DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1-7 and 10-19 are pending.
Status of the Application
Applicant’s response and amendment filed 16 December 2025 are acknowledged and entered.
Applicant has amended Claims 1, 3-7, and 10-11. Applicant has added Claims 13-19. Applicant has cancelled claims 8-9.
Response to Amendment
Applicant has amended the Claims to overcome Objections; the objections are withdrawn.
Applicant has amended the Claims to overcome the 112(a) Written Description rejection; the 112(a) Written Description rejection is partially withdrawn and partially maintained.
Applicant has amended the Claims to overcome the 112(a) Enablement rejections; the 112(a) Enablement rejections are withdrawn.
Applicant has amended Claims 1 and 11 and provided a definition and supporting article for “lung function” (see Remarks pp. 9-10 and §Claim interpretation below) to overcome the 112(b) rejections; the 112(b) rejections are withdrawn. Applicant has amended Claims 3-4 to overcome the Markush rejections; those rejections are withdrawn.
Applicant has amended the Claims 1 and 11 to overcome the 102 and 103 rejections; the 102 and 103 rejections are modified in but maintained.
Some of the NSDP rejections are withdrawn in view of the claim amendments and some are maintained.
Election/Restrictions
Applicant previously elected the species SEQ ID NOs 1 and 40-48 in the reply filed on 10 June 2025 is acknowledged. The claims are examined as they pertain to those SEQ ID NOs.
Claims 1-7 and 10-19 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Information Disclosure Statement
The IDS has been considered.
Priority
The claims recite the compound VX-121. A search for “VX-121” and its name “vanzacaftor” in the priority documents Provisional Application No. 62/843469, PCT Application No. PCT/IL2020/050495 (WO 2020/225813), and parent Application No. 17/607908 did not reveal those terms. Therefore the compound VX-121 has the priority date of 31 March 2022. If VX-121 was disclosed in any of those previous documents, Applicant should point to the specific location.
Claim Objections
Claims 1 and 16 are objected to because of the following informalities:
Claim 1: the “a” in and at the beginning of L7 is inadvertently struck-through but should not be.
Claim 16 recites the method of claim 1, comprising a chemical modification but should recite the method of claim 1, wherein the synthetic oligonucleotide comprises a chemical modification…
Appropriate correction is required.
Claim Interpretation
Claim 11 recites “lung function”. Applicant’s Remarks (pp. 9-10) state that “lung function” is an art-recognized term meaning:
Spirometry is the most common pulmonary function test. It is widely used in the assessment of lung function… Spirometry the maximal volume of air that an individual can inspire and expire with maximal effort. The primary signal measured in spirometry is either volume or flow as a function of time.
That indicates that “lung function” is the maximal volume of air that an individual can inspire and expire with maximal effort as measured by spirometry. Applicant has supplied a reference (Graham) supporting that definition.
Therefore the recitation lung function is interpreted in view of that art-recognized definition: the maximal volume of air that an individual can inspire and expire with maximal effort as measured by volume or flow over time.
Claims 18 and 19 recite that the synthetic oligont consists of a nt sequence set forth in SEQ ID NOs 1 or any one of 41-48. Although the claims recite a nt sequence, which by itself would include short sequences including 2-mers, Claims 18-19 depend from Claim 1 which requires the entirety of recited SEQ ID NOs.
35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 10-12, 16, 6-7, and 17-19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. This rejection is partially maintained and updated in response to claim amendments.
Claim 1 recites:
A method for treating Cystic Fibrosis (CF) in a subject having a 3849 +10Kb C-to-T mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, comprising administering to said subject a composition comprising a therapeutically effective amount of a synthetic oligonucleotide consisting of the nucleotide sequence as set forth in any one of SEQ ID NOs: 1-25 or 40-48 and a composition comprising a therapeutically effective amount of a CFTR potentiator and a therapeutically effective amount of a CFTR corrector
Broad Claim 1 encompasses the large subgenera of any CFTR potentiators or CFTR correctors. Any CFTR potentiators/CFTR correctors would be encompassed by the claims as instantly presented.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
Regarding Claims 1 and claims depending therefrom, the Spec. describes (¶11-13, ¶70-76) some species of CFTR potentiators/CFTR correctors. The Spec. defines a potentiator (¶73): the term "potentiator" refers to any agent that increases the probability that a defective CFTR will be open and therefore allows chloride ions to pass through the channel pore. The Spec. defines a corrector (¶74):
the term "corrector" refers to any agent that assists in proper CFTR channel folding so as to enable its trafficking to the cell membrane. [0075] As used herein, the term "amplifier" refers to any agent that induces a cell to increase its CFTR protein production rates or yields, therefore resulting in an increased amount of the CFTR protein.
However, those descriptions are inadequate to support possession of a representative number of species because the Spec. does not provide information describing physical features of a CFTR potentiator/CFTR corrector. The Spec. does not disclose what physical structure responsible for the claimed function.
Applicant’s examples show the additional agents of Trikafta® and Symdeko®. The Spec. indicates (¶76) Trikafta® combines the potentiator ivacaftor and the correctors tezacaftor and elexacaftor, and Symdeko® combines the potentiator ivacaftor and the corrector tezacaftor. However, those examples are not sufficient to provide written description support for any CFTR potentiators/CFTR correctors. Although the claims recite the functional characteristics (i.e., potentiating/correcting), the functional characteristic is not coupled with any known structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of potentiating/correcting. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for potentiating/correcting in such a way to demonstrate possession of the full invention as claimed at time of filing. The potentiator ivacaftor and the correctors tezacaftor and elexacaftor do not share a core structure.
The specification teaches only some species within the claimed genus/genera (¶76) but those are only a paltry number compared with the breadth of what is claimed. .Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims: CFTR potentiators/CFTR correctors.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claim 1 is rejected for failing to demonstrate possession of the claimed invention. Claims 2, 10-12, 16, 6-7, and 17-19 are rejected because they depend from Claim 1 and do not remedy the issues.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-2, 4, 6-7, 10-13, and 16-17 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by US Patent Application Publication No. 2015/0211010, published 30 July 2015, “App010”; App010 was issued on 01 October 2019 as US Patent No. US 10428328. App010 is of record on IDS. This rejection is partially maintained and updated in response to claim amendments.
App010 is drawn to (§Abstract) oligonucleotides [oligos or oligonts] capable of binding to and modulating the splicing of the pre-mRNA of the CFTR gene, compositions including the oligonucleotides…and uses thereof. App010 teaches that (¶4) their invention includes the splicing mutation 3849+10 kb C-to-T which leads to inclusion of an 84 base pair cryptic exon in the mature messenger RNA (mRNA) (denoted “intron 22 cryptic exon inclusion” mutation). That is the same mutation as what is disclosed in the instant claims. The teachings of App010 indicate that it encompasses the instant invention.
Regarding Claim 1: App010 teaches that the invention provides an oligo that binds to a pre-mRNA transcript of CFTR and suppresses the inclusion of a cryptic exon that exists in intron 22:
(¶39) the present invention provides a synthetic polynucleotide molecule, comprising a nucleotide sequence comprising a sequence of at least 20 consecutive nucleotide bases, wherein said synthetic polynucleotide molecule is capable of binding to a pre-mRNA transcript of the CFTR gene, and suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA. The phrase “suppress intron 22 cryptic exon inclusion” as used herein refers to lowering the occurrence of the addition of 84 nucleotides (SEQ ID NO: 5) found within intron 22 of the CFTR gene to the mature CFTR mRNA, leading to degradation of said mRNA by the nonsense mediated mRNA decay (NMD) mechanism, as illustrated in FIG. 6. In certain embodiments, said nucleotide sequence is complementary to the nucleotide sequence set forth in SEQ ID NO: 3, or to a fragment thereof.
That description encompasses the instant compounds because that ¶ teaches that App010 encompasses 20-mers that are complementary to a fragment of SEQ ID NO 3. Furthermore, App010 teaches that (¶14) ASOs for exon skipping can be at least 18 nt long. An ASO that is at least 18 nt can be 19- or 20-mer.
Further regarding Claim 1 and regarding Claims 10 and 18-19: ¶39 cited above shows that App010 teaches (¶39) 18-, 19-, and 20-mer ASOs that target their SEQ ID NO 3, which is a 122-mer. The following sequence alignments show that App010 SEQ ID NO 3 comprises 100% complementarity to 18-, 19-, and 20-mers that are claimed SEQ ID NOs 1 and 40-44:
RESULT 1
NASEQ2_02262026_163819/c
Query Match 100.0%; Score 20; DB 1; Length 122;
Best Local Similarity 85.0%;
Matches 17; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CUGCAACAGAUGGAAGACUC 20 SEQ ID NO 1
|:||||||||:|||||||:|
Db 93 CTGCAACAGATGGAAGACTC 74 App010-SEQ ID NO 3
RESULT 1
NASEQ2_02262026_163903/c
Query Match 100.0%; Score 19; DB 1; Length 122;
Best Local Similarity 84.2%;
Matches 16; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CUGCAACAGAUGGAAGACU 19 SEQ ID NO 40
|:||||||||:|||||||:
Db 93 CTGCAACAGATGGAAGACT 75 App010-SEQ ID NO 3
RESULT 1
NASEQ2_02262026_164014/c
Query Match 100.0%; Score 19; DB 1; Length 122;
Best Local Similarity 84.2%;
Matches 16; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 1 UGCAACAGAUGGAAGACUC 19 SEQ ID NO 41
:||||||||:|||||||:|
Db 92 TGCAACAGATGGAAGACTC 74 App010-SEQ ID NO 3
RESULT 1
NASEQ2_02262026_164130/c
Query Match 100.0%; Score 18; DB 1; Length 122;
Best Local Similarity 88.9%;
Matches 16; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CUGCAACAGAUGGAAGAC 18 SEQ ID NO 42
|:||||||||:|||||||
Db 93 CTGCAACAGATGGAAGAC 76 App010-SEQ ID NO 3
RESULT 1
NASEQ2_02262026_164103/c
Query Match 100.0%; Score 18; DB 1; Length 122;
Best Local Similarity 88.9%;
Matches 16; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAACAGAUGGAAGACUC 18 SEQ ID NO 43
||||||||:|||||||:|
Db 91 GCAACAGATGGAAGACTC 74 App010-SEQ ID NO 3
RESULT 1
NASEQ2_02262026_164232/c
Query Match 100.0%; Score 18; DB 1; Length 122;
Best Local Similarity 83.3%;
Matches 15; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 1 UGCAACAGAUGGAAGACU 18 SEQ ID NO 44
:||||||||:|||||||:
Db 92 TGCAACAGATGGAAGACT 75 App010-SEQ ID NO 3
Db 202 AA 203
Since App010 teaches that (¶14) nt sequences of the invention comprise at least 18 nts, the teachings of App010 encompass 18- to 20-mers that are 100% complementary to their SEQ ID NO 3. Since App010 teaches any sequence that is 18- or 20-mer and has complementarity to SEQ ID NO 3, and the alignments show SEQ ID NO 3 is complementary to claimed 18- and 20-mer SEQ ID NOs 20 and 41-44, the text of App010 (¶14 and ¶39 and SEQ ID NO 3) above anticipate Claims 18-19.
Regarding Claim 1: The passages above teach that nt sequences that comprise at least 18 or at least 20 consecutive nt and are complementary to App010 SEQ ID NO 3 are capable of binding to a pre-mRNA transcript of the CFTR gene, and suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA. App010 teaches (¶108) the CFP15a nasal epithelial cell line is established from a patient heterozygous for W1282X and 3849+10 kb C to T mutations. App010 teaches (Example 2, ¶118-119, Fig. 8) the oligonts modified splicing in those cells. That indicates that the App010 oligos were suitable for treating a subject heterozygous for the 3849+10 kb C to T mutation.
Regarding Claims 1 and 4-5, and 13-14: App010 teaches (¶21-23 and ¶31) the pharmaceutical compositions of the invention can comprise at least one additional anti-CF agent, that the additional anti-Cystic-Fibrosis agent is selected from the group consisting of a CFTR-splicing-modulating agent, a CFTR potentiator and a CFTR corrector, and that the CFTR potentiator can be N-(2,4-Di-tert-butyl-5-hy-droxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide (Ivacaftor), and that the CFTR corrector can be 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl) cyclopro-panecarbonyl]amino}-3-methylpyridin-2-yl}benzoic acid (Lumacaftor).. Therefore App010 discloses a combination therapy comprising (1) their ASO for suppressing intron 22 cryptic exon inclusion from mature CFTR mRNA and (2) Ivacaftor or Lumacaftor. App010 teaches (¶31) administering an additional agent that is a CFTR potentiator or CFTR corrector. App010 teaches (¶69) administrating a synthetic polynucleotide molecule according to the present invention with one or more of these drugs may be crucial in achieving beneficial therapeutic results. The text (¶21) at least one additional anti-CF agent indicates more than one additional anti-CF agents may be administered and may be crucial for achieving therapeutic results. That indicates that App010 envisioned administering any or all of the drugs from the list, which includes a CFTR potentiator (that can be Ivacaftor) and CFTR corrector (that can be Lumacaftor). Those are limitations of Claims 1, 4, and 13-14.
App010 discloses compounds for treating CF by administering a composition comprising (1) a synthetic oligo complementary to their SEQ ID NO 3 that suppresses intron 22 cryptic exon inclusion in the mature CFTR mRNA and (2) teaches their compositions can comprise at least one but possibly more additional anti-CF agents, including ivacaftor and lumacaftor. App010 discloses (¶81) methods of using the compounds to treat at least one clinical parameter of CF. App010 teaches (¶108) using their compounds on a cell line is established from a patient heterozygous for W1282X and 3849+10 kb C to T mutations. Therefore App010 anticipates Claims 1, 4, 10, 13, and 18-19.
Regarding Claim 2: App010 teaches (¶3) the F508del mutation is very common in CF. Since App010 discloses treating a cell line from a patient heterozygous for the 3849+10 kb C to T mutation and another mutation, and ¶3 demonstrates they knew about the F508del mutation, it is clear they envisioned treating patients having the 3849+10 kb C to T mutation in one allele and the F508del mutation in another allele. Therefore App010 anticipates Claim 2.
Regarding Claims 6-7 and 16: App010 teaches (¶6-7) splice-switching “antisense oligonucleotides”, or ASOs, can be chemically modified and can include the following kinds of modifications that maintain ASO stability, improve target affinity, and provide favorable pharmacokinetic properties: 2'-O-methyl-phospho-rothioate (2OMP), phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acids (PNAs), 2-methoxyethyl phosphorothioate (MOE) and alternating locked nucleic acids (LNAs). App010 discloses (¶107) 2-O-methyl oligos comprising a phosphorothioate backbone. An artisan would recognize that those modifications encompass backbone modifications and sugar modifications. Therefore App010 anticipates Claims 6-7 and 16.
Regarding Claims 11-12 and 17: App010 discloses (¶40) a pharmaceutical composition comprising the synthetic oligo, and (¶42) methods for improving at least one clinical parameter of CF in a patient, the method:
comprising the step of administering a therapeutically effective amount of a synthetic polynucleotide molecule as described above to said patient… said clinical parameter is selected from the group consisting of lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, and the need for antibiotic therapy for sinopulmonary signs or symptoms.
App010 shows (Figs. 8-9, ¶50-51, ¶120) the oligos increase the amount of correctly spliced CFTR transcript and restore CFTR function by increasing ion flux (specifically halide flux) through CFTR. App010 teaches that (¶68) the pharmaceutical composition is formulated for oral, nasal, aerosol, inhalational, abdominal, subcutaneous, intra-peritoneal or intravenous administration. Therefore App010 anticipates Claims 11-12 and 17.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-2, 4, 6-7, 10-13, and 16-19 are rejected under 35 U.S.C. 103 as being unpatentable over US Patent Application Publication No. 2015/0211010 (published 30 July 2015, “App010”; App010 was issued on 01 October 2019 as US Patent No. US 10428328; of record on IDS) as applied to Claims 1-2, 4, 6-7, 10-13, and 16-19 in the 102 rejection above, and further in view of US Patent Application Publication No. US 2013/0122493 (published 16 May 2013, “App493”; of record on IDS), Maruyama (and Yokota. 2018. Tips to Design Effective Splice-Switching Antisense Oligonucleotides for Exon Skipping and Exon Inclusion. Chapter 5, pp. 79-90 in Exon Skipping and Inclusion Therapies. Methods in Molecular Biology, vol. 1828. Springer, “Maruyama”, of record), and Vickers (et al. 2000. Effects of RNA secondary structure on cellular antisense Activity. Nuc. Acid Res. 28[6]:1340-1347, “Vickers”). This rejection is updated in response to claim amendments.
The teachings of App010 as they apply to Claims 1-2, 4, 6-7, 10-13, and 16-19 have been explained in the 102 rejection above.
App010 discloses compounds for treating CF by administering a composition comprising (1) a synthetic oligo complementary to their SEQ ID NO 3 that suppresses intron 22 cryptic exon inclusion in the mature CFTR mRNA and (2) teaches(¶21-23, ¶31, ¶69) their compositions can comprise an additional anti-CF agent or agents, including ivacaftor or lumacaftor. App010 discloses (¶81) methods of using the compounds to treat at least one clinical parameter of CF. App010 teaches (¶108) using their compounds on a cell line is established from a patient heterozygous for W1282X and 3849+10 kb C to T mutations. App010 teaches (¶6-7, ¶107) modified nucleotides, (¶42) methods of using their ASO to improve lung function, and (¶68) various treatment routes.
App010 does not disclose the exact sequences consisting of SEQ ID NOs 1 and 40-48 (Claims 1, 10, and 19). However, those sequences would have been obvious in view of App010 and the following prior art.
In addition to the teachings of App010 described above, App010 teaches (¶90-91) SEQ ID NO 8, an ASO for targeting the 3849 + 10 Kb C[Wingdings font/0xE0]T mutation and (¶109, Table 3-Primer 6; PDF p. 33) SEQ ID NO 20, a 22-mer primer that targets the 84-bp region around the intron 22 cryptic exon. App010 SEQ ID NO 20 comprises the exact nt sequence of claimed SEQ ID NOs 43, 46, and 48, as shown by the following alignments:
US-14-667-285A-20
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 20, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 20
LENGTH: 22
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Primer
Query Match 100.0%; Score 18; Length 22;
Best Local Similarity 88.9%;
Matches 16; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAACAGAUGGAAGACUC 18 SEQ ID NO 43
||||||||:|||||||:|
Db 1 GCAACAGATGGAAGACTC 18
Query Match 100.0%; Score 17; Length 22;
Best Local Similarity 88.2%;
Matches 15; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAACAGAUGGAAGACUC 17 SEQ ID NO 46
|||||||:|||||||:|
Db 2 CAACAGATGGAAGACTC 18
Query Match 100.0%; Score 17; Length 22;
Best Local Similarity 88.2%;
Matches 15; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAACAGAUGGAAGACU 17 SEQ ID NO 48
||||||||:|||||||:
Db 1 GCAACAGATGGAAGACT 17
Although App010’s SEQ ID NO 20 is a primer, App010 teaches it is for targeting the region around the intron 22 cryptic exon, and an artisan would have readily recognized that there is no reason why a primer could not be used as an ASO, particularly when it meets the requirements of targeting their own SEQ ID NO 3, as shown by this alignment:
NASEQ2_07032025_115206/c
Query Match 100.0%; Score 22; DB 1; Length 122;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAACAGATGGAAGACTCTTGT 22
||||||||||||||||||||||
Db 91 GCAACAGATGGAAGACTCTTGT 70
Furthermore, App010’s SEQ ID NO 8 is a 25-mer ASO for targeting the 3849 + 10 Kb C[Wingdings font/0xE0]T mutation, and is complementary to their own SEQ ID NO 3:
NASEQ2_07032025_115317/c
Query Match 100.0%; Score 25; DB 1; Length 122;
Best Local Similarity 72.0%;
Matches 18; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AACAGAUGGAAGACUCUUGUAAUUA 25
||||||:|||||||:|::|:||::|
Db 89 AACAGATGGAAGACTCTTGTAATTA 65
App010 SEQ ID NO 8 is also 100% identical to a contiguous 16-mer of claimed SEQ ID NO 46:
US-17-709-485-46
Query Match 64.0%; Score 16; DB 1; Length 17;
Best Local Similarity 100.0%;
Matches 16; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AACAGAUGGAAGACUC 16
||||||||||||||||
Db 2 AACAGAUGGAAGACUC 17
Combining the full teachings of App010 and the other prior art discussed below would have made obvious all of the exact nt sequences consisting of the claimed SEQ ID NOs.
App493, drawn to probes for distinguishing between nucleotide variants that are in close proximity on a gene, teaches (p. 14, PDF p. 21, Table 3) only two probes for the 3849+10kb C[Wingdings font/0xE0]T mutation. Those are App493 SEQ ID NOs 43 and 44. SEQ ID NO 43 is a 23-mer comprises 100% complementarity to instant SEQ ID NO 1, as shown by the following alignment:
RESULT 2
BAN46507/c
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
ID BAN46507 standard; DNA; 23 BP.
XX
AC BAN46507;
XX
DT 20-JUN-2013 (first entry)
XX
DE Intron19 region-specific PCR primer/probe 3849 + 10 kbc > T F3, SEQ: 43.
XX
KW PCR; algorithm; blood clotting disorder; cancer; cystic fibrosis;
KW diagnostic test; dna typing; hemorrhagic telangiectasia;
KW hereditary hemorrhagic telangiectasia; primer; probe; ss.
XX
OS Homo sapiens.
XX
CC PN US2013122493-A1.
XX
CC PD 16-MAY-2013.
XX
CC PF 16-NOV-2011; 2011US-00297970.
XX
PR 16-NOV-2011; 2011US-00297970.
XX
CC PA (CANO ) CANON US LIFE SCI INC.
XX
CC PI Xu L, Howell R;
XX
DR WPI; 2013-H42400/36.
XX
CC PT Distinguishing nearby neighbor variants on nucleic acid, involves
CC PT providing aliquot of nucleic acid, incubating aliquot with e.g. limiting
CC PT primer, performing asymmetric PCR, generating melting curve and analyzing
CC PT melting curve.
XX
CC PS Example 3; SEQ ID NO 43; 33pp; English.
XX
CC The present invention relates to a method of distinguishing between at
CC least two nearby neighbor variants on a nucleic acid having a locus of
CC interest. The locus of interest is on a gene associated with a disorder
CC selected from the group consisting of cystic fibrosis, Factor V Leiden,
CC human platelet antigens, a RET proto-oncogene associated disease, lactase
CC hemorrhagic telangiectasia, and hereditary hemorrhagic telangiectasia.
CC The invention further provides: a method of detecting a disease in a
CC patient based on said patient's genotype and a priori knowledge of benign
CC and disease-causing variant gene sequences associated with the disease; a
CC kit comprising a primer or probe used for performing a diagnostic test
CC for cystic fibrosis transmembrane conductance regulator Exon 10 variants
CC using a biological sample from a patient; a method of designing primers
CC and probes that are useful for thermal melt analysis of a nucleic acid
CC having a locus of interest that contains one or more benign variants and
CC one or more disease-causing variants that are in close proximity; and a
CC system for distinguishing between at least two nearby neighbor variants
CC on a nucleic acid having a locus of interest. The present sequence
CC represents a PCR primer/probe specific to a human intron19 region
CC associated with the disorder of the invention.
XX
SQ Sequence 23 BP; 5 A; 5 C; 5 G; 8 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 23;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTGCAACAGATGGAAGACTC 20 SEQ ID NO 1
||||||||||||||||||||
Db 22 CTGCAACAGATGGAAGACTC 3
Since claimed SEQ ID NO 1 comprises all the other claimed SEQ ID NOs (i.e., SEQ ID NOs 40-48), an artisan would readily recognize that App493’s SEQ ID NO 43 comprises complementarity to SEQ ID NOs 40-48. Since App493 teaches only two sequences targeting the region of the specific mutation, testing ASOs comprising either of them would have been a matter of routine optimization of a finite number of variants.
App493 also teaches about the F508 mutation. App493 teaches (¶6) F508del is a deleterious mutation found in 70-75% of North American CF chromosomes. App493 teaches (¶99) probes that distinguish between heterozygous F508del and other mutations and (Table 1 on PDF p. 19) at least one biological sample from a patient heterozygous for the 3849 + 10 Kb C[Wingdings font/0xE0]T mutation and the F508del mutation.
Maruyama, drawn to tips for designing effective splice switching ASOs for exon skipping, teaches strategies for designing effective ASOs for exon skipping. Maruyama teaches (§Abstract): A major challenge in exon skipping and exon inclusion is the difficulty in designing effective AONs. The mechanism of mRNA splicing is highly complex, and the efficacy of AONs is often unpredictable but Maruyama’s teachings indicate that, at the time of filing the claimed invention, optimizing known ASO sequences was well within the purview of a skilled artisan.
Maruyama teaches (§1. Introduction ¶3) the length of a splice switching ASO can vary from 8- to 30-mer, and that sequences with certain modifications can even be as short as 14-mer. Maruyama teaches (§Methods) methods for designing exon skipping ASO. Maruyama teaches (§3.3 Examine the Secondary Structure of mRNA) tools for predicting mRNA secondary structure (which affects ASO–target binding), (§3.4 Selection of Chemical Modification and Length) tools for selecting chemical modification and sequence length, (§3.7 Melting Temperature Estimation) tools for predicting melting temperature and that (§Notes, point9) modifications can affect binding affinity to a target strand. Maruyama teaches (§Notes, point 2) the functionality of the truncated protein should be taken into account. Maruyama teaches (§Notes, point4) a cocktail of splice-switching ASOs can be employed to induce multiple exon skipping. Altogether. Maruyama teaches ASO length is an important factor and optimal length depends on chemical modification pattern and GC content and teaches ASO lengths that encompass 17- to 20-mer.
Vickers teaches (§Abstract) mRNA secondary structure can affect hybridization efficiency and potency of RNAi. Vickers teaches (§Introduction ¶3-4) an oligont walk to identify sequences with best potency:
Identification of potent antisense sequences has often been based upon empirical approaches to oligonucleotide selection because the optimal target site on the mRNA cannot yet be predicted. Many investigators employ oligonucleotide ‘walks’, spacing oligonucleotides of a given length at intervals along the RNA and choosing the one with the most activity… activity was optimized by testing numerous oligonucleotides shifted either 5′ or 3′ of the initial site. These experiments change not only the target site on the mRNA, but also the sequence and base composition of oligonucleotides. Any or all of these changes might affect oligonucleotide potency. [emphasis added.]
Those teachings indicate it is routine and conventional in the art of ASO design to produce oligont that target points along a target mRNA, and that is done because changing the target site on the mRNA and sequence/base composition of oligont can affect potency.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the ASOs for treating CF of App010 with the teachings and sequences for targeting the C[Wingdings font/0xE0]T mutation of App010, the ASO comprising App493 SEQ ID NO 43 and teachings about the existence of individuals heterozygous for the C[Wingdings font/0xE0]T and F508del mutations of App493, and the teachings about designing effective splice-switching ASOs of Maruyama and general teachings about ASO design of Vickers for the benefit of optimizing the sequences of App010 and App493 to design ASOs that most effectively induce suppression of intron 22 cryptic exon inclusion from the mature CFTR mRNA and which could be used to treat individuals heterozygous for both the C[Wingdings font/0xE0]T and F508del mutations. One would have been motivated to do so because App010 teaches targeting any region in their SEQ ID NO 3 and also has SEQ ID NO 8 which demonstrates that the particular target region was of interest. One would have been motivated to do so with a reasonable expectation of success because Maruyama teaches the efficacy of ASOs can vary but teaches tips for designing effective ASOs. One would have been motivated because App493 discloses that there are individuals heterozygous for the two mutations. Furthermore, success would have been a reasonable guarantee because App010 already showed (¶50; Fig. 8) SEQ ID NO 8 (which comprises identity to a large contiguous chunk of the claimed sequences) increases the level of correctly spliced CFTR gene, and because the combination of prior art establishes that the ASOs comprising the exact claimed SEQ ID NOs were known for use in treating CF and were the subject of targeting by at least two references. Furthermore, the teachings of App010 indicate that combining ASOs with other treatments was well-established practice in the art of treating CF. The art of Maruyama indicates that strategies for improving splice-switching ASOs were well known, and the art of Vickers indicates it is routine and conventional in the art of ASO design to test multiple sequences that target a specific region and in that way determine which works best. Both Vickers and Maruyama indicate that varying ASO length and precise target were routine and conventional practices for the purposes of optimizing an ASO. That would have motivated an artisan to take known sequences of App010 and App493 and modify them according to Maruyama and Vickers for the benefits of improving efficacy and producing the shortest sequences that are also efficacious, which would have had the benefit or producing less expensive but still effective ASOs. In trying the obvious variants, they would have produces ASOs consisting of SEQ ID NOs 1 and 40-48. Therefore the limitations of Claims 1-2, 4, 6-7, 10-13, and 16-19 would have been obvious in view of App010, App493, Maruyama, and Vickers.
Claim(s) 1-7, 10-14, and 16-19 are rejected under 35 U.S.C. 103 as being unpatentable over App010, App493, Maruyama, and Vickers as applied to Claims 1-2, 4, 6-7, 10-13, and 16-19 in the 103 rejection above, and further in view of International Publication Number WO 2019/200450 (published 24 October 2019 but effectively filed on 09 July 2018, “WO450”) and Keating (et al. 2018. VX-445–Tezacaftor–Ivacaftor in Patients with Cystic Fibrosis and One or Two Phe508del Alleles. N. Engl. J. Med. 379:1612-1620, “Keating”). References to p. # in WO450 refer to the PDF p. #. This rejection is new in response to claim amendments.
Although WO450 was published 24 October 2019, the content relied upon for this rejection was effectively filed on 09 July 2018, which is approx. 10 months before the earliest provisional document of the instant application.
The WO450 content discussed in this rejection are entitled to the priority date of 09 July 2018 and are considered prior art under 35 U.S.C. 102(a)(2).
If the issue date of the U.S. patent or publication date of the U.S. patent application publication or WIPO published application is not before the effective filing date of the claimed invention, it may be applicable as prior art under AIA 35 U.S.C. 102(a)(2) if it was "effectively filed" before the effective filing date of the claimed invention in question with respect to the subject matter relied upon to reject the claim. MPEP § 2152.01 discusses the "effective filing date" of a claimed invention. AIA 35 U.S.C. 102(d) sets forth the criteria to determine when subject matter described in a U.S. patent document was "effectively filed" for purposes of AIA 35 U.S.C. 102(a)(2).
2154.01(a) WIPO Published Applications [R-11.2013]
[Editor Note: This MPEP section is only applicable to applications subject to examination under the first inventor to file (FITF) provisions of the AIA as set forth in 35 U.S.C. 100 (note). See MPEP § 2159 et seq. to determine whether an application is subject to examination under the FITF provisions, and MPEP § 2131-MPEP § 2138 for examination of applications subject to pre-AIA 35 U.S.C. 102.]
The WIPO publication of a PCT international application that designates the United States is an application for patent deemed published under 35 U.S.C. 122(b) for purposes of AIA 35 U.S.C. 102(a)(2) under 35 U.S.C. 374. Thus, under the AIA , WIPO publications of PCT applications that designate the United States are treated as U.S. patent application publications for prior art purposes, regardless of the international filing date, whether they are published in English, or whether the PCT international application enters the national stage in the United States. Accordingly, a U.S. patent, a U.S. patent application publication, or a WIPO published application that names another inventor and was effectively filed before the effective filing date of the claimed invention, is prior art under AIA 35 U.S.C. 102(a)(2). This differs from the treatment of a WIPO published application under pre-AIA 35 U.S.C. 102(e), where a WIPO published application is treated as a U.S. patent application publication only if the PCT application was filed on or after November 29, 2000, designated the United States, and is published under PCT Article 21(2) in the English language. See MPEP § 2136.03, subsection II.
§MPEP 2154.01
See also §MPEP 2152.01.
The teachings of App010, App493, Maruyama, and Vickers as they apply to Claims 1-2, 4, 6-7, 10-13, and 16-19 have been explained in the 103 rejection above.
App010, App493, Maruyama, and Vickers teach a method for treating CF in a subject having a 3849 + 10 Kb C[Wingdings font/0xE0]T mutation in CFTR gene, comprising administering to the subject (1) an ASO consisting of SEQ ID NOs 1 or 40-48, (2) a therapeutically effective amount of a CFTR potentiator that can be ivacaftor and (3) a therapeutically effective amount of a CFTR correct that can be lumacaftor. As discussed above, App010 teaches (¶69) administrating a synthetic polynucleotide molecule according to the present invention with one or more of these drugs may be crucial in achieving beneficial therapeutic results.
App010, App493, Maruyama, and Vickers do not teach that the CFTR corrector can be tezacaftor or elexacaftor (Claims 3 and 5), that the CFTR corrector can be VX-440 or VX-152 (alternative limitations of Claim 13), or that the CFTR potentiator can be ABBV-2222/GLPG2222 or deuterated ivacaftor (Claim 14-15).
WO450 (§Abstract) is drawn to methods for enhancing ion transporter activity and increasing cell surface expression of CFTR. WO450 teaches (p. 4 L4-7) the CFTR potentiators ivacaftor and correctors lumacaftor, tezacaftor, and LGPG222 all offer hope for individuals with CF who have a non-gating mutation. WO450 teaches (p. 3 L15-20) ion channel opening and closing is “gating”. WO450 teaches (p. 15 L30-35) the 3849 + 10kb C[Wingdings font/0xE0]T mutation affects the stability or turnover of the CFTR protein at the cell surface, which indicates it’s a nongating mutation. WO450 teaches (p. 18 L20-35) ion transporter modulators increase the activity of ion transporters by improving ion flow in the channel, improving folding/trafficking of the ion transporter, and/or increasing the amount of transporter the cell produces. WO450 teaches (p. 37 L1-6) kits for administering at least two CFTR modulators {e.g., ivacaftor (IVA, VX-770), GLPG2451, GLPG1837, Iumacaftor (LUM, VX-809), tezacaftor (VX-661), VX-440, VX-152 or GLPG2222}. That and teachings in App010 discussed above indicate it was routine and conventional in the art of treating CFTR to administer multiple drugs to obtain satisfactory treatment for patients.
Keating teaches (§Abstract) administering VX-445 (called “elexacaftor” in instant Claim 5), tezacaftor, and ivacaftor to CF patients who have one or two Phe508del alleles. Keating teaches (same §) the combination therapy increased CFTR function in both sets of patients, and the approach has the potential to treat the underlying cause of CF in approximately 90% of patients. Keating also teaches (§Methods-Clinical development ¶2) treating patients with the additional drug VX-561, a deuterated form of ivacaftor taken once daily. Keating teaches (§Results-Safety ¶2, §Results-Efficacy) their study found both combination therapies safe and effective. Keating teaches (§Main text ¶2) their idea is that combining different drugs with different mechanisms of action would improve treatment because it addresses different symptoms of or causes underlying CF:
Because VX-445 has a mechanism of action that is different from that of the first-generation corrector tezacaftor, we hypothesized that combining VX-445 and tezacaftor would result in a greater amount of Phe508del CFTR protein at the cell surface than would either molecule alone. We also hypothesized that the addition of the CFTR potentiator ivacaftor, which increases CFTR gating activity, would further augment CFTR function.
The teachings of App010, WO450, and Keating indicate it was routine and conventional in the art of treating CF to use a combination of drugs to treat the different causes underlying the disease.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of treating CF in a patient having a 3849 +10kb C[Wingdings font/0xE0]T mutation by administering a composition comprising an ASO consisting of SEQ ID NOs 1 or 40-48 plus a CFTR potentiator and CFTR corrector of App010, App493, Maruyama, and Vickers with the teachings and combination therapies of WO450 and Keating for the benefit of most effectively treating CF. One would have been motivated to do so with a reasonable expectation of success because App010 teaches administering multiple drugs can be crucial to benefiting a patient with CF, and WO450 and Keating teach the additional drugs operate via different mechanisms, namely improving ion flow through the CFTR channel and increasing the amount of CFTR protein at the cell surface, and different from the splice-altering ASO of App010, App493, Maruyama, and Vickers which remediates the 3849 +10kb C[Wingdings font/0xE0]T mutation. It would have been obvious to use the ASO to address the 3849 +10kb C[Wingdings font/0xE0]T mutation and also use additional drugs to address other features of the disease, including those caused by another mutation, such as F508del which Keating teaches affects approximately 90% of CF patients. Therefore the limitations of Claims 3, 5, and 13-14 would have been obvious in view of App010, App493, Maruyama, Vickers,WO450, and Keating. Additionally Keating teaches the deuterated ivacaftor of Claim 15.
Claim(s) 1-7 and 10-19 are rejected under 35 U.S.C. 103 as being unpatentable over App010, App493, Maruyama, Vickers, WO450 and Keating as applied to Claims 1-7, 10-14, and 16-19 in the 103 rejection above, and further in view of Vertex (2021. Vertex to Initiate Phase 3 Development Program for New Once-Daily Triple Combination Regimen in People With Cystic Fibrosis. Press release. Available at investors.vrtx.com, “Vertex”). This rejection is new in response to claim amendments.
As discussed above in §Priority, the compound VX-121 has the priority date of 31 March 2022.
The teachings of App010, App493, Maruyama, Vickers, WO450 and Keating as they apply to Claims 1-7, 10-14, and 16-19 have been explained in the 103 rejection above.
App010, App493, Maruyama, Vickers, WO450 and Keating teach a method for treating CF in a subject having a 3849 + 10 Kb C[Wingdings font/0xE0]T mutation in CFTR gene, comprising administering to the subject (1) an ASO consisting of SEQ ID NOs 1 or 40-48, (2) a therapeutically effective amount of a CFTR potentiator and (3) a therapeutically effective amount of a CFTR corrector, wherein the potentiator can be tezacaftor and the corrector can be deuterated ivacaftor. As discussed above, App010 teaches (¶69) administrating a synthetic polynucleotide molecule according to the present invention with one or more of these drugs may be crucial in achieving beneficial therapeutic results. WO450 and Keating indicate it is beneficial to patients to address various underlying causes and effects of CF.
App010, App493, Maruyama, Vickers, WO450 and Keating do not teach that the composition comprises VX-121, tezacaftor, and deuterated ivacaftor (Claim 15).
However, Vertex, drawn to a new once-daily triple combination regiment for people with CF, teaches (p. 1) a triple combination of VX-121, tezacaftor, and deuterated ivacaftor (VX-561). Vertex teaches (same §) phase 2 data demonstrated that a once-daily triple combination of VX-121/tezacaftor/VX-561 has potential for enhanced clinical benefit compared to other combination treatments. Vertex teaches (¶1) the combination of VX-121/tezacaftor/VX-561 has increased efficacy based on its ability to drive higher levels of chloride transport vs. other combination therapies.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of treating CF in a patient having a 3849 +10kb C[Wingdings font/0xE0]T mutation by administering a composition comprising an ASO consisting of SEQ ID NOs 1 or 40-48 plus tezacaftor and deuterated ivacaftor of App010, App493, Maruyama, Vickers, WO450 and Keating with the combination therapy comprising the triple combination of VX-121, tezacaftor, and deuterated ivacaftor (VX-561) of Vertex for the benefit of most effectively treating CF in a patient. One would have been motivated to do so with a reasonable expectation of success because App010 teaches administering multiple drugs can be crucial to benefiting a patient with CF, and WO450 and Keating teach the additional drugs operate via different mechanisms, namely improving ion flow through the CFTR channel and increasing the amount of CFTR protein at the cell surface, and different from the splice-altering ASO of App010, App493, Maruyama, and Vickers which remediates the 3849 +10kb C[Wingdings font/0xE0]T mutation. It would have been obvious to do so because Vertex teaches their combination of VX-121/tezacaftor/VX-561 shows enhanced clinical benefits vs. other combination therapies. It would have been obvious to use the ASO to address the 3849 +10kb C[Wingdings font/0xE0]T mutation and also use additional drugs to address other features of the disease, including those caused by another mutation, such as F508del which Keating teaches affects approximately 90% of CF patients. Vertex teaches (¶1) their combination therapy is effective in CF patients with one F508del mutation. Therefore the limitations of Claim 15 would have been obvious in view of App010, App493, Maruyama, Vickers, WO450, Keating and Vertex. Therefore the limitations of Claims 1-7 and 10-19 would have been obvious in view of App010, App493, Maruyama, Vickers, WO450, Keating and Vertex.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
***********Note: the instant claims recite pharmaceutical compositions and methods comprising combination therapies comprising the instant oligos and another agent that can be a CFTR potentiator or a CFTR corrector, or a combination thereof (including the specific agents recited in Claims 4-5). Therefore ANY and ALL of Applicant’s patented or copending claims that are directed to any of those categories of agent are subject to a nonstatutory double patenting rejection. Because time for examination does not permit an individual rejection over every single patent/copending application, a selection of patents and copending applications are rejected below. But any patent or copending application that is directed to any of the agents discussed is subject to an NSDP rejection.***********
Claims 1-7 and 10-19 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following U.S. Patents in view of US Patent Application Publication No. 2015/0211010 (published 30 July 2015, “App010”; App010 was issued on 01 October 2019 as US Patent No. US 10428328; of record on IDS), US Patent Application Publication No. US 2013/0122493 (published 16 May 2013, “App493”; of record on IDS), Maruyama (and Yokota. 2018. Tips to Design Effective Splice-Switching Antisense Oligonucleotides for Exon Skipping and Exon Inclusion. Chapter 5 (pp. 79-90 in Exon Skipping and Inclusion Therapies. Methods in Molecular Biology, vol. 1828. Springer, “Maruyama”, of record), Vickers (et al. 2000. Effects of RNA secondary structure on cellular antisense Activity. Nuc. Acid Res. 28[6]:1340-1347, “Vickers”), International Publication Number WO 2019/200450 (published 24 October 2019 but effectively filed on 09 July 2018, “WO450”), Keating (et al. 2018. VX-445–Tezacaftor–Ivacaftor in Patients with Cystic Fibrosis and One or Two Phe508del Alleles. N. Engl. J. Med. 379:1612-1620, “Keating”), and Vertex (2021. Vertex to Initiate Phase 3 Development Program for New Once-Daily Triple Combination Regimen in People With Cystic Fibrosis. Press release. Available at investors.vrtx.com, “Vertex”). This rejection is updated in response to claim amendments.
Application No.
Issued Patent No.
Abbreviation
issue date
Claims
15/869664
US 10731156
US156
2020-08-04
1-20
14/667285
US 10428328
US328
2019-10-01
1-9
Although the claims at issue are not identical, they are directed to overlapping subject matter because the copending claims are directed to compounds and/or methods that can be considered CFTR modifiers, and combination therapies comprising CFTR modifiers are recited in the instant claims.
The patented US156 Claims 1-20 are directed to a pharmaceutical composition comprising CFTR-splicing modulating agents that suppress exon 10 exclusion and that are complementary to SEQ ID NO 2, wherein the sequence can be 18-30 nts, to nts comprising modifications, polynts comprising SEQ ID NOs 6-8 or any active fragment thereof, and methods for using them to treat CF, to particular formulations, and to a kit that comprises the compounds and an additional anti-CF agent.
The patented US328 Claims 1-9 are directed to methods of improving at least one clinical parameter of CF in a patient by administering a CFTR-splicing modulating agent that suppresses exon 10 exclusion and which is complementary to SEQ ID NO 2, and to methods of using the compounds with an additional anti-CF agent. The patented US328 claims recite a method for also suppressing intron 22 cryptic exon inclusion and using the modifier ivacaftor.
The instant claims are directed to a method for treating CF in a subject heterozygous for the 3849 +10Kb C-to-T mutation in the CFTR gene, comprising administering to said subject (1) a composition comprising a therapeutically effective amount of a synthetic oligonucleotide consisting of any one of SEQ ID NOs 1 or 40-48; and (2) a composition comprising a CFTR potentiator and a CFTR corrector; wherein the patient can also be heterozygous for an F508del mutation; wherein the ASO can comprise various modifications; wherein the treating results in various outcomes, and wherein the composition can be administered in various ways or with various potentiators and/or correctors.
All the claim sets are directed to compositions for treating CF by administering an agent (and in the case of US328, that targets the same mutation and can comprise an additional anti-CF agent). An artisan might not know what are the patented SEQ ID NOs 6-8 so they’d look in the SEQ listings and Specs. and find that those sequences comprise ASOs for exon skipping. All the claim sets are directed to anti-CF agents, so the patented claim sets read on the instantly claimed additional CFTR modifier.
The patented US156 claims do not recite treating the C[Wingdings font/0xE0]T mutation, and neither patented claim set recites the claimed SEQ ID NOs or every limitation of the instant claims, but those are taught in the art and would have been obvious in view of the teachings of: App010 (¶4, ¶39, ¶14, SEQ ID NO 3, ¶108; Example 2, ¶118-119, Fig. 8; ¶21-23 and ¶31, ¶69, ¶21, ¶81, ¶108, ¶3, ¶6-7, ¶107, ¶40, ¶42; Figs. 8-9, ¶50-51, ¶120; ¶68, ¶90-91 and SEQ ID NO 8; ¶109, Table 3-Primer 6; PDF p. 33), App493 (p. 14, PDF p. 21, Table 3; SEQ ID NO 43, ¶6, ¶99, Table 1 on PDF p. 19), Maruyama (§1. Introduction ¶3; §Methods, §3.3 Examine the Secondary Structure of mRNA; §3.4 Selection of Chemical Modification and Length; §3.7 Melting Temperature Estimation; §Notes, points 2, 4, and 9), Vickers (§Abstract and §Introduction ¶3-4), WO450 (§Abstract, p. 4 L4-7; p. 3 L15-20; p. 15 L30-35; p. 18 L20-35; p. 37 L1-6), Keating (§Abstract, §Methods-Clinical development ¶2; §Results-Safety ¶2, §Results-Efficacy; §Main text ¶2), and Vertex (p. 1 and ¶1).
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant invention to modify the oligos of the patented claims with the teachings of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex for the benefit of improving treatment outcomes. One would have been motivated to do so with a reasonable expectation of success because App010 teaches the compounds for targeting the C[Wingdings font/0xE0]T mutation and teaches administering additional CFTR modifiers including splicing-modulating agents, which encompasses the compounds of the patented claims. Additionally, the US328 claims recite administering a combination of CF-treating compounds. Modifying the patented oligos of the US156 and US328 claims with the teachings of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex would have produced the claimed invention, including all of Claims 1-7 and 10-19.
This is a nonstatutory double patenting rejection.
Claims 1-7 and 10-19 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following patents in view of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex. This rejection is updated in response to claim amendments.
Application No.
Issued Patent No.
Abbreviation
Publication or issue date
Claims
16/246920
US 10624851
US851
2020-04-21
12-15
14/115869
US 10179106
US106
2019-01-15
15-18
Although the claims at issue are not identical, they are directed to overlapping subject matter.
The patented US851 Claims 12-15 and US106 Claims 15-18 recite a method of treating a pathological condition in a subject, wherein the condition can be CF, comprising administering to the subject a liposome that can comprise a bioactive agent for treating the pathological condition.
The instant claims are directed to a method for treating CF in a subject heterozygous for the 3849 +10Kb C-to-T mutation in the CFTR gene, comprising administering to said subject (1) a composition comprising a therapeutically effective amount of a synthetic oligonucleotide consisting of any one of SEQ ID NOs 1 or 40-48; and (2) a composition comprising a CFTR potentiator and a CFTR corrector; wherein the patient can also be heterozygous for an F508del mutation; wherein the ASO can comprise various modifications; wherein the treating results in various outcomes, and wherein the composition can be administered in various ways or with various potentiators and/or correctors.
Both claim sets are directed to compositions for treating CF.
The patented US851 and US106 claims do not disclose the specific synthetic oligos and combination therapy of the instant claims.
The patented claims don’t recite all the limitations of the instant claims but those are taught in the art and would have been obvious in view of the teachings of: App010 (¶4, ¶39, ¶14, SEQ ID NO 3, ¶108; Example 2, ¶118-119, Fig. 8; ¶21-23 and ¶31, ¶69, ¶21, ¶81, ¶108, ¶3, ¶6-7, ¶107, ¶40, ¶42; Figs. 8-9, ¶50-51, ¶120; ¶68, ¶90-91 and SEQ ID NO 8; ¶109, Table 3-Primer 6; PDF p. 33), App493 (p. 14, PDF p. 21, Table 3; SEQ ID NO 43, ¶6, ¶99, Table 1 on PDF p. 19), Maruyama (§1. Introduction ¶3; §Methods, §3.3 Examine the Secondary Structure of mRNA; §3.4 Selection of Chemical Modification and Length; §3.7 Melting Temperature Estimation; §Notes, points 2, 4, and 9), Vickers (§Abstract and §Introduction ¶3-4), WO450 (§Abstract, p. 4 L4-7; p. 3 L15-20; p. 15 L30-35; p. 18 L20-35; p. 37 L1-6), Keating (§Abstract, §Methods-Clinical development ¶2; §Results-Safety ¶2, §Results-Efficacy; §Main text ¶2), and Vertex (p. 1 and ¶1).Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligos of the patented claims with the teachings of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex for the benefit of improving treating by using a combination treating and optimizing the ASO molecules. One would have been motivated to do so with a reasonable expectation of success because App010 teaches using a combination treatment and teaches the benefits of oligos that that target the C[Wingdings font/0xE0]T mutation. One would have been motivated to do so because the teachings of Maruyama indicate that optimizing ASOs for splice switching is well within the purview of one of ordinary skill in the art. One would have been motivated to do so for the benefits of treating CF on multiple fronts as taught by WO450, Keating, and Vertex. One would have been motivated to do so because the patented claims teach liposomes for administering treatment for CF and an artisan would have realized they could package the compositions of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex in the patented liposomes.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant invention to package the oligos of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex in the liposome of the US851 and US106 claims for the benefit of delivering the agents. Doing so would have produced the limitations of Claims 1-12.
This is a nonstatutory double patenting rejection.
Claims 1-7 and 10-19 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of copending Application No. 18765286 (reference application, “App286”) in view of App010, Maruyama, Vickers, WO450, Keating, and Vertex. NOTE: this application has issued as US Patent No. 12351803. However, that documents is not yet available so the App# is used here. This rejection is updated in response to claim amendments.
Although the claims at issue are not identical, they are not patentably distinct from each other because the allowed App286 claims are directed to a synthetic oligonucleotide molecule complementary to a pre-mRNA transcript of a cystic fibrosis transmembrane conductance regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation, wherein the sequence of said synthetic oligonucleotide molecule consists of the sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 40 and characterized by increasing the percentage of correctly spliced mature CFTR mRNA by at least 10%; and decreasing the level of aberrantly spliced mature CFTR mRNA by at least 20%, and to methods of using the oligos to treat CF, including various kinds of administration.
The instant claims are directed to a method for treating CF in a subject heterozygous for the 3849 +10Kb C-to-T mutation in the CFTR gene, comprising administering to said subject (1) a composition comprising a therapeutically effective amount of a synthetic oligonucleotide consisting of any one of SEQ ID NOs 1 or 40-48; and (2) a composition comprising a CFTR potentiator and a CFTR corrector; wherein the patient can also be heterozygous for an F508del mutation; wherein the ASO can comprise various modifications; wherein the treating results in various outcomes, and wherein the composition can be administered in various ways or with various potentiators and/or correctors.
Both claim sets recite SEQ ID NOs 1 and 40 and methods for treating CF by inducing suppression of the intron 22 cryptic exon.
The instant claims are directed to the same subject matter as App286 except App286 requires the sequence of the oligo to be either instant SEQ ID NOs 1 or 40 and the instant claims allow the sequence to comprise sequences that are shorter versions of those sequences. For example, App286 SEQ ID NO 1 comprises instant SEQ ID NOs 41-48. An exemplary alignment is shown here:
US-18-765-286-1
Query Match 100.0%; Score 17; DB 1; Length 20;
Best Local Similarity 88.2%;
Matches 15; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAACAGAUGGAAGACU 17 SEQ ID NO 48
||||||||:|||||||:
Db 3 GCAACAGATGGAAGACT 19 App286 SEQ ID NO 1
App286 claims do not recite administering an additional CFTR modifier.
However, App010 and the other prior art teach the limitations that the App286 claims don’t teach. The patented claims don’t recite all the limitations of the instant claims but those are taught in the art and would have been obvious in view of the teachings of: App010 (¶4, ¶39, ¶14, SEQ ID NO 3, ¶108; Example 2, ¶118-119, Fig. 8; ¶21-23 and ¶31, ¶69, ¶21, ¶81, ¶108, ¶3, ¶6-7, ¶107, ¶40, ¶42; Figs. 8-9, ¶50-51, ¶120; ¶68, ¶90-91 and SEQ ID NO 8; ¶109, Table 3-Primer 6; PDF p. 33), Maruyama (§1. Introduction ¶3; §Methods, §3.3 Examine the Secondary Structure of mRNA; §3.4 Selection of Chemical Modification and Length; §3.7 Melting Temperature Estimation; §Notes, points 2, 4, and 9), Vickers (§Abstract and §Introduction ¶3-4), WO450 (§Abstract, p. 4 L4-7; p. 3 L15-20; p. 15 L30-35; p. 18 L20-35; p. 37 L1-6), Keating (§Abstract, §Methods-Clinical development ¶2; §Results-Safety ¶2, §Results-Efficacy; §Main text ¶2), and Vertex (p. 1 and ¶1).
It would have been obvious to an artisan to modify the use the compounds of the App286 claims with the teachings of Maruyama and Vickers and use them in the combination methods of WO450, Keating, and Vertex because Maruyama teach optimizing ASO sequences and WO450, Keating, and Vertex teach optimizing treatments and because App010 teaches administering additional CFTR modifiers in addition to ASOs. Therefore it would not be possible to possess or use the compounds of the claimed methods without the compounds and methods that would have been obvious in view of App286 and App010, Maruyama, Vickers, WO450, Keating, and Vertex.
Claims 1-7 and 10-19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 32-52 of copending Application No. 17607908 (reference application, “App908”) in view of Maruyama, Vickers, WO450, Keating, and Vertex. This rejection is updated in response to claim amendments.
Although the claims at issue are not identical, they are not patentably distinct from each other because the copending App908 claims are directed to a synthetic oligont that at least partially suppresses the inclusion of a CFTR gene having a 3849 kb C[Wingdings font/0xE0]T mutation, wherein the sequence can complementary to SEQ ID NO 37 or can be SEQ ID NOs 1 or 41-48 and can comprise a chemically modified nt including the modification 2’OMP, to a pharmaceutical composition comprising the oligo and a pharmaceutically acceptable carrier, to the pharmaceutical composition further comprising a CFTR modifier that can be a CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others, wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator, and to methods of administering the oligos to treat CF (including via oral/nasal/inhalation and other kinds of administration), wherein the treatment can improve a clinical outcome including lung function and others.
The instant claims are directed to the same subject matter including ASOs consisting of the same SEQ ID NOs. Instant SEQ ID NOs 1 and 41-48 are, respectively, identical to App908 SEQ ID NOs 1 and 41-48. Claimed SEQ ID NO 40 is comprised by App908 SEQ ID NO 1 and would have been obvious in view of Maruyama and Vickers. An alignment of SEQ ID NOs 1 is shown here:
RESULT 1
US-17-607-908-1
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 1, US/17607908
GENERAL INFORMATION
APPLICANT: YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW
APPLICANT: UNIVERSITY OF JERUSALEM LTD.
APPLICANT: SPLISENSE LTD.
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: P-607045-PC
CURRENT APPLICATION NUMBER: US/17/607,908
CURRENT FILING DATE: 2021-11-01
PRIOR APPLICATION NUMBER: PCT/IL2020/050495
PRIOR FILING DATE: 2020-05-05
PRIOR APPLICATION NUMBER: US 62/843,469
PRIOR FILING DATE: 2019-05-05
NUMBER OF SEQ ID NOS: 71
SEQ ID NO 1
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 85.0%;
Matches 17; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTGCAACAGATGGAAGACTC 20
|:||||||||:|||||||:|
Db 1 CUGCAACAGAUGGAAGACUC 20
Furthermore, both claim sets are directed to methods of treating CF, including by administering an additional CFTR modifier that can be, among others, ivacaftor.
It would not be possible to possess or use the instant compounds without the App908 compounds and methods.
The App908 claims don’t teach all the instant claim limitations but those are taught in the prior art and the instant claims would have been obvious in view of the teachings of: Maruyama (§1. Introduction ¶3; §Methods, §3.3 Examine the Secondary Structure of mRNA; §3.4 Selection of Chemical Modification and Length; §3.7 Melting Temperature Estimation; §Notes, points 2, 4, and 9), Vickers (§Abstract and §Introduction ¶3-4), WO450 (§Abstract, p. 4 L4-7; p. 3 L15-20; p. 15 L30-35; p. 18 L20-35; p. 37 L1-6), Keating (§Abstract, §Methods-Clinical development ¶2; §Results-Safety ¶2, §Results-Efficacy; §Main text ¶2), and Vertex (p. 1 and ¶1). One would have been motivated to modify the compounds of the App908 claims with the teachings of Maruyama, Vickers, WO450, Keating, and Vertex for the benefits of optimizing CF treatment. Therefore the instant claims would have been obvious in view of the App908 claims and Maruyama, Vickers, WO450, Keating, and Vertex.
Claims 1-7 and 10-19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the listed claims of the listed copending Applications in view of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex. This rejection is updated in response to claim amendments.
Application No.
PGP Pub No
Abbreviation
Publication or claims date
Claims
17/911665
US 20230142669
App665
2023-05-11
1, 3, 5-13, 15-17, 19, 21-25
17/598272
US 20220040219
App272
2022-02-10
64-89
18/574025
App025
2023-12-24
1-3, 5, 7-10,12,14-18, 24, 26-27,30-32
Although the claims at issue are not identical, they are directed to overlapping subject matter because the copending claims are directed to compounds and/or methods that can be considered CFTR modifiers, and combination therapies comprising CFTR modifiers are recited in the instant claims.
The copending App665 claims are directed to a method of exon skipping of CFTR exon 24, comprising administering a synthetic ASO wherein the method can comprise further administering a CFTR modifier that is a translational readthrough agent.
The copending App272 Claims 64-89 are directed to a method for treating CF in a subject, comprising administering exon skipping agents that induce skipping of exon 23 wherein the method can include further administering a CFTR modifier that is an amplifier.
The copending App025 claims are directed to synthetic antisense oligos with certain sequences. An artisan might not know what those sequence are so they would look in the Spec. and find (¶10, Fig. 1) the compounds are for modulating splicing.
The instant claims are directed to a method for treating CF in a subject heterozygous for the 3849 +10Kb C-to-T mutation in the CFTR gene, comprising administering to said subject (1) a composition comprising a therapeutically effective amount of a synthetic oligonucleotide consisting of any one of SEQ ID NOs 1 or 40-48; and (2) a composition comprising a CFTR potentiator and a CFTR corrector; wherein the patient can also be heterozygous for an F508del mutation; wherein the ASO can comprise various modifications; wherein the ASO consists of SEQ ID NOs 1 or 40-48; wherein the treating results in various outcomes, and wherein the composition can be administered in various ways or with various potentiators and/or correctors.
All the claim sets are directed to methods of treating CF by administering an agent plus an additional agent that can be a CFTR-splice-modifying agent or a readthrough agent or a CFTR amplifier, so all the claim sets read on each other.
The copending claims don’t recite all the limitations of the instant claims but those are taught in the art and would have been obvious in view of the teachings of: App010 (¶4, ¶39, ¶14, SEQ ID NO 3, ¶108; Example 2, ¶118-119, Fig. 8; ¶21-23 and ¶31, ¶69, ¶21, ¶81, ¶108, ¶3, ¶6-7, ¶107, ¶40, ¶42; Figs. 8-9, ¶50-51, ¶120; ¶68, ¶90-91 and SEQ ID NO 8; ¶109, Table 3-Primer 6; PDF p. 33), App493 (p. 14, PDF p. 21, Table 3; SEQ ID NO 43, ¶6, ¶99, Table 1 on PDF p. 19), Maruyama (§1. Introduction ¶3; §Methods, §3.3 Examine the Secondary Structure of mRNA; §3.4 Selection of Chemical Modification and Length; §3.7 Melting Temperature Estimation; §Notes, points 2, 4, and 9), Vickers (§Abstract and §Introduction ¶3-4), WO450 (§Abstract, p. 4 L4-7; p. 3 L15-20; p. 15 L30-35; p. 18 L20-35; p. 37 L1-6), Keating (§Abstract, §Methods-Clinical development ¶2; §Results-Safety ¶2, §Results-Efficacy; §Main text ¶2), and Vertex (p. 1 and ¶1).
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligos of the copending claims with the teachings of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex for the benefits of improving treatment outcomes by using a combination therapy and optimizing the ASO molecules. One would have been motivated to do so with a reasonable expectation of success because App010 teaches using a combination treatment and teaches the benefits of oligos that that target the C[Wingdings font/0xE0]T mutation. One would have been motivated to do so because the teachings of Maruyama indicate that optimizing ASOs for splice switching is well within the purview of one of ordinary skill in the art. One would have been motivated to do so for the benefits of treating CF on multiple fronts as taught by WO450, Keating, and Vertex. One would have been motivated because all of the copending claim sets recite combination therapies.
Therefore the inventions of the App665, App272, and App025 claims could be used with the invention of App010, App493, Maruyama, Vickers, WO450, Keating, and Vertex, and doing that would have produced the instant claims. Similarly, since the App665, App272, and App025 claims are directed to methods of treating CF that include administering a readthrough agent or amplifier and some claims recite administering an additional readthrough agent or amplifier, and the instant claims are directed to a compound that can be considered readthrough agent or amplifier, the App665, App272, and App025 claims could require the instant claims.
This is a provisional nonstatutory double patenting rejection.
Response to Arguments
Applicant's arguments filed 16 December 2025 have been fully considered but they are not persuasive. Arguments are addressed below. Arguments that are no longer relevant are not addressed.
Objections
There are minor objections to Claims 1 and 16.
112(a) Written description
The rejection of Claims 1-2, 10-12, 16, 6-7, and 17-19 due to lack of adequate WD is maintained. Claims 1 and claims depending therefrom recite methods of treating CF comprising any CFTR potentiator and any CFTR corrector. Applicant’s examples show the additional agents of Trikafta® and Symdeko®. The Spec. indicates (¶76) Trikafta® combines the potentiator ivacaftor and the correctors tezacaftor and elexacaftor, and Symdeko® combines the potentiator ivacaftor and the corrector tezacaftor. However, those examples are not sufficient to provide written description support for any CFTR potentiators/CFTR correctors. Although the claims recite the functional characteristics (i.e., potentiating/correcting), the functional characteristic is not coupled with any known structure.
Applicant’s amendments addressed (and their amendments fixed) the WD problem with the sequences but neither the amendments nor arguments addressed the other aspect of the rejection, the fact that the claims encompass any CFTR potentiator and CFTR corrector.
102
Applicant argues against the 102 rejection because the claims recite ASOs consisting of SEQ ID NOs 1 and 40-48 and App010 doesn’t have those exact sequences in the SEQ Listing. Applicant argues that the teachings in App010 encompass too many sequences so it doesn’t clearly disclose a composition comprising (1) a nt sequence consisting of any of SEQ ID NOs 1 and 40-48, (2) a therapeutically effective amount of a CFTR potentiator, and (3) a therapeutically effective amount of a CFTR corrector.
Those arguments aren’t found persuasive because App010 discloses their invention (¶39):
provides a synthetic polynucleotide molecule, comprising a nucleotide sequence comprising a sequence of at least 20 consecutive nucleotide bases, wherein said synthetic polynucleotide molecule is capable of binding to a pre-mRNA transcript of the CFTR gene, and suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA… In certain embodiments, said nucleotide sequence is complementary to the nucleotide sequence set forth in SEQ ID NO: 3, or to a fragment thereof.
App010 also discloses (¶14) ASOs for exon skipping can be at least 18 nt long. An ASO that is at least 18 nt can be 19- or 20-mer. The claimed SEQ ID NOs have the following lengths: SEQ ID NO 1 is a 20-mer, SEQ ID NOs 40-41 are 19-mer, SEQ ID NOs 42-44 are 18-mer, and SEQ ID NOs 45-48 are 17-mer. That means SEQ ID NOs 1 and 40-44 are within the exact lengths disclosed by App010. Altogether, App010 teaches every aspect of those sequences, even if it uses other words to do so (i.e., the text from ¶39 shown above).
MPEP §2120(III) for anticipation under 35 U.S.C. 102, the reference must teach every aspect of the claimed invention either explicitly or impliedly. Any feature not directly taught must be inherently present.
That is why the 102 rejection is maintained over claims that recite SEQ ID NOs that are 18-mer or longer.
103
The scope of the claims has changed because they now require sequences that consist of specific SEQ ID NOs and different potentiators and correctors, including deuterated ivacaftor and VX-121.
Applicant argues that (pp. 14-16) none of the references specifically describe a method comprising administering nt sequences that consist of SEQ ID NOs 1 or 40-48 and a potentiator and a corrector. Applicant argues that some of the sequences described in App010 and App493 have a different purpose than an ASO which is designed to bind and mask splicing elements and thereby induce skipping. Applicant argues that a skilled artisan wouldn’t use a primer sequence to induce exon skipping.
Those arguments are not found persuasive because an artisan knows that binding between an oligont sequence and its target occurs as a result of base-pairing and they would have known they could reappropriate any oligont sequence that has suitable properties (sequence complementarity to a target, appropriate length) for any purpose. Some of those properties are discussed in Maruyama. Furthermore, App010’s teachings encompass 18- to 20-mer sequences that target a certain region of the CFTR gene, including to induce exon skipping. App493 also teaches that region was of interest because it binds around the 3849 +10kb C[Wingdings font/0xE0]T mutation. Therefore the target in question—both CFTR generally and the specific region on CFTR (around the 3849 +10kb C[Wingdings font/0xE0]T mutation) that the claimed ASOs target—was of known interest to researchers, including (App010) to induce skipping of the 3849 +10kb C[Wingdings font/0xE0]T mutation. Then Maruyama and Vickers teach that it was routine and conventional to use different lengths of ASO that target different specific sites along a target of interest. That indicates it was routine and conventional in the art of ASO design to perform an “oligowalk” along a target. It would have been obvious to try performing an “oligowalk” along a known target (expressly taught by App010 as their SEQ ID NO 3) by producing ASOs of various length and sequence. The art indicates doing so was conventional, obvious to try, and a part of routine optimization. Therefore it would have been obvious to produce ASOs consisting of the instantly claimed sequences.
Regarding the additional CFTR potentiator and CFTR corrector used in the composition, App010 teaches (¶69) it was obvious to use one or more additional drugs to achieve beneficial therapeutic results. WO450 and Keating teach the same. Those references teach using different drugs to remediate different aspects of CF so an artisan would have found it obvious to pair the ASO for inducing skipping of the 3849 +10kb C[Wingdings font/0xE0]T mutation with other compounds to address protein trafficking and ion flow. Therefore Applicant’s arguments that administering nt sequences that consist of SEQ ID NOs 1 or 40-48 and a potentiator and a corrector distinguish the claimed invention from the prior art are not persuasive.
Applicant then argues that App010’s Fig. 9 doesn’t make it clear that a non-claimed CFTR potentiator increases CFTR function. That argument isn’t about the claimed compounds so it’s not relevant to the claims.
Applicant also argues that combining the ASOs that induce skipping of the 3849 +10kb C[Wingdings font/0xE0]T mutation with Trikafta® enhances CFTR activity in subjects having the 3849 +10kb C[Wingdings font/0xE0]T mutation. Applicant shows data demonstrating that the ASO + Trikafta improve CFTR activity. Applicant shows data demonstrating that one of the claimed compounds + ivacaftor doesn’t improve CFTR activity vs. the ASO alone. Applicant argues that those data show using the claimed compounds together with CFTR potentiators and correctors isn’t obvious in view of App010.
Those arguments aren’t found persuasive because an artisan would have expected that using a combination of more CF therapies that address different aspects of the disease would improve CFTR function compared with a single treatment alone or compared with a combination of fewer therapies. The art of WO450 and Keating (addition necessitated by the claim amendments) both teach treating CF using combination therapy. (App010 also teaches combination therapy might be necessary to produce therapeutic benefits.)
WO450 describes different mechanisms of action of various compounds and Keating discusses that they hypothesized using a combination of three treatments (i.e., Trikafta®) would further augment CFTR function. Keating’s data (see Fig. 1C) indicate that it is common to observe similar levels of improvement when two compounds are administered as when a single compound is administered, and that the most significant improvements occur only when Trikafta® is administered. See, e.g., Fig. 1C data for F508 heterozygote. Those data show that they found no significant differences between administering VX-445 alone and administering TEZ and IVA together. Keating’s data show administering Trikafta® resulted in significant differences vs. any combination of fewer drugs.
Those data show differences occur depending on which combination of drugs are administered but that more drugs are better than fewer. Therefore, contrary to Applicant’s arguments that their data demonstrate unexpected results, those data show what an artisan would have expected: two drugs can be fine, but three drugs are better. Furthermore, administering an ASO that addresses a patient’s specific mutation, such as the ASO that would have been obvious in view of App010, App493, Maruyama, and Vickers, would have been expected to provide some level of treatment and adding additional compounds that address different aspects of CF would have been expected to improve treatment beyond that amount. Furthermore, even if the arguments relating to their ASO + Trikafta® were found persuasive, Applicant’s argument don’t address any claims besides those that recite the combination that is Trikafta®. Finally, artisans know that there is individual variation among patients and it would have been obvious to achieve diverse levels of improvement with any combination of drugs depending on the individual.
Therefore the 103 rejections are maintained. To overcome this rejection Applicant should provide data showing that any combination therapies recited in their claims produce improvements beyond that would have been expected based on the prior art. That is, a synergistic effect beyond just additional effects.
NSDP
Applicant states that they will submit terminal disclaimers over App908 and allowed App286. The NSDP rejections will be withdrawn at that time.
Some of the NSDP rejections have been withdrawn since the claims are amended to recite a CFTR potentiator and a CFTR corrector.
Regarding the other NSDP rejections, Applicant argues that App010 and Maruyama don’t teach the ASO sequences consisting of SEQ ID NOs 1 and 40-48. Those arguments aren’t found persuasive as discussed above in §103. First, App010 also discloses (¶14) ASOs for exon skipping can be at least 18 nt long. An ASO that is at least 18 nt can be 19- or 20-mer. The claimed SEQ ID NOs have the following lengths: SEQ ID NO 1 is a 20-mer, SEQ ID NOs 40-41 are 19-mer, SEQ ID NOs 42-44 are 18-mer, and SEQ ID NOs 45-48 are 17-mer. That means SEQ ID NOs 1 and 40-44 are within the exact lengths disclosed by App010. Altogether, App010 teaches every aspect of those sequences, even if it uses other words to do so (i.e., the text from ¶39 shown above). Then, App493 also indicates the same region was of interest. Therefore the target in question—both CFTR generally and the specific region on CFTR the claimed ASOs target—was of known interest to researchers (e.g., App010, App493), including (as discussed in App010) to induce skipping of the 3849 +10kb C[Wingdings font/0xE0]T mutation. Then Maruyama and Vickers teach that it was routine and conventional to use different lengths of ASO that target different specific sites along a target of interest. That indicates it was routine and conventional in the art of ASO design to perform an “oligowalk” along a target. Those references indicate would have been obvious to try performing an “oligowalk” along a known target (expressly taught by App010) by producing ASOs of various length and sequence. The art indicates doing so was conventional, obvious to try, and a part of routine optimization. Therefore it would have been obvious to produce ASOs consisting of the instantly claimed sequences.
Applicant argues that (pp. 18-19) App010 doesn’t teach or suggest oligont consisting of SEQ ID NOs 1 or 40-48 but how can that be the case when App010 teaches sequences that encompass the same region (i.e., SEQ ID NOs 8 and 20) and, more importantly, that (¶39) their invention encompasses a nt sequence comprising a sequence of at least 20 consecutive nt bases wherein said synthetic polynucleotide molecule is capable of binding to a pre-mRNA transcript of the CFTR gene, and suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA and wherein the nt sequence is complementary to their SEQ ID NO 3 or a fragment thereof? App010 also teaches (¶14) their ASOs for exon skipping can be at least 18-mer.
The claimed sequences would have been obvious in view of the cited prior art and it would have been obvious to use any of them along with known CF treatments. Therefore the NSDP rejections are maintained.
Conclusion
Claims 1-7 and 10-19 are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner (Ruth.Arieti@uspto.gov)
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636