DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 38, 41-42, 48-54, 69-71, 74-79, and 83-86 are pending. Claim 71 is withdrawn from consideration as being directed to a nonelected invention.
Status of the Application
Applicant’s response and amendment filed 19 May 2026 are acknowledged and entered.
Applicant has amended Claims 38, 41, 48-54, 74-76, 78, 83-84, and 86. Applicant has cancelled Claims 1-5, 11-13, 15-19, 21-22, 33-34, 38, 39, and 58-62.
Status of the Application
Applicant has submitted replacement Drawings to overcome Objections; most of the objections are withdrawn but the replacement Drawings didn’t include Figs. 6-7, 9, or 13. See §Drawings.
Applicant has amended Claims 38, 76, 83, and 86 to overcome Objections to the claims; most Objections are withdrawn but one is maintained. See §Claim Objections.
Some aspects of the 112(a) rejection are withdrawn but others are maintained.
Most of the 112(b) rejections are withdrawn but one is maintained.
The 112(d) rejections are withdrawn.
The 103 rejections are partly maintained. Note that the heading of the 103 rejection citing 102(a)(2) art contained a typographical error that omitted some of the claims. However, the rejection itself made clear that Claims 74-75, 77, 79, 93, and 85-86 were included in the rejection.
The NSDP rejection is maintained.
Claims 38, 41-42, 48-54, 69-70, 74-79, and 83-86 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Information Disclosure Statement
The IDS has been considered.
Drawings
Applicant submitted replacement Drawings on 19 May 2026. The text says Replacement Drawings for FIGS. 1-16 are submitted herewith. But those Replacement Drawings are missing Figs. 6-7, 9, and 13. The replacement Drawings are objected to for that reason.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Interpretation
Claim 38 recites optionally. Any optional limitations are interpreted as fully optional and not required by the claim. Claims 38 and 74 recite the mRNA comprising… an ITS of SEQ ID NO 10 or SEQ ID NO 11… (Claim 38) and the RNA comprising an ITS of SEQ ID NO 10 or SEQ ID NO 11… (Claim 74). Those claims are interpreted as the ITS requires the entirety of SEQ ID NO 10 or SEQ ID NO 11.
Claims 38, 41, 50, and 53 recite that the sequence comprising pseudouridine or N1-methyl pseudouridine in place of uridine, comprises pseudouridine or N1-methyl pseudouridine in place of uridine, or with uridine substituted with pseudouridine. The claims do not require any particular amount of substitution so as few as a single U being substituted with modified U will meet the claim limitations.
Claim 54 recites about. The term about is interpreted as 90-110 nt because the Spec. discloses (p. 21 full ¶2) the term “about” means ± 10% of an associated numerical value.
Note about References to Spec.
Any reference to ¶# in the Spec. counts the first full ¶ appearing on the page as ¶1.
Claim Objections
Claims 38, 49, 51-53, 74-75, and 86 are objected to because of the following informalities:
Claims 38, 49, 51-53, and 74-75: Any instance of sequence of or nucleotide sequence…of SEQ ID NO [#] in these claims should simply recite: …SEQ ID NO [#]…i
In addition, Claim 38 should recite: …or therapeutic protein, wherein the mRNA optionally comprises…
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 38, 41-42, 48-54, 69-70, 74-79, and 83-86 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. This rejection is maintained and updated in view of the claim amendments. It has also been adjusted to correct a typographical error: what was called Claim 80 should have referred to Claim 83. There was no Claim 80 in the previous claim set and the text of the rejection made clear that Claim 83 was the subject of the rejection.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
Claim 38 recites an mRNA encoding an antigen or therapeutic protein, the mRNA comprising a 5' UTR, an Initial Transcribed Sequence (ITS) of SEQ ID NO: 11, the mRNA further comprising an open reading frame [ORF] encoding the antigen or therapeutic protein….
Those broad claims encompass the large genus of mRNAs that encode any antigen or any therapeutic protein. An mRNA encoding any kind of antigen or therapeutic protein would be encompassed by the claims as instantly presented. As discussed in the 112(b) rejection, what is considered an antigen or a therapeutic protein is a huge number of molecules and a huge number of mRNAs. Like Claim 1, Claim 38 encompasses any 5’UTR which is a huge number of 5’UTRs. Claim 38 recites any ORF which is a huge number of ORFs.
Claim 48 recites the mRNA …wherein the mRNA further comprises a 3' UTR. Claim 77 recites a 3’UTR sequence.
That broad claim encompasses the large genus of 3’UTRs. Any kind of 3’UTR would be encompassed by the claims as instantly presented.
Claim 74 recites an RNA encoding a protein of interest, the RNA comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 11.
That broad claim encompasses the large genus of proteins of interest. Any kind of protein could be considered interesting to someone and therefore would be encompassed by the claims as instantly presented.
Claims 75-76 recite the RNA …followed by the open reading frame encoding said protein of interest. Claim 77 recites any ORF which is a huge number of ORFs.
That broad claim encompasses the large genus of ORFs encoding proteins of interest. Any ORF would be encompassed by the claims as instantly presented.
Claims 79 recites the RNA …wherein the RNA is an mRNA.
That broad claim encompasses the large genus of mRNAs. Any kind of mRNA would be encompassed by the claims as instantly presented.
Claim 83 recites the RNA …wherein the ORF encodes a SARS-CoV-2 spike protein.
That broad claim encompasses the large genus of ORFs encoding a SARS-CoV-2 spike protein. Any mRNA encoding any SARS-CoV-2 spike protein would be encompassed by the claims as instantly presented.
Claims 85-86 recite the RNA …wherein the ORF encodes one or more influenza proteins or wherein the ORF encodes a varicella protein.
That broad claims encompass the large genus of influenza or varicella proteins. Any kind of influenza or varicella proteins would be encompassed by the claims as instantly presented.
The claims are problematic because they recite (or depend from a claim that recites) various elements (e.g., SARS-CoV-2 spike proteins, ORFs, 3’UTRs, 5’UTRs, antigens, therapeutic proteins, proteins of interest, mRNAs, influenza proteins, and varicella proteins) defined solely by their function (i.e., SARS-CoV-2 spike proteins, ORFs, 3’UTRs, 5’UTRs, antigens, therapeutic proteins, proteins of interest, mRNAs) and/or their broad genus (i.e., influenza or varicella proteins, antigens, therapeutic proteins, proteins of interest, mRNAs).
Regarding the agents defined solely by their function (i.e., an mRNA encoding a SARS-CoV-2 spike protein, 5' UTR, an mRNA encoding an antigen or therapeutic protein, the mRNA further comprising an open reading frame [ORF] encoding the antigen or therapeutic protein, a protein of interest, an open reading frame encoding said protein, mRNA, SARS-CoV-2 spike protein, one or more influenza proteins or wherein the ORF encodes a varicella protein), the Spec. discusses the SARS-CoV-2 spike protein on p. 7 ¶1. The Spec. discloses (Table 1, starts on p. 34) the following SEQs for a SARS-CoV-2 spike protein: SEQ ID NO 1 (which is the DNA version of SEQ ID NO 2 which is RNA; SEQ ID NO 6 is an mRNA comprising other components), SEQ ID NO 3 (the DNA version of SEQ ID NO 4 which is RNA; SEQ ID NO 7 is an mRNA comprising other components), SEQ ID NO 5 (the amino acid sequence). The art of Goodsell (2021. Molecule of the Month: SARS-CoV-2 Spike Variants. Protein Data Bank. Available online at pdb101.rcsb.org/motm/264. Accessed on 13 November 2025, “Goodsell”, of record) teaches SARS-CoV-2 is constantly changing, posing new challenges during the COVID19 pandemic. Goodsell teaches (Variant Structures):
During the COVID-19 pandemic, SARS-CoV-2 has spread across the world, and variants have emerged by chance in different countries and rapidly spread from there. Structures of recent variants are … all have multiple changes… mutations in the receptor-binding domain and C-terminal domains can improve recognition and attachment to cells, changes in the N-terminal domain can help evade the immune system, and mutations in the S2 region can enhance the process of fusion and entry into cells.
Goodsell’s teachings indicate that new spike proteins are rapidly emerging and producing sequence and structural changes. The Spec. discloses two sequences for the spike protein but does not demonstrate that Applicant was in possession of the full invention as claimed—RNA/mRNA/ORFs encoding literally any SARS-CoV-2 spike protein variant—at time of filing.
The Spec. describes 5’UTRs and 3’UTRs (p. 8 ¶1-2) and broadly teaches they are sequences and structures that regulate translation. The Spec. discloses one 5’UTR, namely SEQ ID NO 12, and one 3’UTR, namely SEQ ID NO 14.
The Spec. discusses (p. 7 ¶2) antigens and (p. 7 ¶3; p. 15 § starting at ¶2) mRNA. The Spec. teaches the antigen can be an antigen for any given virus which encompasses any viral protein. Regarding RNA, mRNAs, mRNAs encoding therapeutic proteins or proteins of interest, and ORFs, since the claims recite any therapeutic protein or protein of interest and the Spec. discusses that (p. 13 ¶2) the mRNA encodes the protein, the claims encompass any protein in existence. The Spec. discusses (p. 7 ¶2) varicella proteins but discloses no structures for them. The Spec. discusses (p. 17 ¶3) some influenza proteins but discloses no structures for them. The Spec. discloses two mRNAs encoding an antigen that is specifically the SARS-CoV-2 spike protein: SEQ ID NOs 6 and 7. The Spec. discloses (Table 1 p. 34) mRNAs (or partial mRNAs) of eight proteins of interest: HBA, HBG, HSD, NCA-7d, AES, ALB, MOD, and S27a+R3U. Four of those (NCA-7d, AES, MOD, and S27a+R3U) are synthetic and further information isn’t provided. Those disclosures do not demonstrate that Applicant was in possession of the full invention as claimed—RNA/mRNA/ORFs encoding literally any protein—at time of filing.
The limited number of sequences and descriptions of elements defined solely by their function is not sufficient to provide written description support for the broad genera recited in the claims because those elements—in particular, 5’ and 3’UTRs, proteins and the nucleic acids/RNAs/mRNAs/ORFs that encode them—are diverse and comprise diverse structures.
Regarding what structure is encompassed by the broad genera claimed, the Spec. does not provide information describing their features. The Spec. does not disclose what physical structures are responsible for the claimed function.
Applicant’s examples show possession of a limited number of UTRs and nucleic acids/RNAs/mRNAs/ORFs encoding a small number of proteins of interest. However, those examples are not sufficient to provide written description support for each of the broad genera claimed. Although the claims claim the functional characteristics (i.e., 5’ and 3’UTRs, proteins and the nucleic acids/RNAs/mRNAs/ORFs, etc.), the functional characteristics are not coupled with any known structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of being a 5’ or 3’UTR, a protein or a nucleic acid/RNA/mRNA/ORF encoding a spike protein, antigen, therapeutic protein, or protein of interest. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for being a 5’ or 3’UTR, a protein or a nucleic acid/RNA/mRNA/ORF encoding a spike protein, antigen, therapeutic protein, or protein of interest in such a way to demonstrate possession of the full invention as claimed at time of filing. The sequences provided do not share a core structure.
The specification teaches only a few species within the claimed genus/genera (as discussed above) but those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 38, 48-49, 52, 74-79, and 83-86 are rejected for failing to demonstrate possession of the claimed invention. Claims 41-42, 48-54, 69-70, 75-79, and 83-86 are rejected because they depend from Claim(s) 38, 48, 74-75, 77, 79, and/or 83 and do not remedy the issues.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 38, 41-42, 48-54, 69-70, 74-79, 83, and 85-86 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In the present instance, Claim 38 recites an mRNA encoding an antigen or therapeutic protein and Claim 74 recites an RNA encoding a protein of interest. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. The metes and bounds are unclear because what is or is not an antigen, a therapeutic protein, or a protein of interest differs depending on context and the eye of the beholder. The claims do not recite what is the context claimed so an artisan would not know what is or is not considered an antigen, a therapeutic protein, or a protein of interest.
Claims 38 and 74 are rejected for those reasons. Claims 41-42, 48-54, 69-70, 74-79, 83, and 85-86 are rejected because they depend from Claims 38 and/or 74 and do not remedy the issues. In the interest of compact prosecution the claims are broadly interpreted as encompassing literally any antigen and/or protein in existence.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 38, 38, 74, 79, and 85-86 are rejected under 35 U.S.C. 103 as being unpatentable over US Patent Application Publication No. US2018/0171340 (published on 21 June 2018, “App340”) in view of International Publication Number WO 2020/205793 (published on 08 October 2020 but effectively filed on 30 March 2020, “WO793”; of record on IDS) and US Patent Application Publication No. US20200069793 (published on 05 March 2020, “App793”).
The applied WO793 reference has a common applicant and at least one common inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
This rejection is maintained and updated in response to the claim amendments. All references are of record.
App340 teaches nucleic acid molecules for regulating gene expression. App340 teaches (¶3) their nucleic acid molecules are for producing desired products in a subject for conferring beneficial characteristics to the subject. App340 teaches that (¶13) the nucleic acid molecule can be an mRNA or RNA replicon.
Regarding Claims 38 and 74: App340 teaches that (¶11) the coding sequence can encode a polypeptide, a therapeutic polypeptide, or an antigen or immune modulator.
Regarding Claims 38, 48, and 77: App340 teaches that (¶9) the nucleic acid molecules can have a 5’UTR, a coding sequence for a gene of interest, and a 3’UTR.
App340 teaches (¶47) their nucleic acid molecules can be used to formulate a vaccine.
App340 teaches (¶19) the nucleic acid molecule can comprise additional transcription regulatory sequences. App340 teaches (¶190) encoding a molecule of interest in an open reading frame (ORF).
Regarding Claims 49 and 75: App340 teaches (¶299) an example of a plasmid for transcription of an mRNA containing a 5’UTR and 3’UTR and a T7 promoter. App340’s 5’UTR is derived from human β-globin and comprises SEQ ID NO 36. SEQ ID NO 36 is a 59-mer that comprises a segment of 100% identity to claimed SEQ ID NO 12, as shown by the following alignment:
RESULT 17
US-15-831-230-36
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 36, US/15831230
Publication No. US20180171340A1
GENERAL INFORMATION
APPLICANT: SYNTHETIC GENOMICS INC
TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR ENHANCING GENE EXPRESSION
FILE REFERENCE: SGI.012A
CURRENT APPLICATION NUMBER: US/15/831,230
CURRENT FILING DATE: 2017-12-04
PRIOR APPLICATION NUMBER: 62/430,250
PRIOR FILING DATE: 2016-12-05
PRIOR APPLICATION NUMBER: 62/486,361
PRIOR FILING DATE: 2017-04-17
PRIOR APPLICATION NUMBER: 62/587,954
PRIOR FILING DATE: 2017-11-17
NUMBER OF SEQ ID NOS: 52
SEQ ID NO 36
LENGTH: 59
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic polynucleotide
FEATURE:
NAME/KEY: misc_feature
OTHER INFORMATION: 5 human beta globin UTR
Query Match 100.0%; Score 46; Length 59;
Best Local Similarity 73.9%;
Matches 34; Conservative 12; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGA 46
|||:::||::|:||||||||:|:|::|||:|||||||:||||||||
Db 1 ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGA 46
App340 teaches (¶104) producing a self-amplifying RNA replicon can be of benefit in vaccine applications because immune responses can shut down protein production.
App340 does not teach the mRNA comprising an ORF encoding a therapeutic polypeptide or an antigen comprises an initial transcribed sequence comprising SEQ ID NO 10 (i.e., Claims 38 and 74). App340 does not teach the RNA comprising an ORF encoding any protein of interest comprises an ITS sequence that is specifically SEQ ID NO 10 (Claim 74), that the ORF encodes an influenza protein (Claim 85), or the ORF encodes a varicella protein (Claim 86).
However, WO793, drawn to cell-free production of RNA, teaches components that maximize RNA product yield, including (¶141) an ITS comprising SEQ ID NO 17 which is 100% identical to claimed SEQ ID NO 10, as shown by the following alignment:
RESULT 1
BIK83382
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
ID BIK83382 standard; DNA; 15 BP.
XX
AC BIK83382;
XX
DT 26-NOV-2020 (first entry)
XX
DE Synthetic intial transcribed sequence (ITS) SEQ 17.
XX
KW ITS; initial transcribed sequence; rna synthesis; ss.
XX
OS Unidentified.
XX
CC PN WO2020205793-A1.
XX
CC PD 08-OCT-2020.
XX
CC PF 30-MAR-2020; 2020WO-US025824.
XX
PR 29-MAR-2019; 2019US-0826983P.
XX
CC PA (GREE-) GREENLIGHT BIOSCIENCES INC.
CC PA (ZARU/) ZARUR A J.
CC PA (CUNN/) CUNNINGHAM D S.
CC PA (ABSH/) ABSHIRE J R.
CC PA (JAIN/) JAIN R.
CC PA (HUDS/) HUDSON M E.
XX
CC PI Zarur AJ, Cunningham DS, Abshire JR, Jain R, Hudson ME;
XX
DR WPI; 2020-98041B/086.
XX
CC PT Cell-free reaction for synthesizing eukaryotic mRNA by incubating in
CC PT reaction mixture, cellular RNA and enzymes that depolymerize RNA, and
CC PT treating reaction mixture under conditions where RNA depolymerizing
CC PT enzymes are eliminated.
XX
CC PS Disclosure; SEQ ID NO 17; 155pp; English.
XX
CC The present invention relates to a cell-free reaction for synthesizing
CC eukaryotic messenger RNA (mRNA). The method comprises: (1) incubating
CC cellular RNA and one or more enzymes in a reaction mixture to
CC depolymerize RNA, where the resulting first reaction mixture comprises 5'
CC nucleoside monophosphates; (2) treating the reaction mixture under
CC conditions where the RNA depolymerizing enzymes are inactivated; and (3)
CC incubating the reaction mixture comprising nucleoside monophosphates with
CC a second reaction mixture comprising: (i) a polyphosphate kinase (PPK)
CC and a phosphate donor; and optionally (ii) a cytidine monophosphate (CMP)
CC kinase, (iii) a uridine monophosphate (UMP) kinase, (iv) a guanosine
CC monophosphate (GMP) kinase or (v) a nucleoside-diphosphate (NDP) kinase
CC under conditions where nucleotide triphosphates are produced. The
CC reagents and methods enable in vitro production of mRNA at low cost, high
CC efficiency and at a commercially useful scale.
XX
SQ Sequence 15 BP; 5 A; 2 C; 6 G; 2 T; 0 U; 0 Other;
Query Match 100.0%; Score 15; Length 15;
Best Local Similarity 86.7%;
Matches 13; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGGAGACCAGGAAUU 15
|||||||||||||::
Db 1 GGGAGACCAGGAATT 15
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the mRNA vaccine or an mRNA encoding an antigen or therapeutic protein or protein of interest or RNA replicon of App340 with the ITS comprising SEQ ID NO 17 of WO793 for the benefit of increasing RNA product yield. One would have been motivated to do so with a reasonable expectation of success because App340 teaches RNA replicons that can produce antigen for vaccine applications and they would have wanted to add any components to increase mRNA, and therefore protein, yield. Therefore, modifying the mRNA vaccine or an mRNA encoding an antigen or therapeutic protein or protein of interest or RNA replicon of App340 with the ITS of WO793 would have produced all the limitations of Claims 38, 74, and 79.
Regarding Claims 85-86, WO793 teaches (¶241) an example of producing an influenza vaccine by using an ORF encoding an influenza protein.
In addition, App793, drawn to nucleic acid vaccines, teaches (§Abstract) ORFs encoding at least one varicella antigen.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the mRNA vaccine or an mRNA encoding an antigen or therapeutic protein or protein of interest or RNA replicon of App340 and comprising the ITS of WO793 with the mRNA encoding an influenza protein of WO793 or the mRNA encoding a varicella protein of App793 for the benefit of producing mRNA vaccines against flu and varicella. One would have been motivated to do so with a reasonable expectation of success because it would have been a simple matter to swap the RNA encoding an influenza protein of WO793 or the RNA encoding a varicella protein of App793. Therefore, modifying the mRNA vaccine or mRNA encoding an antigen or therapeutic protein or protein of interest or RNA replicon of App340 and comprising the ITS of WO793 with RNA encoding an influenza protein or a varicella protein of WO793 and/or App793 would have produced all the limitations of Claims 85-86.
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Claim(s) 38, 41-42, 48-50, 54, 69-70, 74, 79, 83, and 85-86 are rejected under 35 U.S.C. 103 as being unpatentable over App340, WO793, and app793 as applied to Claims 38, 38, 74, 79, and 85-86 above, and further in view of Nance (and Meier. 06 April 2021. Modifications in an Emergency: The Role of N1-Methylpseudouridine in COVID-19 Vaccines. ACS Cent. Sci 7:748-756, “Nance”). This rejection is maintained and updated in response to the claim amendments. All references are of record.
The teachings of App340, WO793, and App793 as applicable to Claim(s) 38, 74, 79, and 85-86 have been described above.
App340, WO793, and App793 teach an mRNA comprising an ORF encoding an antigen or therapeutic protein, the mRNA comprising a 5’UTR and an ITS comprising SEQ ID NO 10 (Claim 38) and an RNA encoding an ORF encoding a polypeptide of interest, the RNA comprising an ITS comprising SEQ ID NO 10 (Claim 74).
As discussed in the previous 103 rejection, App340 discloses a 5’UTR comprising claimed SEQ ID NO 12 (a limitation of Claims 49 and 75).
App340, WO793, and App793 do not teach the mRNA comprises modified uridine or specifically N1-methylpseudouridine (Claims 41, 50, 53, and optional limitations of Claim 38) or that it encodes a SARS-CoV-2 spike protein (Claim 83). App340, WO793, and App793 do not teach all the elements of an mRNA vaccine including the 5’cap (Claim 42), that the 5’UTR comprises a Kozak sequence (Claims 48 and 75), or that the polyA tail that can be about 100 nt longer (Claim 54 and 78). App340, WO793, and App793 do not teach mRNA is used in a vaccine against SARS-CoV-2 or that the mRNA is encapsulated in a lipid nanoparticle for delivery (Claims 69-70).
However, Nance teaches (§Abstract, §Introduction ¶2) mRNA COVID19 vaccines wherein the antigen is the SARS-CoV-2 spike protein. Nance teaches (§N1-METHYLPSEUDOURIDINE REDUCES MRNA IMMUNOGENICITY ¶1) while a vaccine should stimulate an immune response, overstimulation of immune signaling is known to silence protein translation, with the potential outcome of limiting antigen expression and vaccine efficacy. That indicates that an mRNA vaccine should include components that increase protein translation.
Regarding a 5’UTR (Claims 38, 48) and the 5’Cap (Claim 42), Nance teaches (Fig. 2) design elements in synthetic mRNA therapeutics include a 5’UTR and a 5’-cap.
Regarding the 5’UTR comprising a Kozak sequence (Claims 48), Nance teaches (§PRIMARY STRUCTURE OF THE COVID-19 MRNA VACCINES ¶1 bullet point 2) the 5’UTR comprises an optimized Kozak sequence that helps drive high levels of translation from the correct start codon.
Regarding the 3’UTR (Claim 48) and polyA tail that can be about 100 nt (Claim 54), Nance teaches (Fig. 2) a 3’UTR is a design element in synthetic mRNA therapeutics. Fig. 2 shows a polyA tail that is 110 nt which is about 100 nt.
Regarding the modified uridine (Claims 41, 50, and 54): Nance teaches (§Introduction ¶3) N1-methylpseudouridine can enhance immune evasion and protein production. However, Nance also teaches (§N1-METHYLPSEUDOURIDINE CAN ALTER MRNA TRANSLATION ¶3; Fig. 5) modified uridine, specifically N1-methylpseudouridine, can exert context-dependent effects on translation, sometimes increasing protein production and sometimes reducing it.
Regarding the spike ORF, Nance teaches (Fig. 2) an RNA sequence comprising a spike ORF.
Regarding lipid nanoparticles (LNP) that encapsulate the mRNA and facilitate its delivery (Claim 70), Nance teaches (§Introduction ¶2) those are a component of mRNA vaccines and (§N1-METHYLPSEUDOURIDINE REDUCES MRNA IMMUNOGENICITY) can be delivered to animals.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of App340, WO793, and App793 with those of Nance for the benefit of producing an RNA replicon encoding the SARS-CoV-2 spike protein to use as a vaccine.
Specifically, it would have been obvious to modify the nucleic acid that is an mRNA or self-amplifying RNA replicon and which can comprise a 5’UTR (including specifically App340 SEQ ID NO 36), a 3’UTR, a coding sequence of any antigen or polypeptide of interest, and other regulatory elements with the RNA sequence encoding a spike protein of Nance for the benefit of producing an mRNA vaccine for vaccinating against COVID19 (i.e., SARS-CoV-2). One would have been motivated to do so with a reasonable expectation of success because App340 teaches mRNA molecules and RNA replicons that can be used in vaccine compositions and each other element was known to provide some benefit as discussed above. One would have been motivated to use various sequences known to improve gene expression or protein translation because it was known in the art that RNA vaccines should induce high levels of protein expression. The facts that App340 teaches (¶104) producing an RNA replicon to increase antigen levels and Nance teaches (§N1-METHYLPSEUDOURIDINE REDUCES MRNA IMMUNOGENICITY ¶1) high protein expression is important for an mRNA vaccine indicates that low protein expression was a known impediment to successful mRNA vaccines and an artisan would have been seeking ways to improve protein expression. Including the ITS sequence of WO793—including the specific disclosed sequences that comprise claimed SEQ ID NO 10—would have been a way to produce an RNA replicon that persists and produces ample protein antigen.
An artisan would have modified the mRNA or RNA replicon with the other teachings of Nance because Nance teaches each element of an mRNA vaccine produces a specific benefit (§PRIMARY STRUCTURE OF THE COVID-19 MRNA VACCINES, entire §): the 5’cap helps recruit a ribosome, the 5’UTR and Kozak sequence help drive high levels of translation from the correct start codon, and the 3’UTR and polyA tail help stabilize the RNA.
An artisan would have used any SARS-CoV-2 spike protein–encoding RNA sequence that encodes any SARS-CoV-2 spike protein because using any of them would have been merely a design choice. Alternatively the artisan would have wanted to use different protein sequences or mRNA encoding different protein sequences to make a vaccine for emerging viral strains.
Packaging the mRNA or RNA replicon into an LNP would have been obvious because Nance teaches LNPs were commonly used to deliver mRNA vaccines.
Therefore it would have been obvious to use the teachings of App340, WO793, App793, and Nance in any combination and doing so would have produced all the limitations of Claims 42, 48-49, 54, 69-70, and 83.
Regarding the pseudouridine or N1-methylpseudouridine (m1Ψ) (Claim 50 and optional limitations of Claim 38) or various ITS sequences comprising or lacking modified bases (i.e., Claim 41), an artisan would have been motivated to include modified uridines because Nance teaches (§Introduction ¶3) N1-methylpseudouridine can enhance immune evasion and protein production. One would have been motivated to produce different versions of the same initiation site—with and without modified uridines—because Nance teaches (§Introduction ¶3; §N1-METHYLPSEUDOURIDINE CAN ALTER MRNA TRANSLATION ¶3; Fig. 5) modified uridine can exert context-dependent effects on translation, sometimes increasing protein production and sometimes reducing it, and an artisan would have wanted to test different versions of the mRNA to figure out what works best for any particular application. Therefore the limitations of Claims 41 and 50 and the optional limitations of Claim 38 would have been obvious in view of App340, WO793, App793, and Nance.
The combination of references also makes obvious some limitations of Claims 51-53, 75, 77 (i.e., the Kozak sequence and the N1-Ψ) and Claim78 (i.e., the polyA sequence), as addressed above.
Claim(s) 38, 41-42, 48-51, 54, 69-70, 74-75, 77, 79, 83, and 85-86 are rejected under 35 U.S.C. 103 as being unpatentable over App340, WO793, App793, and Nance as applied to Claims 38, 41-42, 48-50, 54, 69-70, 74, 79, 83, and 85-86 above, and further in view of International Patent Application Publication No. WO 2019/200171 (published 17 October 2019, “WO171”). This rejection is maintained and updated in response to the claim amendments. All references are of record.
The teachings of App340, WO793, App793, and Nance as applicable to Claim(s) 38, 41-42, 48-50, 54, 69-70, 74, 79, 83, and 85-86 have been described above.
App340, WO793, App793, and Nance teach an mRNA vaccine or an mRNA encoding an antigen or therapeutic protein.
App340, WO793, App793, and Nance do not teach the Kozak sequence comprises specifically SEQ ID NO 13 (Claims 51 and 75-77).
However, WO171, drawn to structural modifications for mRNAs, teaches (p. 3 L10-20) mRNAs for therapeutic uses including vaccination. WO171 teaches the Kozak sequence called SEQ ID NO 18 which comprises 100% identity to claimed SEQ ID NO 13 as shown by this alignment:
BGW54157
ID BGW54157 standard; RNA; 6 BP.
XX
AC BGW54157;
XX
DT 12-DEC-2019 (first entry)
XX
DE GC-rich RNA element (EK2) SEQ: 18.
XX
KW gene therapy; nanotechnology; rna detection; ss; therapeutic;
KW translation.
XX
OS Eukaryota.
XX
CC PN WO2019200171-A1.
XX
CC PD 17-OCT-2019.
XX
CC PF 11-APR-2019; 2019WO-US027089.
XX
PR 11-APR-2018; 2018US-0656213P.
PR 07-MAY-2018; 2018US-0667849P.
PR 20-NOV-2018; 2018US-0769739P.
XX
CC PA (MODR ) MODERNATX INC.
XX
CC PI Reid D, Koehrer C, Jain R, Moore MJ, Donovan S, Larsen A;
CC PI Presnyak V;
XX
DR WPI; 2019-865423/84.
XX
CC PT Messenger RNA used in pharmaceutical composition or lipid nanoparticle
CC PT for use in manufacture of medicament, comprises 5'cap, 5 'untranslated
CC PT region, initiation codon, full open reading frame encoding polypeptide.
XX
CC PS Claim 48; SEQ ID NO 18; 291pp; English.
XX
CC The present invention relates to a novel messenger RNA (mRNA) comprising
CC RNA elements, particularly C-rich or CG-rich elements, which provide a
CC desired translational regulatory activity to the mRNA. The mRNA comprises
CC a 5' cap, a 5' untranslated region (UTR), an initiation codon, a full
CC open reading frame (ORF) encoding a polypeptide, and a 3' UTR. The 5' UTR
CC comprises a C-rich RNA element located proximal to the 5' cap. The 5' UTR
CC further comprises a kozak-like sequence upstream of the initiation codon.
CC The invention claims: (a) a pharmaceutical composition comprising the
CC mRNA and a pharmaceutically acceptable carrier; (b) a lipid nanoparticle
CC comprising the mRNA; (c) use of the mRNA, the pharmaceutical composition,
CC or the lipid nanoparticle, in the manufacture of a medicament to inhibit
CC or reduce the amount of polypeptide translated from an ORF within an mRNA
CC other than the full ORF, or to inhibit or reduce the production of
CC aberrant translation products encoded by an mRNA, or to treat a disease
CC characterized by aberrant protein expression, wherein the medicament
CC comprises the mRNA, the pharmaceutical composition, or lipid nanoparticle
CC ; and (d) a method for identifying an RNA element having translational
CC regulatory activity.
XX
SQ Sequence 6 BP; 0 A; 4 C; 2 G; 0 T; 0 U; 0 Other;
ALIGNMENT:
Query Match 100.0%; Score 6; Length 6;
Best Local Similarity 100.0%;
Matches 6; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCCGCC 6
||||||
Db 1 GCCGCC 6
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the mRNA vaccine or an mRNA encoding an antigen or therapeutic protein of App340, WO793, App793, and Nance teach with the Kozak sequence comprising SEQ ID NO 18 of WO171 for the benefit of driving high levels of translation from the correct start codon. One would have been motivated to do so with a reasonable expectation of success because Nance teaches (§PRIMARYSTRUCTURE OF THE COVID-19 MRNA VACCINES) an optimized Kozak sequence helps drive high levels of translation from the correct start codon. Using any Kozak sequence in the invention that would have been obvious in view of App340, WO793, App793, and Nance would have been merely a design choice. It would have been obvious to an artisan to combine the various elements in any combination or order, including the order recited in Claims to optimize expression for any given purpose, including because Nance teaches (Fig. 2) various orders, WO793 teaches (¶141) the ITS is at the 5’end of the 5’UTR, and WO171 teaches (p. 4 L26-31) the 5’UTR is followed by a Kozak sequence which is followed by an ORF which is followed by a 3’UTR. Therefore, the invention of Claim 51, 75, and 77 would have been obvious in view of App340, WO793, App793, Nance, and WO171.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 38, 41-42, 48, 50, 54, 69-70, 74, 79, and 83 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over Claims 57-68 of copending Application No. 17779257 (reference application, “App257”) in view of Nance (and Meier. 06 April 2021. Modifications in an Emergency: The Role of N1-Methylpseudouridine in COVID-19 Vaccines. ACS Cent. Sci 7:748-756, “Nance”). This rejection is maintained and updated in view of the claim amendments.
Although the claims at issue are not identical, they are not patentably distinct from each other because both claim sets are directed to nucleic acids comprising a specific ITS sequence. App257 discloses the ITS sequence of SEQ ID NO 1 and the instant claims recite SEQ ID NOs 10 and 11. Those sequences are identical, as shown by these alignments:
US-17-779-257-1
Filing date in PALM: 2022-05-24
Sequence 1, US/17779257
Publication No. US20220411792A1
GENERAL INFORMATION
APPLICANT: GreenLight Biosciences, Inc.
TITLE OF INVENTION: NUCLEIC ACID COMPOSITIONS
FILE REFERENCE: G0830.70037WO00
CURRENT APPLICATION NUMBER: US/17/779,257
CURRENT FILING DATE: 2022-05-24
PRIOR APPLICATION NUMBER: US 62/944,824
PRIOR FILING DATE: 2019-12-06
NUMBER OF SEQ ID NOS: 49
SEQ ID NO 1
LENGTH: 15
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 100.0%; Score 15; Length 15;
Best Local Similarity 86.7%;
Matches 13; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGGAGACCAGGAAUU 15 SEQ ID NO 10
|||||||||||||::
Db 1 GGGAGACCAGGAATT 15 App257 SEQ ID NO 1
The other App257 claims recite a promoter linked to the ITS and upstream of a sequence encoding a sequence of interest.
The other App257 claims don’t recite the 5’UTR, 5’cap, Kozak sequence, 3’UTR, polyA tail, modified uridines, coding sequence encoding a SARS-CoV-2 spike protein, the amino acid substitutions, the mRNA vaccine, or the LNP of the instant claims, but Nance teaches (§Abstract, §Introduction ¶2-3; §N1-METHYLPSEUDOURIDINE REDUCES MRNA IMMUNOGENICITY ¶1; Figs. 2 and 5; §PRIMARY STRUCTURE OF THE COVID-19 MRNA VACCINES ¶1 bullet point 2; and §N1-METHYLPSEUDOURIDINE CAN ALTER MRNA TRANSLATION ¶3) all the instantly claimed limitations that the App257 claims don’t teach.
It would have been obvious to use the mRNA of Nance with the ITS of the App257 claims in for the benefit of producing a SARS-CoV-2 vaccine. Therefore using the ITS of the App257 claims in the mRNA of Nance would have produced the invention of Claims 38, 41-42, 48, 50, 54, 69-70, 74, 79, and 83.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Sequences Free of Prior Art of Record
The following sequences were searched and found free of the prior art of record:
SEQ ID NO 6, 7, 11, 14, 17
The closest art for SEQ ID NO 11 is SEQ ID NO 38 in International Publication No. WO 2021113774(published 10 June 2021) but that cannot serve as art for the claimed invention because it was published after the filing date of the claimed invention and does not name another inventor.
BJL49074
ID BJL49074 standard; DNA; 15 BP.
XX
AC BJL49074;
XX
DT 22-JUL-2021 (first entry)
XX
DE Initial transcription sequence (ITS) DNA GL-hybrid_A9(A start), SEQ 38.
XX
KW Initial transcription sequence; genetic engineering; ss.
XX
OS Unidentified.
XX
CC PN WO2021113774-A1.
XX
CC PD 10-JUN-2021.
XX
CC PF 04-DEC-2020; 2020WO-US063490.
XX
PR 06-DEC-2019; 2019US-0944824P.
XX
CC PA (GREE-) GREENLIGHT BIOSCIENCES INC.
XX
CC PI Abshire JR, Dhamankar H, Farmer W, Gregg C;
XX
DR WPI; 2021-631054/051.
XX
CC PT Engineered nucleic acid for high-yield and cost-effective production of
CC PT ribonucleic acids, comprises an initial transcription sequence (ITS)
CC PT having the nucleotide sequence.
XX
CC PS Claim 1; SEQ ID NO 38; 85pp; English.
XX
CC The invention relates to a novel engineered nucleic acid, useful for high
CC -yield and cost-effective production of ribonucleic acids. The invention
CC further claims: 1) an engineered nucleic acid comprising an initial
CC transcription sequence (ITS) comprising the nucleotide sequence selected
CC from SEQ ID NO: 1-4, 10-13, and 38-45 (see BJL49037-BJL49040, BJL49046-
CC BJL49049, and BJL49074-BJL49081); and 2) a construct comprising: a first
CC expression cassette comprising a promoter operably linked to an initial
CC transcription sequence (ITS) upstream of a nucleotide sequence encoding a
CC sense strand of a double-stranded RNA (dsRNA); and a second expression
CC cassette comprising a promoter operably linked to an initial
CC transcription sequence (ITS) upstream of a nucleotide sequence encoding
CC an antisense strand of the dsRNA, wherein the sense strand of the dsRNA
CC is complementary to the antisense strand of the dsRNA. The engineered
CC nucleic acid is useful for high-yield and cost-effective production of
CC ribonucleic acids.
XX
SQ Sequence 15 BP; 6 A; 2 C; 5 G; 2 T; 0 U; 0 Other;
Query Match 100.0%; Score 15; Length 15;
Best Local Similarity 86.7%;
Matches 13; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGGAGACCAGGAAUU 15
|||||||||||||::
Db 1 AGGAGACCAGGAATT 15
Claims 52-53, 76, 78, and 84 and/or Claims directed to solely SEQ ID NO 11 are potentially allowable over the prior art of record if all other issues are resolved.
Response to Arguments
Applicant's arguments filed 19 May 2026 have been fully considered but they are not persuasive. Arguments that are no longer relevant are not addressed.
Drawings
Applicant’s replacement drawings sheet says replacement drawings for Figs. 1-16 are submitted but that file lacks Figs. 6-7, 9, and 13.
Objections
Any instance of sequence of or nucleotide sequence…of SEQ ID NO [#] in these claims should simply recite the SEQ ID NO.
112a Written Description (WD)
Applicant argues that independent Claims 38 and 74 recite an RNA or mRNA that comprises an ITS of SEQ ID NO 10 or SEQ ID NO 11 and that other components are well known in the art and described in the application.
That is not found persuasive because the WD rejection explains that the claims are problematic because they recite or depend from a claim that recites elements defined solely by their function and/or broad genus but the Spec. does not disclose what physical structures are responsible for the claimed functions. The rejection explains, in regard to a SARS-CoV-2 spike protein, the art of Goodsell teaches new spike proteins are rapidly emerging and those evolved spike proteins comprise structural changes. The Spec. doesn’t disclose any structure that is requisite for a SARS-CoV-2 spike protein. The rejection explains that the Spec. does not demonstrate that Applicant was in possession of the full invention as claimed—RNA/mRNA/ORFs encoding literally any protein—at time of filing and that the limited number of sequences and descriptions of elements defined solely by their function is not sufficient to provide written description support for the broad genera recited in the claims because those elements—in particular, 5’ and 3’UTRs, proteins and the nucleic acids/RNAs/mRNAs/ORFs that encode them—are diverse and comprise diverse structures. The rejection explains that although the claims recite functional characteristics, the functional characteristics are not coupled with any known structure that is necessary for performing the claimed function. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims. The WD rejection is maintained for those reasons.
112b
Applicant argues that the terms antigen, therapeutic protein, and protein of interest are broad but not indefinite. That isn’t found persuasive because, as discussed in the rejection, what is or is not an antigen, a therapeutic protein, or a protein of interest differs depending on context and the eye of the beholder. An artisan would not know what is or is not considered an antigen, a therapeutic protein, or a protein of interest because what is an antigen, a therapeutic protein, or a protein of interest to one person is not an antigen, a therapeutic protein, or a protein of interest to any person. For example, some people have allergies to peanuts; peanut is an antigen for those individuals but not for any individual. Factor VIII would be therapeutic for an individual with hemophilia A but could cause excess clotting for an individual who produces their own functional Factor VIII. What is of interest to one person is not necessarily of interest to another person. Therefore what is an antigen, therapeutic protein, or protein of interest varies and the metes and bounds of each term are indefinite.
103
Note that the heading of the 103 rejection citing 102(a)(2) art contained a typographical error that omitted some of the claims. However, the rejection itself made clear that Claims 74-75, 77, 79, 93, and 85-86 were included in the rejection.
The 103 rejection is maintained because although the rejection stated:
the applied reference has a common applicant and at least one common inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2),
the arguments didn’t overcome the rejection by presenting: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
The 103 rejection explains that WO793 (the 102[a][2] art) discloses components that maximize RNA product yield, including SEQ ID NO 17 which is identical to claimed SEQ ID NO 10, and it would have been obvious to modify the mRNA and teachings of the other references with the ITS comprising WO793’s SEQ ID NO 17 for the benefit of increasing RNA product yield and one would have been motivated to do so with a reasonable expectation of success because it was routine in the art to add components to increase mRNA (and, therefore, protein) yield. The rejection also explains that WO793 and App793 teach ORFs encoding an influenza protein or a varicella antigen. The 103 rejection is maintained for those reasons.
NSDP
Applicant argues that the NSDP rejection is moot because some of the claims of the reference application have been cancelled. That is not found persuasive because the remaining claims have been modified to require subject matter from the cancelled claims, namely App257’s SEQ ID NO 1.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights