DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from International Application PCT/US2016/053416 filed 09/23/2016 and Provisional Applications Nos. 62/315,521 filed 03/30/2016, 62/307,279 filed 03/11/2016 and 62/232,956 filed 09/25/2015 is hereby acknowledged.
This Application is a CON of Patent Application Nos. 16/695,551 filed 11/26/2019 and 15/761,964 filed 03/21/2018.
Application Status
This Office Action is in response to Amendments and Remarks filed 07/24/2026.
Amendments to claims filed 07/24/2026 are hereby acknowledged. Claims 1-55, 59-62, 66, 69 and 74-84 are cancelled. Claim 56 is currently amended. Claims 85-89 are newly added. Therefore, claims 56-58, 63-65, 67-68, 70-73 and 85-89 are pending and under consideration in this Office Action.
Any objection or rejection not reiterated herein has been overcome by amendments and is therefore withdrawn.
Applicant’s amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for the reasons that follows.
Drawings
Amendments to Drawings filed 07/24/2026 are hereby acknowledged. Replacement sheets for Drawings are acceptable.
Specification
Amendments to Specification filed 07/24/2026 are hereby acknowledged. Replacement sheets are acceptable.
The following rejections are maintained from Office Action dated 01/27/2026, but are modified as necessitated by Applicant’s amendments filed 07/24/2026:
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or non-obviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 56-58, 63-65, 67-68, 70-71 and 85-89 are rejected under 35 U.S.C. §103 as being unpatentable over Van Roon-Mom (Van Roon-Mom, W.M.C. et al. US Patent No. 9,611,471 B2, published April 4, 2017, benefitting from priority of US 2013/0198877 A1, published August 1, 2013 and US Application No. 12/814,203 filed August 4, 2011) in view of Evers (Evers, M.M. et al. “Ataxin-3 protein modification as a treatment strategy for spinocerebellar ataxia type 3: Removal of the CAG containing exon”. Neurobiology of Disease, Vol. 58 (2013), pp: 49-56; cited on IDS filed 06/07/2024 as NPL# 11).
Regarding claims 56 and 85-89, it recites “An oligomeric compound comprising a modified oligonucleotide consisting of 15-25 linked nucleosides, wherein the modified oligonucleotide comprises 15, 16, 17, or 18 contiguous nucleobases of SEQ ID NO: 6; wherein each nucleoside of the modified oligonucleotide comprises a 2' -O-methoxyethyl group”.
A search for sequence set forth in SEQ ID NO: 6 retrieved the following results (Qy, query = SEQ ID NO: 6; Db, Database = SEQ ID NO: 143 of US Patent No. 9,611,471, i.e. Van Roon-Mom):
US-13-814-203-143/c
(NOTE: this sequence has 2 duplicates in the database searched.
See complete list at the end of this report)
Sequence 143, US/13814203
Patent No. 9611471
GENERAL INFORMATION
APPLICANT: Academisch Ziekenhuis Leiden h.o.d.n. LUMC
APPLICANT: van Roon-Mom, Wilhelmina M.C.
APPLICANT: Evers, Melvin M.
APPLICANT: Pepers, Barry A.
APPLICANT: Aartsma-Rus, Annemieke
APPLICANT: van Ommen, Garrit-Jan B.
TITLE OF INVENTION: Antisense oligonucleotide directed removal of proteolytic
TITLE OF INVENTION: cleavage sites from proteins
FILE REFERENCE: P91958PC00
CURRENT APPLICATION NUMBER: US/13/814,203
CURRENT FILING DATE: 2013-02-04
PRIOR APPLICATION NUMBER: PCT/NL2011/050549
PRIOR FILING DATE: 2011-08-04
PRIOR APPLICATION NUMBER: EP 10172076.1
PRIOR FILING DATE: 2010-08-05
PRIOR APPLICATION NUMBER: US 61/370,855
PRIOR FILING DATE: 2010-08-05
NUMBER OF SEQ ID NOS: 234
SEQ ID NO 143
LENGTH: 22
TYPE: DNA
ORGANISM: Artificial
FEATURE:
OTHER INFORMATION: target hATXN3Ex9_1
Query Match 100.0%; Score 22; Length 22;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGATATGTTTCTGGAACTACC 22
||||||||||||||||||||||
Db 22 GAGATATGTTTCTGGAACTACC 1
Therefore, US Patent No. 9,611,471 teaches an oligonucleotide consisting of 15-25 nucleosides, wherein the oligonucleotide comprises 18 contiguous nucleobases of SEQ ID NO: 6, since it teaches the RNA version and complementary sequence of SEQ ID NO: 143, SEQ ID NO: 144:
US-13-814-203-144
(NOTE: this sequence has 3 duplicates in the database searched.
See complete list at the end of this report)
Sequence 144, US/13814203
Patent No. 9611471
Query Match 100.0%; Score 22; Length 22;
Best Local Similarity 68.2%;
Matches 15; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGATATGTTTCTGGAACTACC 22
||||:|:|:::|:|||||:|||
Db 1 GAGAUAUGUUUCUGGAACUACC 22
SEQ ID NO: 144, complementary to SEQ ID NO: 143 is 100% identical to SEQ ID NO: 6, cited in Table 3 in columns 21-22, i.e., a sequence that comprises more than 19 or 20 contiguous nucleobases of SEQ ID NO: 6 (claim 86), a sequence that comprises 22 contiguous nucleobases of SEQ ID NO: 6, which is more than the “at least 21 contiguous nucleobases” (claim 87) and is at least 22 contiguous nucleobases of SEQ ID NO: 6 (claim 88).
Therefore, Van Roon-Mom teaches oligonucleotides that can be 22 nucleobases in length, i.e., 22 linked nucleosides (claim 85).
Regarding the limitation “wherein at least one nucleoside of the modified oligonucleotide comprises a 2’-O-methoxyethyl group”, Van Roon-Mom teaches antisense oligonucleotide that are uniformly 2’-O-methoxyethylribose modified with phosphorothioate internucleoside linkages (see claim 2, columns 97-98 and claim 4, columns 99-100).
Van Roon-Mom also teaches that the antisense oligonucleotide is uniformly modified with phosphorothioate internucleotide linkages (see claims 2 and 4, columns 97-100, and column 13, “Examples” section, lines 67-67).
Regarding claim 57, Van Roon-Mom teaches a method using the antisense oligonucleotides listed in Table 3, as the component of the composition (see claim 3, columns 97-98).
Regarding claim 58, Van Roon-Mom teaches a method of using an antisense oligonucleotide that binds to the pre-mRNA to form a double-stranded nucleic acid complex (see claim 1, columns 97-98). Therefore, if in complex the antisense is forming a double stranded nucleic acid with the pre-mRNA, the antisense taught by Van Roon-Mom is a single-stranded oligonucleotide.
Regarding claims 63-65 and 89, Van Roon-Mom teaches modified nucleobases using in some embodiments nucleotide analogues, so the one or more sugar moieties are mono- or disubstituted at the 2’, 3’ and/or 5’ position, with –OH, --F, alkyl, alkenyl, alkynyl, alkaryl, allyl, aryl, or aralkyl groups that may be interrupted by one or more heteroatoms, -methoxy, -aminopropoxy, -aminoxy, methoxyethoxy etc.. (see columns 7 (line 60) to 8 (line 10). Therefore, methyl radical, the simplest alkyl radical is included in the embodiments. Van Roon-Mon teaches a sequence, i.e., SEQ ID NO: 144 that comprises a cytosine nucleobase, that can be modified at a 5’ position (see columns 7 (line 60) to 8 (line 10).
Van Roon-Mom also teaches that the antisense oligonucleotide is a 2’-O-methoxyethylribose modified phosphorothioate oligonucleotide (see claims 2 and 4, columns 98 and 99).
Regarding claim 67, Van Roon-Mom teaches the use of Nanotechnology to deliver oligonucleotides to the brain, e.g. nanogel consisting of cross-linked PEG and polyethyleneimine, as well as encapsulation in liposomes (see column 9, lines 12-16).
Regarding claim 68, Van Roon-Mom teaches a method of modulating splicing of a pre-mRNA in a cell comprising contacting the cell with an oligomeric compound comprising an antisense oligonucleotide modified with a 2’-)-methoxyethyl group (see column 14, lines 55-67 and column 15, line 1-7).
However, the specific oligonucleotide in the preferred embodiment, is an antisense oligonucleotide against Huntingtin pre-mRNA (see claims 1 and 2, columns 97-98).
Even though Van Roon-Mom teaches the potential use of antisense oligonucleotide set forth in SEQ ID NO: 144 for Spinocerebellar Ataxia type 3 (SCA3) (see Table 3, columns 21-22), Van Roon-Mom fails to teach modifying the specific antisense oligonucleotide taught in SEQ ID NO: 144 and using it to modulate splicing of Ataxin-3 pre-mRNA, and a specific pharmaceutically acceptable carrier.
However, Evers teaches the oligonucleotide set forth as SEQ ID NO: 144 in Van Roon-Mom, in the form of AON 9.1 in Table 1, on page 50 (right column).
Evers teaches using 2’-O-methyl modified antisense oligonucleotides (AONs) with a phosphorothioate backbone to induce an in-frame exon skip in the ataxin-3 pre-mRNA. Van Roon-Mom teaches the result as a modified ataxin-3 protein lacking the polyQ repeat, while total ataxin-3 protein levels were unaltered and its functional domains remained intact (see page 50, left column, last paragraph of “Introduction” section).
Evers teaches using liposomes, under the form of LipofectamineTM to contact the cells with the AONs (see page 50, left column, “Cell culture and transfection” subsection, second paragraph).
Evers also teaches injections of AONs carried in sterile saline, i.e. a pharmaceutically acceptable carrier, to C57bl/6j mice (see page 51, right column, “AON injection into mice” subsection).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the AON taught by Van Roon-Mom as SEQ ID NO: 144, further modified it to add a 2’-O-methoxyethyl group and a 5-methylcytosine, as taught by Van Roon-Mom and used the modified AON as taught by Evers for modulating splicing in Ataxin-3 pre-mRNA. One with ordinary skills in the art motivated in using an AON with a sequence proven to be effective in exon skipping in Ataxin-3 for developing a treatment for SCA3, could have performed this modification with a reasonable expectation of success.
Regarding claim 70, Evers teaches contacting the AON with cells in vitro (see page 50, left column, “Cell culture and transfection” subsection, second paragraph).
Regarding claim 71, Evers teaches contacting the AON with cells in an animal ((see page 51, right column, “AON injection into mice” subsection).
Claims 72 and 73 are rejected under 35 U.S.C. §103 as being unpatentable over Van Roon-Mom (Van Roon-Mom, W.M.C. et al. US Patent No. 9,611,471 B2, published April 4, 2017, benefitting from priority of US 2013/0198877 A1, published August 1, 2013, and US Application No. 12/814,203 filed August 4, 2011) in view of Evers (Evers, M.M. et al. “Ataxin-3 protein modification as a treatment strategy for spinocerebellar ataxia type 3: Removal of the CAG containing exon”. Neurobiology of Disease, Vol. 58 (2013), pp: 49-56; cited on IDS filed 06/07/2024 as NPL# 11), as applied to claim 56 above, and in further view of Van Roon-Mom II (Van Roon-Mom, W.M.C. et al. US2014/0039037 A1, published February 6, 2014; cited on IDS filed 06/07/2024).
The rejection of claim 56 is described above; the combination of Van Roon-Mom and Evers renders elements of claim 56 obvious.
However, the combination of references does not specifically teach elements of claim 72 and 73, i.e. “wherein the administering reduces the number and/or the volume of aggregates in brain tissue” (claim 72) and “wherein the brain tissue is selected from the group consisting of brainstem, cerebellum, and cortex” (claim 73).
However, Van Roon-Mom II teaches these limitations.
Regarding claims 72 and 73, Van Roon-Mom II teaches all the elements taught by Van Roon-Mom. Van Roon-Mom II further teaches using an antisense against ataxin-3 in SCA3 fibroblasts and in mice at risk for SCA3 (see [0141]-[0145]). Van Roon-Mom II also teaches that a single intra-cerebral ventricular (ICV) injection was administered of 40 ataxin-3 AONs mix and after seven days, the mice were sacrificed and skipping efficiency in the cerebellum was assessed by qRT-PCR (see [0146]). Van Roon-Mom II also teaches viability of the cells in the cerebellum, after administering the AONs, resulting in modified ataxin-3 lacking the polyQ repeat that is toxic when expanded ([0147]-[0148]).
Van Roon-Mom II teaches that a significant reduction in expanded polyQ containing ataxin-3 was shown using IC2 antibody that recognizes long glutamine stretches (FIG. 15a) in the samples with the full and partial exon skip approaches. This indicates a reduction of expanded polyQ-containing ataxin-3 in SCA3 patient derived fibroblasts after AON transfection in isolated cells in culture ([0143]).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the method of using the specific AON set forth as SEQ ID NO: 144, also known as AON 9.1 taught by Van Roon-Mom/Evers, to treat an animal at risk of developing SCA3, administering a therapeutically effective amount of AONs to reduce the polyQ repeats in ataxin-3, and adding a step to verify the effectiveness and reduction of the number of toxic ataxin-3 protein level and/or volume of aggregates in the cerebellum of the animal. One with ordinary skills in the art could have combined the method taught by Van Roon-Mom/Evers with using qRT-PCR, and a staining step using specific antibody (IC2) on cerebellum samples, as taught by Van Roon-Mom II. One with ordinary skills in the art, motivated in verifying the efficacy of the method and optimizing quantities of AONs could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Response to Arguments
Regarding the rejection under 35 U.S.C. § 103, Applicant's arguments filed 07/24/2026 have been fully considered but they are not persuasive.
In response to Applicant’s arguments, on page 7 and 8 of Remarks filed
07/24/2026, the amendments to claim 56 do not overcome the obviousness rejection. The chemical modifications claimed are considered routine in prior art.
Evers itself states that “As treatment for neurodegenerative disorders AONs with a phosphorothioate backbone are very promising and are currently tested in phase I and phase I/II clinical trials for amyotrophic lateral sclerosis” (see page 54, right column, second paragraph).
Another example in prior art is Uzcategui (WO 2013/138353 A1, cited on IDS filed 06/07/2024 as WO#13), which also teaches oligonucleotides targeting ATXN3 beneficial for the treatment of disorders such as spinocerebellar ataxia 3 (see title and abstract). Uztecategui teaches chemical modifications for their oligonucleotides comprising backbone modifications with phosphorothioate and methyl cytosine (see pages 103-104, claims 137-140) and 2’-O-methoxyethyl (see page 10, lines 24-25; page 40, lines 13-20; page 64, lines 18-20). Uztecategui teaches that having at least one 2’-O-methoxyethyl modification are believed to be particularly useful for oral administration (page 64, lines 18-20).
In KSR Int 'l v. Teleflex, the Supreme Court, indicated that “The principles
underlying [earlier] cases are instructive when the question is whether a patent claiming the combination of elements of prior art is obvious. When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable variation, § 103 likely bars its patentability.” KSR Int'l v. Teleflex lnc., 127 S. Ct. 1727, 1740 (2007).
In response to Applicant’s arguments on pages 8-11 (“A person of ordinary skill in the art considering Van Roon-Mom 1 (VRM1) and Evers would not have arrived at the oligomeric compound recited in the claims”) and that there is no reasonable expectation of success (page 12), and In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Given that the modifications to oligonucleotides have been tested and practiced on other oligonucleotides targeting the same gene in prior art, e.g., Uztecategui, it is reasonable to expect success in obtaining, modifying and using an oligonucleotide taught by VRM1 and Evers.
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Regarding Applicant’s arguments stating on page 13 that “2’-MOE modified
oligonucleotides show superior in vivo potency and tolerability”, Examiner would like to remind that the claim 56 is drawn to “An oligomeric compound comprising a modified oligonucleotide”, which is rendered obvious by the combination of references. In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., in vivo potency and tolerability) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The method of using and administering to an animal having or at risk for developing SCA3 is taught by Evers. The superiority of one modification over another is not claimed. It would also amount to an intended use and end-result to the method of using such oligonucleotides.
Conclusion
No Claim is allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636
