Prosecution Insights
Last updated: July 17, 2026
Application No. 17/674,692

UBE3A ANTISENSE THERAPEUTICS

Final Rejection §103§DOUBLEPATENT§DP
Filed
Feb 17, 2022
Priority
Feb 17, 2021 — provisional 63/150,188
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Quelltx Inc.
OA Round
6 (Final)
52%
Grant Probability
Moderate
7-8
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
37 granted / 71 resolved
-7.9% vs TC avg
Strong +66% interview lift
Without
With
+66.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
38 currently pending
Career history
117
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
51.1%
+11.1% vs TC avg
§102
10.8%
-29.2% vs TC avg
§112
8.0%
-32.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 71 resolved cases

Office Action

§103 §DOUBLEPATENT §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claims 1-3, 5, 7-11, 13-18 are pending. Claim 18 stands withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Elected group I claims 1-3, 5, 7-11, 13-17 along with elected species SEQ ID NO: 8 are examined here. It should be noted that SEQ ID NO: 155 and 156 are identical to elected SEQ ID NO: 8 and are also examined. Priority Acknowledgment to domestic priority of U.S. Provisional App. 63/150188, filed on 2/17/2021 is recognized. All examined claims enjoy the benefit of ‘188 filing date. Information Disclosure Statement The information disclosure statement (IDS) submitted on 01/30/2026 was filed after the mailing date of the prior Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Claim Rejections - 35 USC § 103 Rejection of claims 1-3, 5, 7-11, 13-17 under Fink, Benson and Magner is withdrawn due to the amendment to claim 1. Upon further search and consideration, claims 1-3, 5, 7-11, 13-17 were rejected under Fink, Benson and Vickers and Prakash. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 5, 7-11, 13-14, 17 are rejected under 35 U.S.C. 103 as being unpatentable over Fink et al. (2017, Nature Communications, 8, pg. 1-14, referred as Fink, of record), Benson et al. (US20100249052, referred as Benson, of record) and Vickers et al. (2003, JBC, 278, pg. 7108-7118, of record) and Prakash et al. (US20140343123A1, pub. 11/20/2014, “Prakash”). Here, elected SEQ ID NO: 8, SEQ ID NO: 155 and 156 are examined. Each has the following 20 nt. sequence: gcaatctggtgtagaccctt. (The examiner will only note SEQ ID NO: 8.) Further SEQ ID NO: 14 is ACCTCATTCAGTGGTTCATT. Fink discloses ASOs that inhibit expression of UBE3A transcript (pg. 11 in Methods, and pg. 4, Fig. 2a, d, relevant to instant cl. 2, 3). Fink discloses “ASOs are 20 bp in length with five 2’-O-methoxyethyl-modified nucleotides at each end of the oligonucleotide, ten DNA nucleotides in the centre and a phosphorothioate backbone” (pg. 11, relevant to instant cl. 7, 8, 9, 10, 11). The 2MOE is a modified RNA sugar. Further, the ASO gapmer of Fink demonstrated ~60% reduction in UBE3A mRNA expression and UBE3A protein levels (pg. 4), and it is known that gapmer designed ASO induce RNase H mediated cleavage, as evidenced by Vickers in caption of Table 1, noting that gapmer with deoxynucleotides serve as a substrate for RNase H (pg. 7111, relevant to instant cl. 5). Fink discloses ASO-1 (5′-TGAGCTATCACCTATCCTTG-3′) and ASO-2, 5′-CATTGTGATTTGTGTCCACT-3′ (pg. 11). ASO-1 has 19 out of 20 nt. that are identical with instant SEQ ID NO: 6 (gtgagctatc acctatcctt; underlined sequence corresponds with bolded sequence of ASO-1, relevant to instant cl. 14). However, Fink does not disclose the elected SEQ ID NO: 8, nor the plurality of ASOs, nor a conjugated ASO, nor a backbone comprising at least one phosphorothioate internucleoside linkage (PS-INL) and at least one phosphodiester internucleoside linkage (PO-INL). Benson discloses in claim 1 a double stranded RNA inhibiting the expression of human E6AP gene, a ubiquitin ligase protein, and consists of a sense and an antisense strand. Benson discloses that E6AP (E6-associated protein) refers to ubiquitin protein ligase E3A (ube3A) (par. 39). Antisense oligonucleotide is complementary to mRNA encoding E6AP. Recitation of a composition comprising an antisense oligonucleotide can also reasonably be interpreted as to encompass a dsRNA which has a sense strand and an antisense strand and is not only limited to a single-stranded ASO. Benson discloses, in Table 1, an antisense oligonucleotide with SEQ ID NO: 719 AGCAAUCUGGUGUAGACCCTT, a 21 nt. sequence (with compound # ND-10182) comprising the complete 20 nt. sequence of instant SEQ ID NO: 8 (underlined, bolded portion matches SEQ ID NO: 8, relevant to instant cl. 1). Table 2 discloses that compound #ND-10182 has only ~16% transcript remaining in an in vitro study (pg. 30, i.e. ~ 84% inhibition). PNG media_image1.png 139 328 media_image1.png Greyscale Further, the base sequence has the same structural limitation as claim 1 so inherently reads on functional limitation recited in claim 13 with no more than 4 mismatches in a homologous segment in a rodent genome (relevant to instant cl. 13). Benson discloses conjugating a ligand to the dsRNA, the ligand can be hydrophobic ligand, substrate for receptor-mediated endocytosis, or carbohydrate clusters (par. 71). Ligand conjugation facilitates in cellular absorption and tissue targeting (par. 71, relevant to instant cl. 17). Further, Benson discloses SEQ ID NO: 894, ACCUCAUUCAGUGGUUCAUTT, which comprises the complete 20 nt. of instant SEQ ID NO: 14 (ACCTCATTCAGTGGTTCATT) (Table 1, relevant to instant cl. 14). Benson’s SEQ ID NO: 894 has compound #ND-10357, which results in 28.86% transcript remaining (pg. 32, i.e. a ~72% inhibition). Further Benson, discloses a pharmaceutical composition comprising more than one type of dsRNA, which aids in targeting different regions of the transcript (par. 100, 186). Thus based on the successful inhibition of target transcript targeting two separate sites, it would be obvious for a skilled artisan to combine two known products (SEQ ID NOs: 719 and 894) to yield predictable results (relevant to instant cl. 14). Benson does not disclose ASO. Vickers et al. (2003, JBC, 278, pg. 7108-7118) comparing siRNAs and ASOs note that “[e]xamination of 80 siRNA oligonucleotide duplexes designed to bind to RNA from four distinct human genes revealed that, in general, activity correlated with the activity to RNase H-dependent oligonucleotides designed to the same site, although some exceptions were noted. The one major difference between the two strategies is that RNase H-dependent oligonucleotides were determined to be active when directed against targets in the pre-mRNA, whereas siRNAs were not. These results demonstrate that siRNA oligonucleotide- and RNase H-dependent antisense strategies are both valid strategies for evaluating function of genes in cell-based assays” (abstract, bold/underline for emphasis). Vickers indicate that there was a correlation between the activity of siRNA (comprising both an antisense and complementary sense strands) and ASO, and thus it is reasonable to consider the inhibition of either siRNA or ASO for the same target site since they behave in a similar fashion: i.e. an antisense strand hybridizes to an accessible site on the target transcript. Vickers also notes that “the loss of activity was greater for the RNase H-dependent oligonucleotide than the siRNA but not significantly so” (pg. 7117). Fink, Benson, and Vickers do not disclose an ASO comprising a backbone comprising at least one phosphorothioate internucleoside linkage (PS-INL) and at least one phosphodiester internucleoside linkage (PO-INL). Prakash discloses that a replacing one or more phosphorothioate linkages of a fully phosphorothioate antisense compound with phosphodiester linkages results in improvement in some measures of tolerability, i.e. one or more PO-INL(s) are less immunogenic than a backbone solely of PS-INL (par. 15). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified a dsRNA SEQ ID NO: 719 in view of Benson and Vickers and Prakash and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Benson’s inhibition of target transcript using SEQ ID NO: 719 at ~80%; Vickers noting that dsRNA based RNAi silencing and RNaseH-based ASO silencing result in similar inhibitory activities with ASO having modest increased potency compared to a siRNA; and Prakash noting an oligonucleotide that a mix of PO-INLs and PS-INLs is less immunogenic than an oligonucleotide with a backbone solely of PS-INLs, a skilled artisan would reasonably expect success by modifying a siRNA of SEQ ID NO: 719 to an ASO sequence of 20 nt. with both PS-INL and PO-INL to inhibit the target transcript of Ube3a with reduced immunogenicity based on hybridizing to the transcript and recruiting RNaseH enzyme for degradation of the hybrid DNA/RNA structure. Claims 15 and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Fink et al. (2017, Nature Communications, 8, pg. 1-14, referred as Fink, in prior Action of 05/11/2023), Benson et al. (US20100249052, referred as Benson, in prior Action of 05/11/2023) and Vickers et al. (2003, JBC, 278, pg. 7108-7118, of record, referred as Vickers) and Prakash et al. (US20140343123A1, pub. 11/20/2014, “Prakash”) as applied to claims 1-3, 5, 7-11, 13, 14, 17 above, and further in view of Olson et al. (US20160237427, referred as Olson, in prior Action). As noted above for claims 1-3, 5, 7-11, 13, 14, 17 Fink teaches a 20 nt. ASO gapmer, with central 10 nt. as DNA bases and flanking 5 nt. wings comprising 2MOE modification and phosphorothioate backbone, that inhibits UBE3A expression. Thus Fink discloses a 5-10-5 gapmer and phosphorothioate backbone, which is interpreted that all internucleotide linkage are phosphorothioate. Vickers discloses the same 5-10-5 gapmer with all internucleotide linkages as phosphorothioate (pg. 7111, Table 1 caption). Benson discloses, in Table 1, an antisense oligonucleotide with SEQ ID NO: 719 AGCAAUCUGGUGUAGACCCTT, a 21 nt. sequence, of a dsRNA duplex, which comprises the complete instant 20 nt. SEQ ID NO: 8 (underlined, bolded 20 nt. in sequence above). Fink, Benson, Vickers do not disclose the 4-12-4 gapmer. Olson discloses the 4-12-4 gapmer design for antisense oligomer with the wings consisting of 4 2-MOE modified ribose sugars (par. 361). Olson further discloses all internucleotide linkage groups are phosphorothioate (par. 384). Olson discloses modification in gapmer design affects decrease in off-target binding and better long term tolerability (par. 338). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified a 5-10-5 gapmer of Fink in view of Olson and arrive at the claimed invention with a reasonable expectation of success. Based on the Olson’s disclosure that a decreased-wing length that are modified results in decreased off-target activity, a skilled artisan would reasonably expect success in reducing off-target effects by modifying a 5-10-5 gapmer of Fink to a 4-12-4 gapmer of Olson for reduced off-target effects. Thus, cl. 15 and 16 are obvious. Response to Arguments Applicant's arguments filed 03/19/2026 have been fully considered but they are not persuasive. The Remarks raise various issues: The Remarks indicate that the ASO backbone containing a mixture of PS-INL and PO-INL is absent in the cited prior art (pg. 6). The Remarks discusses designing oligonucleotide with mixed PS-INL/PO-INL in Ex. 3-6 of specification and indicate results with dose-response and protein knockdown (pg. 7) and add that “decision to incorporate PO linkages [i.e. PO-INL] into the wings of the gapmer arose from the inventors’ own insight” (pg. 7). The argument is not persuasive. The rejection notes a Prakash reference teaching oligonucleotide with mixed PS-INL and PO-INL backbone. Further the incorporation of PO-INL along with PS-INL backbone reduces immunogenic side-effects and for some achieve comparable results as fully PS backbone while for some the mixture of PO-INL/PS-INL results in loss of potency. Regardless, Prakash discloses designing a gapmer with a backbone comprising both PO-INL and PS-INL that is able to inhibit the expression of target gene and although less potent would achieve a dose response and inhibit the expression of target gene. Thus, the rejection is maintained. Double Patenting The double patenting rejection is maintained. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-3, 5, 7-11, 13-17 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-11, 13-17 of copending Application No. 19/188,812 (‘812). Although the claims at issue are not identical, they are not patentably distinct from each other. Elected SEQ ID NOs: 8 is the same as SEQ ID NO: 8 of ‘812, same applies for SEQ ID NO: 14 for both applications. Claims 1, 4, 6 of ‘812 correspond to instant claim 1. Regarding at least one PS-INL and at least one PO-INL, the recited SEQ ID NOs have at least one gapmer, e.g., SEQ ID NO: 228, that has a mixture of both PS-INLs and PO-INLs. Claims 2, 3, 5, 7-11, 14-17 of ‘812 correspond to the same numbered claims on instant application. Regarding instant cl. 13, it is not patentably distinct from cl. 13 of ‘812 because they overlap in number of mismatches, instant app. requires up to 4 mismatches in a homologous segment in a rodent genome, while ‘812 requires up to 5 mismatches. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Response to Arguments Applicant's arguments filed 03/19/2026 have been fully considered but they are not persuasive. The Remarks requests that the rejection be held in abeyance until allowable subject matter is identified (pg. 7). The argument is not persuasive, thus the rejection is maintained. Allowable Subject Matter No claim is allowed. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Show 7 earlier events
Aug 29, 2024
Response Filed
Dec 06, 2024
Final Rejection mailed — §103, §DOUBLEPATENT, §DP
Feb 28, 2025
Request for Continued Examination
Mar 05, 2025
Response after Non-Final Action
Nov 04, 2025
Response Filed
Dec 19, 2025
Non-Final Rejection mailed — §103, §DOUBLEPATENT, §DP
Mar 19, 2026
Response Filed
Apr 28, 2026
Final Rejection mailed — §103, §DOUBLEPATENT, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12648958
TREM COMPOSITIONS AND USES THEREOF
1y 9m to grant Granted Jun 09, 2026
Patent 12630839
METHODS AND COMPOSITIONS FOR THE TREATMENT OF FABRY DISEASE
6y 4m to grant Granted May 19, 2026
Patent 12624356
COMPOUNDS AND METHODS FOR MODULATING PLP1
2y 10m to grant Granted May 12, 2026
Patent 12612626
An siRNA compound that inhibits expression of APOC3
3y 10m to grant Granted Apr 28, 2026
Patent 12600967
An siRNA compound that inhibits complement factor B (CFB).
3y 9m to grant Granted Apr 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

7-8
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+66.0%)
3y 7m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 71 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month