Prosecution Insights
Last updated: October 04, 2026
Application No. 17/701,325

COMPOSITIONS AND METHODS FOR MODULATING APOLIPOPROTEIN B (APOB) GENE EXPRESSION

Final Rejection §102§103§112
Filed
Mar 22, 2022
Priority
Sep 23, 2019 — provisional 62/904,325 +1 more
Examiner
HASAN, KHALEDA B
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Sepia Therapeutics Inc.
OA Round
2 (Final)
59%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
79 granted / 133 resolved
-0.6% vs TC avg
Strong +50% interview lift
Without
With
+49.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
20 currently pending
Career history
158
Total Applications
across all art units

Statute-Specific Performance

§101
6.1%
-33.9% vs TC avg
§103
33.5%
-6.5% vs TC avg
§102
14.7%
-25.3% vs TC avg
§112
25.8%
-14.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 133 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received 4/27/2026. Applicant’s amendment filed 4/27/2026 has been entered. Claims 2-4, 6-12, 14-16, 18-23, 25-40, 42, 44-48, 51-100, 102-104, and 107-110 are cancelled. Claims 1, 5, 13, 17, 24, 41, 43, 49-50, 101, and 105-106 are currently pending. Claims 49-50, 101, and 105-106 are withdrawn from prosecution as being drawn to non-elected subject matter. The restriction requirement mailed 7/7/2025 is still deemed proper. Applicant's elected Group I (claims 1, 5, 13, 17, 24, 41, and 43) with traverse in the reply filed 9/5/2025. Accordingly, claims 1, 5, 13, 17, 24, 41, and 43 are examined herein. Objection to the specification is withdrawn in view of Applicant’s amendment to remove an embedded hyperlink. Rejection of claim 17 under 35 U.S.C. 112(b) as being indefinite is withdrawn in view of Applicant’s amendment to remove the limitation “Table 2”. Rejection of claim 43 under 35 U.S.C. 101 as being drawn to a human organism is withdrawn in view of Applicant’s amendment of “A cell” to “An isolated cell”. Rejection of claims 1, 5, 13, 24, 41, and 43 under 35 U.S.C. 102 as being anticipated by McLaughlin (2014; of record) is withdrawn in view of Applicant’s amendment of independent claim 1 to incorporate the limitation “a DNA-binding domain, or fragment thereof, of a zinc finger polypeptide (ZNF) or a transcription activator-like effector (TALE) polypeptide that specifically binds to the APOB expression control region” from claim 17 and “an enzymatically inactive Cas polypeptide and a gRNA” from cancelled (previously withdrawn and unexamined) claim 31. Rejection of claim 17 under 35 U.S.C. 103 as being unpatentable over McLaughlin (2014; of record), in view of Zhang (2019; of record) is withdrawn in view of Applicant’s amendment to add the limitation “SEQ ID NOs: 88-93”. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 5 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 5 lists limitations (a) through (e) with “and/or” such that the limitations can be required in the alternative. Claim 5 reciting “(a) wherein the site-specific APOB targeting moiety comprises a polynucleotide or a peptide nucleic acid (PNA)” fails to further limit part (b) of claim 1, wherein the site-specific APOB targeting moiety comprises “an enzymatically inactive Cas polypeptide and a gRNA” because the gRNA is a polynucleotide. Claim 5 reciting “(e) wherein the disrupting agent comprises a modification” fails to further limit part (b) of claim 1 because an enzymatically inactive Cas polypeptide is a Cas polypeptide comprising a modification. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 103 – new necessitated by amendment In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 5, 13, 24, 41, and 43 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (WO2014204726A1; published 12/24/2014; Cite No. BH in IDS filed 6/27/2022). This is a new rejection necessitated by Applicant’s amendment to claim 1 adding the limitations “a DNA-binding domain, or fragment thereof, of a zinc finger polypeptide (ZNF) or a transcription activator-like effector (TALE) polypeptide that specifically binds to the APOB expression control region” from currently amended claim 17 and “an enzymatically inactive Cas polypeptide and a gRNA” from cancelled (previously withdrawn and unexamined) claim 31. Zhang’s disclosure is directed to delivery, engineering and optimization of systems, methods, and compositions for manipulation of sequences and/or activities of target sequences for hepatic gene therapy (entire document; abstract). Regarding claim 1, Zhang teaches a site-specific APOB disrupting agent comprising a Cas polypeptide and a gRNA (paras 0011, claims 1-3, Examples 38-39; entire document). Zhang teaches that the CRISPR-Cas9 system targeting ApoB was effective at inducing a phenotypic change in vivo (Example 38, paras 00222-00229). Zhang further teaches ZFN and TALE polypeptides (para 0005; Example 30). Zhang teaches that the targets gene or sequence comprising regulatory sequences such as promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions (para 00529, 00549, and 00620). Zhang further teaches using dCas9 to repress gene expression (Example 17, para 00795). However, Zhang does not specifically teach targeting an APOB expression control region with the enzymatically inactive Cas polypeptide and a gRNA or with ZFN or TALE polypeptides. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined Zhang’s teachings targeting ApoB with a CRISPR-Cas system (Example 38) with other teachings using enzymatically inactive Cas proteins and fusion proteins (Example 17) or with ZFN or TALE polypeptides (Example 30) because it would have amounted to a simple combination of prior art elements according to known methods to yield predictable results. Zhang teaches CRISPR-Cas systems and other programmable gene editing nucleases of ZFNs and TALEs as described above and teaches targeting ApoB for hepatic gene therapy. One would have had a reasonable expectation of success because Zhang teaches making improved compositions for gene editing for hepatic gene therapy in subjects in need thereof. Thus, the claimed invention as a whole is prima facie obvious. Regarding claim 5, Zhang teaches ABOP disrupting agents comprising polynucleotide (part a) and the dCas9 comprising the modification of catalytically inactive domains and further fusion proteins (part e) (Examples 17 and 30). Regarding claim 13, Zhang teaches that the targets gene or sequence comprising regulatory sequences such as promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions (paras 00529, 00549, and 00620). Regarding claim 24, Zhang teaches APOB disrupting agents present in a composition comprising a pharmaceutical carrier (paras 00309, 00347, 00375, and 00387-0388). Regarding claim 41, Zhang teaches AAV2/8 liver targeting viral vectors encoding Cas and sgRNA (Example 38; para 00347). Regarding claim 43, Zhang teaches isolated cells comprising the site-specific APOB disrupting Cas and sgRNA agents (Example 40; paras 0029 and 0084). Claim 17 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (WO2014204726A1; published 12/24/2014; Cite No. BH in IDS filed 6/27/2022), as applied to claims 1, 5, 13, 24, 41, and 43 above, and further in view of Zhang et al. “referred to as Zhang 2016” (US20160175462A1; published 6/23/2106; see attached PTO-892). The teachings of Zhang are discussed above and are applied to claim 17 as they are applied to claims 1, 5, 13, 24, 41, and 43 above. However, Zhang does not specifically teach SEQ ID NO: 88 of claim 17. Zhang 2016‘s disclosure is directed to delivery, engineering and optimization of systems, methods, and compositions for manipulation of sequences and/or activities of target sequences and methods of directing CRISPR complex formation in eukaryotic cells to ensure enhanced specificity for target recognition and avoidance of toxicity and to edit or modify a target site in a genomic locus of interest to alter or improve the status of a disease or a condition (entire document). Regarding claim 17, Zhang 2016 teaches SEQ ID NO: 482 having 86.8% sequence identity to instant SEQ ID NO: 88, SEQ ID NO: 492 having 85.8% sequence identity to instant SEQ ID NO: 90, and SEQ ID NO: 499 having 85.2% sequence identity to instant SEQ ID NO: 92 representing a site-specific APOB targeting moieties (see sequence alignments below). Query Match 86.8%; Score 86.8; Length 125; Best Local Similarity 92.9% (Qy: Zhang SEQ ID NO: 88) Qy 3 TGGGGCAGCATCTCCATCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG 62 ||| | || || || ||||||||||||||||||||||||||||||||||||||||||| Db 101 TGGAACCACACCTTCACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG 42 Qy 63 TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT 100 |||||||||||||||||||||||||||||||||||||| Db 41 TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT 4 (Db: Zhang 2016 - SEQ ID NO: 482) Query Match 85.8%; Score 85.8; Length 125; Best Local Similarity 92.8% (Qy: Zhang SEQ ID NO: 90) Qy 4 GCAGCATCTCCATCTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT 63 | |||| | || ||||||||||||||||||||||||||||||||||||||||||||| Db 100 GAAGCAGGCCAATGGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT 41 Qy 64 TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT 100 ||||||||||||||||||||||||||||||||||||| Db 40 TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT 4 (Db: Zhang 2016 - SEQ ID NO: 492) Query Match 85.2% Score 85.2; Length 125; Best Local Similarity 91.8% (Qy: Zhang SEQ ID NO: 92) Qy 3 TGCCATATGGCCACCAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG 62 || | || || || | |||||||||||||||||||||||||||||||||||||||||| Db 101 TGTACTTTGTCCTCCGGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG 42 Qy 63 TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT 100 |||||||||||||||||||||||||||||||||||||| Db 41 TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT 4 (Db: Zhang 2016 - SEQ ID NO: 499) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified Zhang’s ApoB disrupting agent with the sequences taught in Zhang 2016 (see alignments above) because it would have amounted to a simple substitution of known guide RNAs targeting APOB to obtain predictable results of making the claimed gene disrupting agent. One would have had a reasonable expectation of success because Zhang and Zhang 2016 improving gene editing compositions and methods of using the compositions for therapeutics. Thus, the claimed invention as a whole is prima facie obvious. Response to Arguments Applicant’s arguments with respect to claims 1, 5, 13, 24, 41, and 43 under 35 U.S.C. 102 and claim 17 under U.S.C 103 have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument. Allowable Subject Matter SEQ ID NOs: 89, 91, and 93 (listed in claim 17) encode site-specific APOB targeting moieties having a particular set of nucleotide modifications, including 2’-O-Me and phosphorothioate linkages that appear to be free of the prior art. Conclusion No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KHALEDA B HASAN whose telephone number is (571)272-0239. The examiner can normally be reached IFP, Monday - Friday 7:30am-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KHALEDA B HASAN/Examiner, Art Unit 1636 /BRIAN WHITEMAN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Mar 22, 2022
Application Filed
Jan 27, 2026
Non-Final Rejection mailed — §102, §103, §112
Apr 27, 2026
Response Filed
Aug 26, 2026
Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747441
RIBOSWITCH MODULATED GENE THERAPY FOR RETINAL DISEASES
3y 2m to grant Granted Sep 29, 2026
Patent 12742172
ENGINEERED DNA MOLECULE FOR CODING RNA
1y 6m to grant Granted Sep 22, 2026
Patent 12697400
GENE EDITING METHODS FOR TREATING ALPHA-1 ANTITRYPSIN (AAT) DEFICIENCY
2y 3m to grant Granted Aug 04, 2026
Patent 12692494
SERPIN FAMILY F MEMBER 2 (SERPINF2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
4y 5m to grant Granted Jul 28, 2026
Patent 12686876
Compositions and Methods Comprising a TTR Guide RNA and a Polynucleotide Encoding an RNA-Guided DNA Binding Agent
2y 11m to grant Granted Jul 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+49.5%)
3y 5m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 133 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month