DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from International Application PCT/US2016/053416 filed 09/23/2016 and Provisional Applications Nos. 62/315,521 filed 03/30/2016, 62/307,279 filed 03/11/2016 and 62/232,956 filed 09/25/2015 is hereby acknowledged.
Election/Restrictions
Applicant’s election of Species Group A1 (claims 56-73 drawn to an oligomeric compound that has 15,16,17 or 18 contiguous nucleobases of SEQ ID NO: 6) in the reply filed on 10/23/2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 74-84 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/23/2025.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Application Status
This Application is a CON of Patent Application Nos. 16/695,551 filed 11/26/2019 and 15/761,964 filed 03/21/2018.
Preliminary amendments to claims are hereby acknowledged. Claims 1-55 are cancelled. Claims 56-84 are newly added and are pending. Claims 74-84 are withdrawn from consideration. Therefore, claims 56-73 are under consideration in this Office Action.
Information Disclosure Statement
The information disclosure statements (IDSs) submitted on 10/10/2022, 06/07/2024, 06/27/2024 and 08/06/2024 are hereby acknowledged. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Drawings
The drawings are objected to for the following reasons:
37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."”
In the current case, the view numbers for Figures 1-15 are preceded by the word "Figure" instead of the abbreviation "FIG.".
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The use of the terms “Lipofectamine” (p.37 and p.43), “Glutamax” (p.43), “ReliaPrep”, “PureLink”, “Faststart Taq”, “Transblot Turbo”, “IRDye” (p.44), “Odyssey” (p.44-45), “Leica”, “Everbrite” (p.46-47), “Triton-X100” , “Alexa Fluor” (p.46), “ Superfrost”, QuickChange” (p.47), which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 57 is rejected under 35 U.S.C. §112(b) or 35 U.S.C. §112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. §112, the applicant), regards as the invention.
Claim 57 recites the limitation " The oligomeric compound of claim 56, consisting of the modified oligonucleotide" . There is insufficient antecedent basis for this limitation in the claim. It is unclear which oligonucleotide the claim is referring to, since the claim is depending upon claim 56, which is drawn to a genus encompassing species of oligonucleotides consisting of 15, 16, 17…to 25 linked nucleosides, which can also be fragments of SEQ ID NO: 6 having only 15 contiguous nucleobases. The species can comprise 15, 16, 17 or 18 contiguous nucleobases of SEQ ID NO: 6, but can also be as long as 25 linked nucleobases, therefore comprising nucleobases not present in SEQ ID NO: 6. The Species also comprise oligonucleotides modified at least on one residues, which residues can be anyone from position 1 to position 15, 16, 17, 18 or 25, with combinations of modifications on multiple residues giving rise to an even larger number of species.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 57 is rejected under 35 U.S.C. §112(d) or pre-AIA 35 U.S.C. §112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 57 depends on claim 56, however, there is no additional limitation claimed compared to claim 56.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or non-obviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 56-71 are rejected under 35 U.S.C. §103 as being unpatentable over Van Roon-Mom (Van Roon-Mom, W.M.C. et al. US Patent No. 9,611,471 B2, published April 4, 2017, benefitting from priority of US 2013/0198877 A1, published August 1, 2013 and US Application No. 12/814,203 filed August 4, 2011) in view of Evers (Evers, M.M. et al. “Ataxin-3 protein modification as a treatment strategy for spinocerebellar ataxia type 3: Removal of the CAG containing exon”. Neurobiology of Disease, Vol. 58 (2013), pp: 49-56; cited on IDS filed 06/07/2024 as NPL# 11).
Regarding claim 56, it recites “An oligomeric compound comprising a
modified oligonucleotide consisting of 15-25 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising 15, 16, 17, or 18 contiguous nucleobases of SEQ ID NO: 6, wherein at least one nucleoside of the modified oligonucleotide comprises a 2' -O-methoxyethyl group”.
A search for sequence set forth in SEQ ID NO: 6 retrieved the following results (Qy, query = SEQ ID NO: 6; Db, Database = SEQ ID NO: 143 of US Patent No. 9,611,471, i.e. Van Roon-Mom):
US-13-814-203-143/c
(NOTE: this sequence has 2 duplicates in the database searched.
See complete list at the end of this report)
Sequence 143, US/13814203
Patent No. 9611471
GENERAL INFORMATION
APPLICANT: Academisch Ziekenhuis Leiden h.o.d.n. LUMC
APPLICANT: van Roon-Mom, Wilhelmina M.C.
APPLICANT: Evers, Melvin M.
APPLICANT: Pepers, Barry A.
APPLICANT: Aartsma-Rus, Annemieke
APPLICANT: van Ommen, Garrit-Jan B.
TITLE OF INVENTION: Antisense oligonucleotide directed removal of proteolytic
TITLE OF INVENTION: cleavage sites from proteins
FILE REFERENCE: P91958PC00
CURRENT APPLICATION NUMBER: US/13/814,203
CURRENT FILING DATE: 2013-02-04
PRIOR APPLICATION NUMBER: PCT/NL2011/050549
PRIOR FILING DATE: 2011-08-04
PRIOR APPLICATION NUMBER: EP 10172076.1
PRIOR FILING DATE: 2010-08-05
PRIOR APPLICATION NUMBER: US 61/370,855
PRIOR FILING DATE: 2010-08-05
NUMBER OF SEQ ID NOS: 234
SEQ ID NO 143
LENGTH: 22
TYPE: DNA
ORGANISM: Artificial
FEATURE:
OTHER INFORMATION: target hATXN3Ex9_1
Query Match 100.0%; Score 22; Length 22;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGATATGTTTCTGGAACTACC 22
||||||||||||||||||||||
Db 22 GAGATATGTTTCTGGAACTACC 1
Therefore, US Patent No. 9,611,471 teaches a nucleotide sequence set forth in SEQ ID NO: 6, since it teaches the RNA version and complementary sequence of SEQ ID NO: 143.
US-13-814-203-144
(NOTE: this sequence has 3 duplicates in the database searched.
See complete list at the end of this report)
Sequence 144, US/13814203
Patent No. 9611471
Query Match 100.0%; Score 22; Length 22;
Best Local Similarity 68.2%;
Matches 15; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGATATGTTTCTGGAACTACC 22
||||:|:|:::|:|||||:|||
Db 1 GAGAUAUGUUUCUGGAACUACC 22
SEQ ID NO: 144, complementary to SEQ ID NO: 143 is 100% identical to SEQ ID NO: 6, cited in Table 3 in columns 21-22.
Therefore, Van Roon-Mom teaches oligonucleotides that can be 22 nucleobases in length.
Regarding the limitation “wherein at least one nucleoside of the modified oligonucleotide comprises a 2’-O-methoxyethyl group”, Van Roon-Mom teaches antisense oligonucleotide that are uniformly 2’-O-methoxyenyltribose modified with phosphorothioate internucleoside linkages (see claim 2, columns 97-98 and claim 4, columns 99-100).
Regarding claim 57, Van Roon-Mom teaches a method using the antisense oligonucleotides listed in Table 3, as the component of the composition (see claim 3, columns 97-98).
Regarding claim 58, Van Roon-Mom teaches a method of using an antisense oligonucleotide that binds to the pre-mRNA to form a double-stranded nucleic acid complex (see claim 1, columns 97-98). Therefore, if in complex the antisense is forming a double stranded nucleic acid with the pre-mRNA, the antisense taught by Van Roon-Mom is a single-stranded oligonucleotide.
Regarding claims 59, 60, 61 and 62, Van Roon-Mom teaches that the antisense oligonucleotide is uniformly modified with phosphorothioate internucleotide linkages (see claims 2 and 4, columns 97-100, and column 13, “Examples” section, lines 67-67).
Regarding claims 63-66, Van Roon-Mom teaches modified nucleobases using in some embodiments nucleotide analogues, so the one or more sugar moieties are mono- or disubstituted at the 2’, 3’ and/or 5’ position, with –OH, --F, alkyl, alkenyl, alkynyl, alkaryl, allyl, aryl, or aralkyl groups that may be interrupted by one or more heteroatoms, -methoxy, -aminopropoxy, -aminoxy, methoxyethoxy etc.. (see columns 7 (line 60) to 8 (line 10). Therefore, methyl radical, the simplest alkyl radical is included in the embodiments. Van Roon-Mom also teaches that the antisense oligonucleotide is a 2’-O-methoxyethylribose modified phosphorothioate oligonucleotide (see claims 2 and 4, columns 98 and 99).
Regarding claim 67, Van Roon-Mom teaches the use of Nanotechnology to deliver oligonucleotides to the brain, e.g. nanogel consisting of cross-linked PEG and polyethyleneimine, as well as encapsulation in liposomes (see column 9, lines 12-16).
Regarding claims 68 and 69, Van Roon-Mom teaches a method of modulating splicing of a pre-mRNA in a cell comprising contacting the cell with an oligomeric compound comprising an antisense oligonucleotide modified with a 2’-)-methoxyethyl group (see column 14, lines 55-67 and column 15, line 1-7).
However, the specific oligonucleotide in the preferred embodiment, is an antisense oligonucleotide against Huntingtin pre-mRNA (see claims 1 and 2, columns 97-98).
Even though Van Roon-Mom teaches the potential use of antisense oligonucleotide set forth in SEQ ID NO: 144 for Spinocerebellar Ataxia type 3 (SCA3) (see Table 3, columns 21-22), Van Roon-Mom fails to teach modifying the specific antisense oligonucleotide taught in SEQ ID NO: 144 and using it to modulate splicing of Ataxin-3 pre-mRNA, and a specific pharmaceutically acceptable carrier.
However, Evers teaches the oligonucleotide set forth as SEQ ID NO: 144 in Van Roon-Mom, in the form of AON 9.1 in Table 1, on page 50 (right column).
Evers teaches using 2’-O-methyl modified antisense oligonucleotides (AONs) with a phosphorothioate backbone to induce an in-frame exon skip in the ataxin-3 pre-mRNA. Van Roon-Mom teaches the result as a modified ataxin-3 protein lacking the polyQ repeat, while total ataxin-3 protein levels were unaltered and its functional domains remained intact (see page 50, left column, last paragraph of “Introduction” section).
Evers teaches using liposomes, under the form of LipofectamineTM to contact the cells with the AONs (see page 50, left column, “Cell culture and transfection” subsection, second paragraph).
Evers also teaches injections of AONs carried in sterile saline, i.e. a pharmaceutically acceptable carrier, to C57bl/6j mice (see page 51, right column, “AON injection into mice” subsection).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date, to have modified the AON taught by Van Roon-Mom as SEQ ID NO: 144, further modified it to add a 2’-O-methoxyethyl group and a 5-methylcytosine, as taught by Van Roon-Mom and used the modified AON as taught by Evers for modulating splicing in Ataxin-3 pre-mRNA. One with ordinary skills in the art motivated in using an AON with a sequence proven to be effective in exon skipping in Ataxin-3 for developing a treatment for SCA3, could have performed this modification with a reasonable expectation of success.
Regarding claim 70, Evers teaches contacting the AON with cells in vitro (see page 50, left column, “Cell culture and transfection” subsection, second paragraph).
Regarding claim 71, Evers teaches contacting the AON with cells in an animal ((see page 51, right column, “AON injection into mice” subsection).
Claims 72 and 73 are rejected under 35 U.S.C. §103 as being unpatentable over Van Roon-Mom (Van Roon-Mom, W.M.C. et al. US Patent No. 9,611,471 B2, published April 4, 2017, benefitting from priority of US 2013/0198877 A1, published August 1, 2013 and US Application No. 12/814,203 filed August 4, 2011) in view of Evers (Evers, M.M. et al. “Ataxin-3 protein modification as a treatment strategy for spinocerebellar ataxia type 3: Removal of the CAG containing exon”. Neurobiology of Disease, Vol. 58 (2013), pp: 49-56; cited on IDS filed 06/07/2024 as NPL# 11), as applied to claim 56 above, and in further view of Van Roon-Mom II (Van Roon-Mom, W.M.C. et al. US2014/0039037 A1, published February 6, 2014; cited on IDS filed 06/07/2024).
The rejection of claim 56 is described above; the combination of Van Roon-Mom and Evers renders elements of claim 56 obvious.
However, the combination of references does not specifically teach elements of claim 72 and 73, i.e. “wherein the administering reduces the number and/or the volume of aggregates in brain tissue” (claim 72) and “wherein the brain tissue is selected from the group consisting of brainstem, cerebellum, and cortex”.
However, Van Roon-Mom II teaches these limitations.
Regarding claims 72 and 73, Van Roon-Mom II teaches all the elements taught by Van Roon-Mom. Van Roon-Mom II further teaches using an antisense against ataxin-3 in SCA3 fibroblasts and in mice at risk for SCA3 (see [0141]-[0145]). Van Roon-Mom II also teaches that a single intra-cerebral ventricular (ICV) injection was administered of 40 ataxin-3 AONs mix and after seven days, the mice were sacrificed and skipping efficiency in the cerebellum was assessed by qRT-PCR (see [0146]). Van Roon-Mom II also teaches viability of the cells in the cerebellum, after administering the AONs, resulting in modified ataxin-3 lacking the polyQ repeat that is toxic when expanded ([0147]-[0148]).
Van Roon-Mom II teaches that a significant reduction in expanded polyQ containing ataxin-3 was shown using IC2 antibody that recognizes long glutamine stretches (FIG. 15a) in the samples with the full and partial exon skip approaches. This indicates a reduction of expanded polyQ-containing ataxin-3 in SCA3 patient derived fibroblasts after AON transfection in isolated cells in culture ([0143]).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention to have modified the method of using the specific AON set forth as SEQ ID NO: 144, also known as AON 9.1 taught by Van Roon-Mom/Evers, to treat an animal at risk of developing SCA3, administering a therapeutically effective amount of AONs to reduce the polyQ repeats in ataxin-3, and adding a step to verify the effectiveness and reduction of the number of toxic ataxin-3 protein level and/or volume of aggregates in the cerebellum of the animal. One with ordinary skills in the art could have combined the method taught by Van Roon-Mom/Evers with using qRT-PCR, and a staining step using specific antibody (IC2) on cerebellum samples, as taught by Van Roon-Mom II. One with ordinary skills in the art, motivated in verifying the efficacy of the method and optimizing quantities of AONs could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Conclusion
No Claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636