 79 and 80. Additionally, in light of Schmutz/UniProt teach the conserved regions of the GmCKX3, specifically teaches on the transmembrane region positions 6-23. Both Lammertyn and Schmutz/UniProt teach on over-lapping conserved regions 12-57 and 6-23, respectively. Lammertyn also points out that one skilled in the art would want to target these motif’s to disrupt activity. Moreover, Montague teaches a blueprint on how to use the computer program Chop-Chop, specifically identifying the optimal spacer sequence used targeting, which would arrive to SEQ ID NO: 105-107. This would have been considered a reason to combine and obvious to try both teachings since the prior art teaches that one skilled in the art to target the binding domains resulting inhibited activity, and a blueprint on how to identify the conserved regions. It is the Office’s position, based on the teachings, is that producing a null or knockout CKX3/CKX1 gene, is well-known and well characterized in the art make it a well-known option to produce a soybean plant cell with inhibited CKX3/CKX1 activity to increase yield.
Therefore, the Office’s position is that it would be obvious for those ordinary skill in the art to produce a soybean plant cell with a CKX3/CKX1 knockout, using a blueprint on how to make CKX3/CKX1 knockouts to increase yield, gene and conserved region identification computer program BLAST, NCBI’s teaching of disclosing the CKX3/CKX1 gene JQ582834 sequence, and computer programs like ChopChop to identify the optimal spacer sequences would have been an obvious for one skill in the art to try with a reasonable expectation of success to produce a soybean plant cell comprising a CKX3/CKX1 null or knockout and the spacer sequences.
Response to Applicant's Remarks:
Since the rejections have been modified to reflect the amendment to the claims, only the arguments that are relevant to the current rejections are responded below:
To the extent Applicant’s traversals apply to the above rejection, Applicant traverses primarily that Montague does not compensate for the deficiencies of Lammertyn, Zou, and Schmutz. (Remarks, 01/21/2026, pages 11-15).
This argument has been fully considered but not found persuasive.
MPEP says, "the Board stated that when there is motivation to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. KSR, 550 U.S. at 402-03, 82 USPQ2d at 1390” (MPEP, 2143/section E).
In regard to the 1st argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, the combination of Lammertyn, Schmulling, Zou, Schmutz and Montague render the claimed invention obvious.
At least for these reasons, the rejection is maintained.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTIAN JOSE ORDAZ whose telephone number is (703)756-1967. The examiner can normally be reached 8:30 am-5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.J.O./Examiner, Art Unit 1663
/PHUONG T BUI/Primary Examiner, Art Unit 1663
Prosecution Insights