DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 10/30/2025 has been entered.
Status of Claims
Claims 87, 158, 190-192, 194-203 and new claim 204 are pending and examined here.
In the prior action the following was noted: The elected species of SEQ ID NO: 5, i.e. the limitation of “perfect complementarity to at least 11 contiguous nucleotides of the SYNGR-3 nucleic acid sequence of SEQ ID NO: 5,” was searched and found to be free of the prior art, and the examiner has selected further species for search and examination in accordance with MPEP 803.02(C)(2). Following search of the amended claims of SEQ ID NO: 50, a new art was found that read on perfect complementarity of at least 11 contiguous nucleotides of SEQ ID NO: 5, thus the limitation noted is not allowable.
Priority
Domestic benefit of Provisional App. 63/167, 204, filed on 03/29/2021, is acknowledged. All the examined claims enjoy the benefit of ‘204 filing date.
Claim Rejections - 35 USC § 112
35 U.S.C. 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 87, 158, 190, 191, 192, 194-204 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed invention encompasses an antisense strand comprising a sequence sufficient complementary to 16 to 25 nucleotide in length of SEQ ID NO: 2, 9, or 12 and the sequence is complementary to at least 10 contiguous nt. to SEQ ID NO: 50, 57 or 60; or an antisense strand comprising a sequence sufficient complementary to 16 to 25 nucleotide in length of SEQ ID NO: 5 and the sequence is perfectly complementary to at least 11 contiguous nt. of SEQ ID NO: 53. SEQ ID NOs 50, 57 and 60, which represent the target sequences of the SYNGR-3 transcript, are 20 nt. in length and therefore for those sequences only 50% of complementarity is required. For SEQ ID NO: 53, only 55% of complementarity is required. However, claims 87 and its dependents and claim 204 do not limit the length of the antisense strands, and when in read in light of the specification, the RNA can be up to 80 nt. in length (par. 6). Thus if the antisense is longer than 20 nt. then percentage of complementarity decreases. For cl. 158 and its dependents, the length of the antisense strand can be up to 26 nucleotides, if 26 is interpreted as a maximum limit, the percentage of complementary is less than 50%.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. In the instant case, only siRNA species whose complete structure that is disclosed is of antisense strands with perfect complementarity of 100% (not considering the uracil overhang(s) at the end(s) of the antisense strand of Table 10, or either 90% or 95% complementarity if overhangs are considered). The genus encompasses a large number of variants and molecules that claim to have the same activity as the fully complementary antisense strand of 21 nt. in length, and the genus encompasses a large number of variants and molecules that have a different structure. The specification does not describe the complete structure of a representative number of species of the large genus of antisense strands that that have approximate 50% complementarity and still enable functional silencing of the target gene SYNGR-3.
Further, only a single species of di-branched siRNAs was tested (see Ex. 2) and both siRNAs are fully complementary, none of the siRNAs of Fig. 1-4 are of the claimed “branched RNA compound comprising 2 or more dsRNAs” or “branched compound of Formula (I)”.
Next, then, it is determined whether a representative number of species have been sufficiently described by other relevant identifying characteristics (i.e. other than nucleotide sequence), specific features and functional attributes that would distinguish different members of the claimed genus. In the instant case, the only other identifying characteristic is their ability to bind to target transcript to enable silencing of the target gene. Here, the data shows that even with perfect complementarity, see SYNGR1894 in Fig. 1A, that results in no silencing. Thus, such a functional limitation cannot be an identifying characteristic for the claimed diverse genus of molecules since by Applicant’s definition of to direct silencing of target transcript or functional equivalent thereof all members of the claimed genus will have that characteristic.
The inventions of Claims 87, 158 and 204 and their dependent claims require the use of the inventions and therefore are likewise rejected under 35 U.S.C. 112, first paragraph, as failing to comply with the written description requirement.
Applicant’s attention is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP2163).
In conclusion, Applicant’s disclosure of species of antisense strand of 20 nt. that are 100% complementary to target transcript of the claimed broad genus is not deemed sufficient to reasonably convey to one skilled in the art that Applicant was in possession of the claimed broad genus at the time the application was filed. Thus, it is concluded that the written description requirement is not satisfied for the claimed genus.
35 U.S.C. 112(b)
Rejection of claims 87, 158, 189-192 and 194-203 due to recitation of “sufficiently complementary has been withdrawn due to the claim amendment.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 87, 158, 204 and dependent claims 190-192, 194-203 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 87, 158, 204 combine conjunctive and disjunctive terms in a listing of SEQ ID NOs (“SEQ ID NOs: 2, 9, and 12 or SEQ ID NO: 5”, lines 6-7 of cl. 87 and in lines 12-13 of cl. 158) and later recite “SEQ ID NOs: 50, 57, or 60, respectively” but the earlier recitation of SEQ ID NOs have 4 SEQ ID NOs. There is not a direct one-to-one mapping of two sets of items, the purpose of reciting “respectively.” The claims are unclear. Same rationale for indefiniteness applies to cl. 204: “SEQ ID NOs: 1, 3, 4, 6, 8, 10 and 11, or SEQ ID NO: 7,” lines 5-6 with later recitation of a listing of 7 SEQ ID NOs.
In the interest of compact prosecution, the limitation of the claims (lines 5-11 of cl. 87 and lines 11-16 of cl. 158) is interpreted in the following manner:
the antisense strand comprises a sequence sufficiently complementary to 16 to 25 nucleotides of a synaptogyrin-3 (SYNGR-3) nucleic acid sequence of SEQ ID NOs: 2 9 and 12, to direct target-specific silencing of a SYNGR-3 gene, wherein the sequence comprises complementarity to at least 10 contiguous nucleotides of any one of the SYNGR-3 nucleic acid sequence of SEQ ID NOs: 50, 57, or 60, respectively, or the antisense strand comprises a sequence sufficiently complementary to 16 to 25 nucleotides of a synaptogyrin-3 (SYNGR-3) nucleic acid sequence of SEQ ID NO: 5, wherein the sequence comprises a perfect complementarity to at least 11 contiguous nucleotides of the SYNGR-3 nucleic acid sequence of SEQ ID NO: 53.
Claim 204 is interpreted in the same manner.
Claim Interpretation
Claims 87, 158, and 167 have been amended to recite “the sequence comprises complementarity to at least 10 contiguous nucleotides of the SYNGR-3 nucleic acid sequence of SEQ ID NOs: 1-12”. The term “complementarity” in this phrase is given its broadest reasonable interpretation in view of the specification. As such, the claims are not considered to require perfect complementarity “to at least 10 contiguous nucleotides of the SYNGR-3 nucleic acid sequence of SEO ID NOs: 1-12”. The specification as filed frequently uses the terms “complementary” and “complementarity” in the context of a “sequence” or “strand”. These terms are often accompanied by modifiers such as “substantially”, “fully”, “generally, and “near perfect”. Accordingly, the term “complementarity”, in the context of a “sequence” is interpreted broadly to embrace any of these embodiments and to not require complementarity of each nucleotide within the recited “sequence”.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 87, 158, 190, 191, 192, 194-204 are rejected under 35 U.S.C. 103 as being unpatentable over Hamamoto et al. (WO2012144220, pub. 10/26/2012) and Khvorova et al. (US Pat. 10478503, referred as Khvorova ‘503, of record) and Foster et al. (2017, Molecular Therapy, 26, pg. 708-717, referred as Foster).
Instant SEQ ID NO: 53 is gugaacauguuuacaauuuu (of claims 87 and 158).
Instant SEQ ID NO: 60 is ugaacauguuuacaauuuuu; there is a 19 nt. overlap with SEQ ID NO: 53, and both read on SEQ ID NOs: 5, 12 (of claims 87 and 158).
Instant SEQ ID NO: 59 is agugaacauguuuacaauuu and shares a sequence (gray highlighted) with SEQ ID NOs: 53 and 60 (of claim 204).
Hamamoto discloses that enhancer of zeste homolog 2 (EZH2) is overexpressed in various types of cancers and is integral to proliferation in cancer cells and thus a good molecular target for cancer therapy (par. 6, 7). Hamamoto discloses a siRNA that targets EZH2 transcripts for its inhibition designated “siEZH2#1,” with a sense strand SEQ ID NO: 11 with the following sequence of 19 nt., cuaaccauguuuacaacua, and its complementary antisense strand SEQ ID NO: 12 with the following sequence of 19 nt., uaguuguaaacaugguuag (Table 2, par. 299; all sequences in the action are from 5’-3’, unless noted otherwise). The sense strand has a contiguous 11 nt. sequence that is identical to instant SEQ ID NOs: 5, 53, 59, 60 (and 2 and 9); and, consequently, the antisense strand has a contiguous 11 nt. sequence that is perfectly complementary to SEQ ID NOs: 5, 53, 59 and 60 (and 2 and 9) and has 14 nt. that are complementary to instant SEQ ID NOs: 53, 59, and 60 (see alignment below with SEQ ID NO: 53, as noted above the sequences share a consensus sequence, relevant to instant cl. 87, 158, 204).
Hamamoto EZH2#1 antisense: 2 AGUUGUAAACAUGGUUA 18
| ::|:|||||:| : |
Instant SEQ ID: 53 18 AATTGTAAACATGTTCA 2
Hamamoto Fig. 4A demonstrates approximately 75% inhibition with siEZH2#1. Hamamoto discloses that the dsRNA can be modified for stability and cell uptake (par. 232), including phosphorothioate linkages and 2’-O-methyl (2OMe) and 2’-deoxy-fluro (2F) ribose modifications (par. 233).
Hamamoto does not teach a branched RNA comprising 2 or more dsRNAs connected by a linker or an ethylene glycol linker, and a sense strand with at least 65% 2OMe nt. modification (cl. 87, 158, 204).
Khvorova ‘503 discloses a branched RNA compound wherein the RNA molecules are connected to one another by one or more linker (“L”) (Col. 1, line 57), and each nucleic acid is double stranded comprising a sense strand and antisense strand, and each strand has a 5’ and a 3’ ends (Col. 2, line 8-10, also see Fig. below). Figure 1 (bottom branched RNA) discloses an asymmetric siRNA, with a sense strand of 15 nt. and antisense strand of 20 nt. (relevant to instant cl. 158). Khvorova ‘503 discloses branched RNA compounds that have full chemical stabilization (also termed “full metabolic stabilization”), i.e. all of the constituent bases are chemically-modified (Col. 16, line 13-15), further, the definition of “metabolically stabilized” includes RNA molecules that have been chemically modified from 2’-hydroxyl to 2’-OMe (2OMe; Col. 33, line 36-39), thus contemplates that each modified nt. is 2’-OMe (2OMe), i.e. a 100% modification with 2OMe (see below of Fig. 1, bottom, and Fig. 9, top, a different embodiment with alternating 2OMe and 2F modification pattern; dark circles are 2OMe nt. modification, and gray circles are 2F nt. modification)).
Khvorova composite of Fig. 9 (top) and Fig. 1 (bottom):
PNG
media_image1.png
736
667
media_image1.png
Greyscale
Figs. 1 (bottom) and 9 (top) disclose branched RNA, each comprising two dsRNAs molecules, and here the linker is polyethylene glycol conjugated to sense strands (Col. 12, line 8-16; relevant to instant cl. 87 158, 204), Khvorova ‘503 discloses the advantage of a branched structure is to promote increased uptake and allow each branch to act cooperatively to “dramatically enhance rates of internalization, trafficking, and release” (Col. 16, lines 25-30). Khvorova ‘503 also discloses that branched oligonucleotides exhibit unexpected improvement in distribution, i.e. to a wide range of tissues, including neuronal cells, in addition to liver as was the case with prior siRNAs, and improvement in vivo efficacy and safety (Col. 1, line 40-41, 50-53, 59-60). Ex. 6 discloses that a di-branched siRNA molecule led to significant silencing of a target gene and was efficiently delivered to neurons without the lipid formulation (i.e. a transfection agent) and did not hinder RISC loading (Col. 46, line 49 – Col. 47, line 3, relevant to instant cl. 87, 158, 204).
Khvorova ‘503 and Hamamoto do not disclose sense strand comprising at least 65% 2OMe nt. modification.
Foster demonstrates substantial efficacy improvements by further refining siRNA chemistry by optimizing the positioning of 2OMe and 2F modifications across both strands of dsRNA siRNA duplex to enhance stability without comprising intrinsic RNAi activity (abstract). 2OMe nt. modification is a sterically more demanding modification and has a greater stabilizing effect compared to less bulky modification, such as 2F (pg. 708). With the goal of reducing 2F content (pg. 709), the 2OMe's positioning needs to be applied judiciously without substantially reducing RNAi activity (708). The screen identified two optimal siRNA duplex, labeled as DV18 and DV22, whose sense strand had 17 nt. (~80%) modified with 2OMe and 4 nt. modified with 2F (see Fig. 2C, pg. 711; Fig. 3, pg. 712, Fig. 4, improved results both in vivo mouse and non-human primate, relevant to instant cl. 87, 158). Thus Foster indicates improving the efficacy of a fully modified 2OMe and 2F siRNA by optimizing the content of 2OMe and 2F nt. modifications across both strands of dsRNA.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the siRNA EZH2#1 of Hamamoto in view of Khvorova ‘503 and Foster and arrive at the claimed invention with a reasonable expectation of success. Based on success of reducing the expression of target transcript using EZH2#1 siRNA, and Khvorova demonstrating that a branched RNA with increased cellular uptake and , and Foster demonstrating that increased 2OMe content provides a more stable siRNA thus increasing in vivo efficacy, a skilled artisan would also link multiple siRNAs as a branched RNA molecule of Khvorova ‘503 to increase likelihood of inhibition and for successful entry into a cell and to modify the 2OMe and 2F positions across both the strands as noted by Khvorova ‘503 and Foster, respectively, to balance nuclease resistance and maintaining RNAi activity. Thus, cl. 87, 158, and 204 are obvious.
Regarding instant cl. 190, 191, and 192, Khvorova ‘503 discloses branched siRNAs comprising asymmetric siRNAs, each containing a blunt end and a 5 nt. overhang at the other end, see Fig. 1 above.
Regarding instant cl. 194, Khvorova ‘503 discloses a branched RNA compound wherein sense strand comprised at least one modified nt. that is 2F modified nt. As noted above, Foster discloses the benefit of 2F modification for enhanced stability of the siRNA.
Regarding instant cl. 195-197, Khvorova ‘503 Figs. 1 and 9, see above, disclose a modified internucleotide linkage, comprising phosphorothioate (PS) linkage. Foster discloses that siRNA could be further stabilized with phosphorothioate (PS) modifications at the terminal ends, which provide additional protection against 3’ and 5’ exonucleases (pg. 708).Thus, it would be obvious to introduce PS modifications to the designed siRNAs for improved nuclease resistance, thus claims 195-197 are obvious.
Regarding instant cl. 198, Khvorova ‘503 discloses that RNA silencing agents may be altered to facilitate enhanced efficacy and specificity in mediating RNAi according to asymmetry design, which enhance the “entry of the antisense strand of the siRNA… into RISC in favor of the sense strand, such that the antisense strand preferentially guides cleavage or translationally repression of target mRNA (Col. 37, line 62 to Col. 38, line 7). One way to introduce asymmetry of an RNA silencing agent is by introducing at least one mismatch base pair between the 5’ end of the first or antisense strand and the 3’ end of the sense portion (Col. 38, line 19-23).
Thus it would it obvious for a skilled artisan to introduce a mismatch to improve entry of the antisense strand into the RISC machinery for repression of syngr3 mRNA target sequence.
Regarding instant cl. 199, Khvorova ‘503 discloses antisense strand comprising alternating 2OMe nt. modification and 2F nt. modification (col. 2, line 19-21, relevant to instant cl. 199 (1)). In an embodiment of a compound with the structure of formula (III) provides that position 2 and 14 are nucleotide comprising 2’-deoxy-2’-fluoro modification (see also composite Fig. 1 and 9 above; relevant to instant cl. 199 (2)), and nt. positions 1-2 to 1-7 from the 3’ end of the antisense strand are phosphorothioate internucleotide linkages (relevant to instant cl. 199 (3)), portion of antisense strand is complementary to portion of sense strand (formula III) (i.e. only the internal portions are complementary, while the 5 nt. at 3’ end are an overhang and are ss strand, relevant to instant cl. 199 (4)), and nt. positions 1-2 from 5’ end of sense strand are PS linkage (Col. 5-6, relevant to instant cl. 199 (5)). Khvorova ‘503 also disclose the branched oligonucleotides exhibit unexpected improvement in distribution, i.e. to wide range of tissues, including neuronal cells, and in addition to liver as was the case with prior siRNAs, and improvement in vivo efficacy and safety (Col. 1, line 40-41, 50-53, 59-60).
Regarding cl. 200, 202, Additionally, Khvorova ‘503 discloses L-(N)n as formula I, wherein L is selected from ethylene glycol, a peptide, RNA, DNA, and n is 2, 3, 5, 6, 7, or 8; with N is RNA duplex comprising a sense and antisense strands (Col. 2, lines 50-66; also see composite figure of Khvorova ‘503 with polyethylene glycol linker).
Khvorova ‘503 discloses formula I of L-(N)n optionally further comprises one or more branch point B, wherein B is independently for each occurrence a polyvalent organic species (Col., 2, line 57-60, relevant to instant cl. 200); and disclose that polyvalent organic species include triols or tetrols (Col. 21, line 13-26, relevant to instant cl. 202); and optionally comprises one or more spacer S, wherein S is independently for each occurrence selected from an ethylene glycol, a peptide, RNA, DNA (Col. 2, lines 57-60, relevant to instant cl. 200).
Regarding instant cl. 201 and 203, Khvorova ‘503 discloses that a L has one or more branch point B, which is polyvalent organic species and S is peptide (Col. 28, line 15, 56-57, see also claim 16 with B in a branched structure, relevant to instant cl. 201); discloses that polyvalent organic species include triols or tetrols (Col. 21, line 13-26, relevant to instant cl. 203). Khvorova ‘503 also discloses the branched oligonucleotides exhibit unexpected improvement in distribution, i.e. to wide range of tissues, including neuronal cells, and in addition to liver as was the case with prior siRNAs, and improvement in vivo efficacy and safety (Col. 1, line 40-41, 50-53, 59-60).
Response to Arguments
Applicant’s arguments, see pg. 8-10 and also claim amendments, filed 1/30/2025, with respect to the rejection(s) of claims 87, 158, 167, 189-192, 194-203 under 103 have been fully considered and are persuasive: specifically the requirement of 13 contiguous nt. of complementarity with SEQ ID NO: 55. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of Hamamoto and Khvorova ‘503, Foster et al.
Allowable Subject Matter
No claims are allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600