DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
NOTE: the examiner for this application has changed. Please address all future correspondence to Examiner Ruthie Arieti, AU1635.
Claims 1-5, 11-13, 15-19, 21-22, 33-34, 38-42, 48-54, 58-62, 69-71, 74-79, and 83-86 are pending.
Election/Restrictions
Applicant’s election without traverse of the invention of Group I (drawn to an mRNA encoding a SARS-CoV-2 spike protein, or an mRNA encoding an antigen, therapeutic protein, or protein of interest) and the species SEQ ID NO 11 in the reply filed on 13 October 2025 is acknowledged.
Claims 22, 34, 58-62, and 71 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 13 October 2025.
Applicant's election with traverse of the species the L5F mutation, SEQ ID NO 2, and SEQ ID NO 6 in the reply filed on 13 October 2025 is acknowledged. The traversal is on the ground(s) that the Office Action does not establish that these elements are critical to patentability because the Examiner has not provided any reasoning or evidence demonstrating that selected spike protein amino acid substitution, open reading frame, or the mRNA sequence encoding SARS-Co V2 spike protein is essential to the claimed invention and because Applicant respectfully submits that a search and examination of the claimed subject matter without regard to the encoded protein is not undue. This is not found persuasive because whether or not an element is critical to patentability is irrelevant to a requirement for species election; the requirement for species election is that the species are patentably distinct. MPEP §806. Note that one amino acid substitution does not automatically make obvious a different amino acid substitution. Note that SEQ ID NOs 2 and 4 do not encode the same sequence. Note that SEQ ID NOs 6 and 7 do not encode the same sequence.
Regarding the asserted lack of search burden, Examiner are the ones who perform the search so they are positioned to determine what is a search burden. The Examiner who restricted determined that searching for all the recited species is indeed a search burden.
In addition to SEQ ID NO 11, SEQ ID NO 10 was searched. The specific amino acid substitutions K986P and V987P were found searchable. Therefore the requirement for restriction of species between SEQ ID NOs 10 and 11 and over those specific AA substitutions are withdrawn but all other requirements for species election, including the other species in Claim 19, are maintained.
The requirement is still deemed proper and is therefore made FINAL.
Claims 22, 34, 58-62, and 71 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 13 October 2025.
Claims 1-5, 11-13, 15-19, 21, 33, 38-42, 48-54, 69-70, 74-79, and 83-86 are examined.
Information Disclosure Statement
The IDS has been considered.
The Spec. cites references.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings are objected to because of the following informalities:
The patent or application file contains at least one drawing executed in color. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). See below for those instructions. Figs. 1-5 and 8-16 have color.
Figs. 2A, 5B: The text (including text along the x- and y-axes) is fuzzy and unreadable.
Figs. 2B,2C; 3C: the text is fuzzy.
Fig. 3B: the text is fuzzy.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Instructions for color Drawings
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
Claim Interpretation
Claims 1-5, 11-13, 15-19, 21, 33, 38-42, 48-54, and 69-70 recite or depend from a claim(s) that recite optionally. Any optional limitations are interpreted as fully optional and not required by the claim.
Claims 4, 13, 15, 41, 50, and 53 recite that the sequence comprises modified uridine or with uridine substituted with modified uridine. The claims do not require any particular amount of substitution so as few as a single U being substituted with modified U will meet the claim limitations.
Claim 12 recites …comprises the nt sequence substantially of SEQ ID NO 12…. The phrasing substantially of is not a common grammatical construction. It is interpreted to mean the nt sequence is substantially identical to SEQ ID NO 12. Claim 21 recites …has a nt sequence substantially corresponding to SEQ ID NO 2…. The phrasing substantially corresponding to is not a common grammatical construction. It is interpreted to mean the nt sequence is substantially identical or complementary to SEQ ID NO 2. Claims 15-16 and 52 recite …substantially comprises the nt sequence of SEQ ID NO [#]. The phrasing substantially comprises is interpreted to mean mostly comprises the nt sequence of SEQ ID NO [#]. In all cases, substantially is interpreted to mean mostly, as in >50%.
Claim 17 recites about. The term about is interpreted as 90-110 nt because the Spec. discloses (p. 21 full ¶2) the term “about” means ± 10% of an associated numerical value.
Note about References to Spec.
Any reference to ¶# in the Spec. counts the first full ¶ appearing on the page as ¶1.
Claim Objections
Claims 1-2, 12-13, 15-16, 18, 38, 49, 51-53, 74-75, and 86 are objected to because of the following informalities:
Claim 1 recites …the mRNA comprising a 5'UTR comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9… but for clarity the claim should recite …the mRNA comprising a 5' UTR comprising an Initial Transcribed Sequence (ITS) having SEQ ID NO: 8 or SEQ ID NO: 9….
Claims 2 and 39 should include a comma: …wherein the ITS comprises SEQ ID NO 10 or SEQ ID NO 11, or at least 8….
Claims 12-13, 15-16, 18, 38, 49, 51-53, and 74-75: Any instance of the sequence or the nucleotide sequence…of SEQ ID NO [#] in these claims should simply recite: …SEQ ID NO [#]…
Claim 38 recites: an mRNA encoding an antigen or therapeutic protein, the mRNA comprising a 5' UTR, comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 11, the mRNA further comprising an open reading frame encoding the antigen or therapeutic protein, optionally comprising one or more modified nucleobases. The claim should delete the mRNA further and should instead recite: an mRNA encoding an antigen or therapeutic protein, the mRNA comprising a 5' UTR, comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 11, comprising an open reading frame encoding the antigen or therapeutic protein, and optionally comprising one or more modified nucleobases.
Claim 76 should be reworded because it can be altered, as appropriate, to: The RNA of Claim 75, wherein SEQ ID NO 13 is followed by a sequence comprising SEQ ID NO 17, which is followed by the open reading frame encoding said protein.
Claim 83 should delete the superfluous of any of and should simply recite: the RNA of Claim 74…
Claim 86 should make protein singular: …encodes a varicella protein [singular].
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-5, 11-13, 15-19, 21, 33, 38-42, 48-54, 69-70, 74-79, and 83-86 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
Claim 1 recites an mRNA encoding a SARS-CoV-2 spike protein, the mRNA comprising a 5' UTR comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9…
That broad claim encompasses the large genus of mRNAs encoding a SARS-CoV-2 spike protein and 5’UTRs. Any mRNA encoding any SARS-CoV-2 spike protein and any 5’UTR would be encompassed by the claims as instantly presented.
Claim 38 recites an mRNA encoding an antigen or therapeutic protein, the mRNA comprising a 5' UTR, comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 11, the mRNA further comprising an open reading frame [ORF] encoding the antigen or therapeutic protein…. Claim 39 recites the mRNA of claim 38, wherein the ITS comprises SEQ ID NO: 11 or at least 8, or at least 10, or at least 12 consecutive nucleotides of SEQ ID NO: 11.
Those broad claims encompass the large genus of mRNAs that encode any antigen or any therapeutic protein. An mRNA encoding any kind of antigen or therapeutic protein would be encompassed by the claims as instantly presented. As discussed in the 112(b) rejection, what is considered an antigen or a therapeutic protein is a huge number of molecules and a huge number of mRNAs. Like Claim 1, Claim 38 encompasses any 5’UTR which is a huge number of 5’UTRs. Claim 38 recites any ORF which is a huge number of ORFs. Claim 39 recites sequences wherein the ITS comprises at least 8, 10, or 12 consecutive nt of SEQ ID NO 11. SEQ ID NO 11 is 15-mer and the ITS sequences, SEQ ID NOs 8 and 9, are 6-mer. Claim 39 requires only 8, 10, or 12 nt of SEQ ID NO 11 and Applicant has not described whether or not the 7 nt of SEQ ID NO 11 that do not comprise SEQ ID NO 9 comprise an ITS.
Claims 11 and 48 recite the mRNA …wherein the mRNA further comprises a 3' UTR and optionally a PolyA tract. Claim 77 recites a 3’UTR sequence.
That broad claim encompasses the large genus of 3’UTRs. Any kind of 3’UTR would be encompassed by the claims as instantly presented.
Claims 12 and 49 recite the mRNA …wherein the 5'UTR further comprises the nucleotide sequence substantially of SEQ ID NO: 12 or a derivative thereof.
That broad claim encompasses the large genus of 5’UTR sequences that comprise a nucleotide (nt) sequence substantially of SEQ ID NO 12 or a derivative thereof. Since the Spec. never defines what is substantially of SEQ ID NO 12, that recitation is interpreted as a nucleotide sequence substantially identical to SEQ ID NO 12. Still, what is considered substantially identical to SEQ ID NO 12 encompasses a huge number of sequences. Applicant has not identified any minimum sequence wherein the sequence can be considered substantially of or substantially identical to SEQ ID NO 12. And the claim is even broader than that because it also recites any derivative of a nt sequences substantially of SEQ ID NO 12. Any kind of sequence comprising as little as about 40% identity/complementarity to SEQ ID NO 12 would be encompassed by Claim 12 as instantly presented. Any kind of sequence comprising about 80% identity/complementarity to SEQ ID NO 12 would be encompassed by Claim 49 as instantly presented. (See above §Claim interpretation and below §112[b].)
Claims 15 and 52 recite the mRNA …wherein the 3' UTR substantially comprises the nucleotide sequence of SEQ ID NO: 14 or the 3' UTR substantially comprises the nucleotide sequence of SEQ ID NO: 14 a derivative thereof.
Similar to the claims to a nt sequence substantially of SEQ ID NO 12, the broad claims 15 and 52 encompass the large genus of 3’UTR sequences that are substantially identical to SEQ ID NO 14. But what is considered substantially identical to SEQ ID NO 14 encompasses a huge number of sequences. Applicant has not identified any minimum sequence wherein the sequence can be considered substantially of or substantially identical to SEQ ID NO 14. And the claim is even broader than that because it also recites any derivative of a nt sequences substantially of SEQ ID NO 14. Any kind of sequence comprising about 40% identity to SEQ ID NO 14 would be encompassed by Claim 12 as instantly presented. Any kind of sequence comprising >50% identity to SEQ ID NO 14 would be encompassed by Claim 52 as instantly presented. (See above §Claim interpretation and below §112[b].)
Claim 16 recites the mRNA … wherein the 3' UTR substantially comprises the nucleotide sequence of SEQ ID NO: 15.
That broad claim encompasses the large genus of3’UTR sequences that are substantially identical to SEQ ID NO 15. But what is considered substantially identical to SEQ ID NO 15 encompasses a huge number of sequences. Applicant has not identified any minimum sequence wherein the sequence can be considered substantially of or substantially identical to SEQ ID NO 15. Any kind of sequence comprising >50% identity to SEQ ID NO 15 would be encompassed by the claims as instantly presented. (See above §Claim interpretation and below §112[b].)
Claim 21 recites the mRNA …wherein the spike protein open reading frame has a nucleotide sequence substantially corresponding to SEQ ID NO: 2.
That broad claim encompasses the large genus of sequences that substantially correspon[d] to SEQ ID NO 2. What is encompassed by the language “substantially corresponding to” is inadequately described. Any kind of sequence that comprises >50% identity to SEQ ID NO 2 could be interpreted to be encompassed by the claims as instantly presented. (See above §Claim interpretation and below §112[b].) In addition, Claim 21 recites that the ORF has a nt sequence substantially corresponding to SEQ ID NO 2 which includes sequences as short as 2-mer that “correspond” to any portion of SEQ ID NO 2.
Claim 74 recites an RNA encoding a protein of interest, the RNA comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 11.
That broad claim encompasses the large genus of proteins of interest. Any kind of protein could be considered interesting to someone and therefore would be encompassed by the claims as instantly presented.
Claims 75-76 recite the RNA …followed by an open reading frame encoding said protein. Claim 77 recites any ORF which is a huge number of ORFs.
That broad claim encompasses the large genus of ORFs encoding proteins of interest. Any ORF would be encompassed by the claims as instantly presented.
Claims 79 recites the RNA …wherein the RNA is an mRNA.
That broad claim encompasses the large genus of mRNAs. Any kind of mRNA would be encompassed by the claims as instantly presented.
Claim 80 recites the RNA …wherein the ORF encodes a SARS-CoV-2 spike protein.
That broad claim encompasses the large genus of ORFs encoding a SARS-CoV-2 spike protein. Any mRNA encoding any SARS-CoV-2 spike protein would be encompassed by the claims as instantly presented.
Claims 85-86 recite the RNA …wherein the ORF encodes one or more influenza proteins or wherein the ORF encodes a varicella protein.
That broad claims encompass the large genus of influenza or varicella proteins. Any kind of influenza or varicella proteins would be encompassed by the claims as instantly presented.
The claims are problematic because they recite (or depend from a claim that recites) various elements (e.g., SARS-CoV-2 spike proteins, ORFs, 3’UTRs, 5’UTRs, antigens, therapeutic proteins, proteins of interest, mRNAs, influenza proteins, and varicella proteins) defined solely by their function (i.e., SARS-CoV-2 spike proteins, ORFs, 3’UTRs, 5’UTRs, antigens, therapeutic proteins, proteins of interest, mRNAs) and/or their broad genus (i.e., influenza or varicella proteins, antigens, therapeutic proteins, proteins of interest, mRNAs).
Regarding the agents defined solely by their function (i.e., an mRNA encoding a SARS-CoV-2 spike protein, 5' UTR, an mRNA encoding an antigen or therapeutic protein, the mRNA further comprising an open reading frame [ORF] encoding the antigen or therapeutic protein, a protein of interest, an open reading frame encoding said protein, mRNA, SARS-CoV-2 spike protein, one or more influenza proteins or wherein the ORF encodes a varicella protein), the Spec. discusses the SARS-CoV-2 spike protein on p. 7 ¶1. The Spec. discloses (Table 1, starts on p. 34) the following SEQs for a SARS-CoV-2 spike protein: SEQ ID NO 1 (which is the DNA version of SEQ ID NO 2 which is RNA; SEQ ID NO 6 is an mRNA comprising other components), SEQ ID NO 3 (the DNA version of SEQ ID NO 4 which is RNA; SEQ ID NO 7 is an mRNA comprising other components), SEQ ID NO 5 (the amino acid sequence). The art of Goodsell (2021. Molecule of the Month: SARS-CoV-2 Spike Variants. Protein Data Bank. Available online at pdb101.rcsb.org/motm/264. Accessed on 13 November 2025, “Goodsell”) teaches SARS-CoV-2 is constantly changing, posing new challenges during the COVID19 pandemic. Goodsell teaches (Variant Structures):
During the COVID-19 pandemic, SARS-CoV-2 has spread across the world, and variants have emerged by chance in different countries and rapidly spread from there. Structures of recent variants are … all have multiple changes… mutations in the receptor-binding domain and C-terminal domains can improve recognition and attachment to cells, changes in the N-terminal domain can help evade the immune system, and mutations in the S2 region can enhance the process of fusion and entry into cells.
Goodsell’s teachings indicate that new spike proteins are rapidly emerging and producing sequence and structural changes. The Spec. discloses two sequences for the spike protein but does not demonstrate that Applicant was in possession of the full invention as claimed—RNA/mRNA/ORFs encoding literally any SARS-CoV-2 spike protein variant—at time of filing.
The Spec. describes 5’UTRs and 3’UTRs (p. 8¶1-2) and broadly teaches they are sequences and structures that regulate translation. The Spec. discloses one 5’UTR, namely SEQ ID NO 12, and one 3’UTR, namely SEQ ID NO 14.
The Spec. discusses (p. 7 ¶2) antigens and (p. 7 ¶3; p. 15 § starting at ¶2) mRNA. The Spec. teaches the antigen can be an antigen for any given virus which encompasses any viral protein. Regarding RNA, mRNAs, mRNAs encoding therapeutic proteins or proteins of interest, and ORFs, since the claims recite any therapeutic protein or protein of interest and discusses that (p. 13 ¶2) the mRNA encodes the protein, the claims encompass any protein in existence. The Spec. discusses (p. 7 ¶2) varicella proteins but discloses no structures for them. The Spec. discusses (p. 17 ¶3) some influenza proteins but discloses no structures for them. The Spec. discloses two mRNAs encoding an antigen that is specifically the SARS-CoV-2 spike protein: SEQ ID NOs 6 and 7. The Spec. discloses (Table 1 p. 34) mRNAs (or partial mRNAs) of eight proteins of interest: HBA, HBG, HSD, NCA-7d, AES, ALB, MOD, and S27a+R3U. Four of those (NCA-7d, AES, MOD, and S27a+R3U) are synthetic and further information isn’t provided. Those disclosures do not demonstrate that Applicant was in possession of the full invention as claimed—RNA/mRNA/ORFs encoding literally any protein—at time of filing.
The limited number of sequences and descriptions of elements defined solely by their function is not sufficient to provide written description support for the broad genera recited in the claims because those elements—in particular, 5’ and 3’UTRs, proteins and the nucleic acids/RNAs/mRNAs/ORFs that encode them—are diverse and comprise diverse structures.
Regarding what structure is encompassed by the broad genera claimed, the Spec. does not provide information describing their features. The Spec. does not disclose what physical structures are responsible for the claimed function.
Applicant’s examples show possession of a limited number of UTRs and nucleic acids/RNAs/mRNAs/ORFs encoding a small number of proteins of interest. However, those examples are not sufficient to provide written description support for each of the broad genera claimed. Although the claims claim the functional characteristics (i.e., 5’ and 3’UTRs, proteins and the nucleic acids/RNAs/mRNAs/ORFs, etc.), the functional characteristics are not coupled with any known structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of being a 5’ or 3’UTR, a protein or a nucleic acid/RNA/mRNA/ORF encoding a spike protein, antigen, therapeutic protein, or protein of interest. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for being a 5’ or 3’UTR, a protein or a nucleic acid/RNA/mRNA/ORF encoding a spike protein, antigen, therapeutic protein, or protein of interest in such a way to demonstrate possession of the full invention as claimed at time of filing. The sequences provided do not share a core structure.
The specification teaches only a few species within the claimed genus/genera (as discussed above) but those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims.
The claims reciting substantially of SEQ ID NO [#], a derivative of SEQ ID NO [#], substantially comprises the nt sequence of SEQ ID NO [#], and substantially corresponding to SEQ ID NO [#] are problematic because they recite broad genera of sequences, some of whose functions are explicitly recited, but the Spec. does not describe (1) any required structure that must be part of the sequence or (2) the part of the sequence that is required for the recited function. The Spec. never discloses what is considered substantially corresponding to, substantially of, substantially comprising, a derivative of a SEQ ID NO, or a derivative of a sequence that is “substantial” (i.e., mostly identical/complementary) to a SEQ ID NO. As discussed above in §Claim interpretation, “substantially” is not defined in the Spec. so it’s interpreted under its plain meaning which is “mostly” which is >50%. A sequence that is mostly identical to a sequence could reasonably be interpreted to comprise:
Any number of the nts removed from the SEQ ID NO as long as the number removed is ≤50%;
a single chunk of the nts different from the SEQ ID NO as long as the number different is ≤50%;
every 10th, every 5th, or many other positions of nt (starting at any position) different from the SEQ ID NO, as long as >50% of the nt are present in the resulting sequence;
every 10th, every 5th, or many other positions of nt (starting at any position) removed from the SEQ ID NO, as long as the number removed is ≤50%;
any other combination of nts mutated or removed as long as the number mutated or removed is ≤50% or as long as >50% of the original nt sequence is present in the resulting sequence.
As discussed in the 112(b) rejection below, what is considered substantially corresponding to, substantially of, or substantially comprising a SEQ ID NO can vary from person to person but the term is being interpreted as its plain meaning of “mostly”. Derivatives of those “substantially corresponding” sequences have even less in common with the claimed SEQ ID NO. Each of those categories comprises a broad subgenus with diverse members and different structures that affect their functions. Some of those structures may have altered UTR activity or other altered function(s). Regarding SEQ ID NO 2, some of the altered sequences may no longer encode a spike protein.
The Spec. describes only a limited number of sequences, namely the SEQ ID NOs themselves. The Spec. doesn’t show or discuss any sequence variants or derivatives. The Spec. does not describe any structure that must be preserved of the claimed SEQ ID NOs and the claims allow for a tremendous amount of variation. Nor does the Spec. describe how an artisan would determine which portions of the SEQ ID NO to preserve.
Regarding what structure is encompassed by the 5’UTR derived from or >50% identical to SEQ ID NO 12, the 3’UTR derived from or >50% identical to SEQ ID NOs 14 or 15, or the spike protein ORFs or >50% identical to SEQ ID NO 2, the Spec. does not provide information describing any requisite portion of the sequence or any requisite features. In each case the Spec. does not disclose what physical structure is responsible for the claimed function.
Applicant’s examples show only the sequences themselves, fail to couple the claimed functional characteristic with any known structure, and the Spec. does not identify a core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for necessary for performing the claimed function(s) in such a way to demonstrate possession of the full invention as claimed at time of filing. The specification teaches only the SEQ ID NOs themselves but those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 1, 11-12, 15-16, 21, 38, 48-49, 52, 74-79, and 83-86 are rejected for failing to demonstrate possession of the claimed invention. Claims 2-5, 11-13, 15-19, 21, 33, 39-42, 48-54, 69-70, 75-79, and 83-86 are rejected because they depend from Claim(s) 1, 11-12, 15-16, 38, 48, 74-75, 77, 79, and/or 83 and do not remedy the issues.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2, 4, 12-13, 15-16, 21, 38-42, 48-54, 69-70, 74-79, 83, and 85-86 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claim 2 recites: An mRNA encoding a SARS-CoV-2 spike protein, the mRNA comprising a 5' UTR comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9, optionally comprising one or more modified nucleobases, wherein the ITS comprises SEQ ID NO: 10 or SEQ ID NO: 11 or at least 8, or at least 10, or at least 12 consecutive nucleotides of SEQ ID NO: 10 or SEQ ID NO: 11, optionally comprising one or more modified bases. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. Claim 1 requires that the mRNA comprises an ITS comprising either SEQ ID NO 8 or SEQ ID NO 9 and Claim 2 requires that the ITS comprises SEQ ID NO 11 or at least 8 nt of SEQ ID NO 11. SEQ ID NO 11 does not comprise SEQ ID NO 8. Therefore if SEQ ID NO 8 is selected for Claim 1, Claim 2 is indefinite because it requires SEQ ID NO 11 comprising SEQ ID NO 8 which is not possible.
Claim 2 is rejected for those reasons. In the interest of compact prosecution Claim 2 is interpreted as: An mRNA encoding a SARS-CoV-2 spike protein, the mRNA comprising a 5' UTR comprising an Initial Transcribed Sequence (ITS) that is SEQ ID NO: 9, optionally comprising one or more modified nucleobases, wherein the ITS comprises SEQ ID NO: 11 or at least 8, or at least 10, or at least 12 consecutive nucleotides of SEQ ID NO: 11.
In the present instance, Claims 12, 15-16, 21, 49, and 52 recite …the nucleotide sequence substantially of SEQ ID NO 12 or a derivative thereof (Claim 12); …3’UTR substantially comprises the nucleotide sequence of SEQ ID NO 14 or a derivative thereof… (Claim 15); …wherein the 3’UTR substantially comprises the nucleotide sequence of SEQ ID NO 15 (Claim 16); …has a nucleotide sequence substantially corresponding to… (Claim 21); …SEQ ID NO 12 or a derivative thereof (Claim 49); and …substantially comprises the nucleotide sequence of SEQ ID NO 14 (Claim 52). The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. What is a sequence that is substantially of, or a derivative of a sequence substantially of; or a sequence that substantially comprises or substantially corresponds to a certain SEQ ID NO, or a sequence that is a derivative of a certain SEQ ID NO has no set definition and what is considered each of those limitations can vary depending on the eye of the beholder.
Claims 12, 15-16, 21, 49, and 52 are rejected for those reasons. Claims 13 and 16 are rejected because they depend from Claims 12 and/or 15 and do not remedy the issues.
The phrasing substantially of in Claim 12 is not a common grammatical construction. It is interpreted to mean the nt sequence is substantially identical to SEQ ID NO 12. The phrasing substantially corresponding to in Claim 21 is not a common grammatical construction. It is interpreted to mean the nt sequence is substantially identical or complementary to SEQ ID NO 2. The phrasing substantially comprises in Claims 15-16 and 52 is interpreted to mean mostly comprises the nt sequence of SEQ ID NO [#]. In all cases, substantially is interpreted to mean mostly, as in >50%. Regarding Claims 12, 15, and 49, all cases a derivative of a sequence or a derivative of a >50% identical/complementary sequence is interpreted as meaning the derivative has up to 22% difference to the >50% identical/complementary sequence. That interpretation is based on the Spec. (p. 13 ¶2) which discusses that a derivative of a sequence can have up to about 20% of nt substituted (up to about 20% = 22% because the Spec. defines about as ±10%). Therefore sequences as little as about 40% identical/complementary to the recited sequence read on Claims 12 and 15. Sequences about 80% identical/complementary to the recited sequence read on Claim 49.
In the present instance, Claim 38 recites an mRNA encoding an antigen or therapeutic protein and Claim 74 recites an RNA encoding a protein of interest. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. The metes and bounds are unclear because what is or is not an antigen, a therapeutic protein, or a protein of interest differs depending on context and the eye of the beholder. The claims do not recite what is the context claimed so an artisan would not know what is or is not considered an antigen, a therapeutic protein, or a protein of interest.
Claims 38 and 74 are rejected for those reasons. Claims 39-42, 48-54, 69-70, 74-79, 83, and 85-86 are rejected because they depend from Claims 38 and/or 74 and do not remedy the issues. In the interest of compact prosecution the claims are broadly interpreted as encompassing literally any antigen and/or protein in existence.
Regarding Claims 4, 13, 15-16, 41, 50, and 53, the phrases "wherein the ITS comprises a modified uridine which is optionally pseudouridine or N1-methyl-pseudouridine" (Claims 4 and 41), “…with uridine substituted with modified uridine, where the modified uridine is optionally pseudouridine or N1-methyl-pseudouridine” (Claims 13, 15, 50, and 53) renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d). That language (bold/underlined) is exemplary language so it is unclear whether the limitation(s) following the phrase are part of the claimed invention.
Claims 4, 13, 15, 41, 50, and 53 are rejected for those reasons. Claim 16 is rejected because it depends from Claim 15 and doesn’t remedy the issues. he In the interest of compact prosecution those claims are interpreted as requiring any modified uridine.
Claim 21 recites the limitation "the spike protein open reading frame has a nucleotide sequence substantially corresponding to SEQ ID NO 2" in L1-2. There is insufficient antecedent basis for this limitation in the claim because Claim 21 depends from Claim 18 which recites a spike protein but no spike protein open reading frame. In turn, Claim 18 depends from Claim 1 which also recites no spike protein open reading frame.
Furthermore, the metes and bounds of the claims are unclear because Claim 18 requires that the spike protein has a specific AA sequence (namely SEQ ID NO 5) but then Claim 21 recites that the spike protein open reading frame has a nt sequence substantially corresponding to SEQ ID NO 2, indicating that the nt sequence can be different which indicates it does not necessarily encode the exact AA sequence of Claim 18. As discussed above, what is substantially corresponding is indefinite. Since Claim 21 allows for more variation and Claim 18 requires a specific sequence, those two features contradict and the claim is indefinite.
In the interest of compact prosecution Claim 21 is interpreted as if it depends from Claim 1 and recites: The mRNA of Claim 1, wherein the mRNA comprises an open reading frame encoding the spike protein, wherein the open reading frame encoding the spike protein comprises at least 50% identity to SEQ ID NO 2.
Claims 83 and 85-86 recite the limitation "the open reading frame" in L1-2. There is insufficient antecedent basis for this limitation in the claim because Claims 83 and 85-86 depend from Claim 74 which recites no open reading frame.
In the interest of compact prosecution the claims are interpreted as reciting: The RNA of Claim 74, wherein the RNA comprises an open reading frame, wherein the open reading frame encodes…
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 21 and 39 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 21 recites the limitation: An mRNA encoding a SARS-CoV-2 spike protein, the mRNA comprising a 5' UTR comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9, optionally comprising one or more modified nucleobases, wherein the spike protein has the amino acid sequence of SEQ ID NO: 5, optionally having from one to twenty-five amino acid substitution, wherein the spike protein open reading frame has a nucleotide sequence substantially corresponding to SEQ ID NO: 2. The problem is the limitation "the spike protein open reading frame has a nucleotide sequence substantially corresponding to SEQ ID NO 2".
Claim 21 depends from Claim 18 but is broader than Claim 18 because Claim 18 requires that the spike protein AA sequence is SEQ ID NO 5 but Claim 21 requires that the RNA encoding the spike protein only substantially corresponds to SEQ ID NO 2. That means that Claim 21 allows for vastly more spike proteins than the spike protein encoded by AA SEQ ID NO 5. Since Claim 21 allows for more variation and Claim 18 requires a specific sequence, Claim 21 is broader than Claim 18 from which it depends.
Claim 39 recites: An mRNA encoding an antigen or therapeutic protein, the mRNA comprising a 5' UTR, comprising an Initial Transcribed Sequence (ITS) of SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11, the mRNA further comprising an open reading frame encoding the antigen or therapeutic protein, optionally comprising one or more modified nucleobases, wherein the ITS comprises SEQ ID NO: 10 or SEQ ID NO: 11 or at least 8, or at least 10, or at least 12 consecutive nucleotides of SEQ ID NO: 10 or SEQ ID NO: 11, optionally comprising one or more modified bases. Claim 39 depends from Claim 38 but doesn’t incorporate all the limitations of Claim 38 because Claim 38 requires that the mRNA comprises the entirety of SEQ ID NO 11 but Claim 39 requires that the mRNA only at least 8 nt of SEQ ID NO 11. For that reason, Claim 39 is broader than Claim 38.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-5, 11-13, 17-19, 21, 33, 38-42, 48-50, 54, and 69-70 are rejected under 35 U.S.C. 103 as being unpatentable over US Patent Application Publication No. US2018/0171340 (published on 21 June 2018, “App340”) in view of
Sandig (et al. 1993. A phage T7 class-III promoter functions as a polymerase II promoter in mammalian cells. Gene 131:255-259, “Sandig”), US Patent Application Publication No. US 2015/0141320 (published on 21 May 2015, “App320”), International Publication Number WO 2009/026131 (published 26 February 2009, “WO131”), Stony Brook University News (15 April 2021. Former SBU Professor Collaborated on Biotech Tools Used to Produce COVID Vaccines, “SBU”), English translation of Chinese Patent Application Publication Document No. CN 111088283 (Application No. CN 202010203073, published on 01 May 2020, “CNApp283”), and Nance (and Meier. 06 April 2021. Modifications in an Emergency: The Role of N1-Methylpseudouridine in COVID-19 Vaccines. ACS Cent. Sci 7:748-756, “Nance”).
App340 teaches nucleic acid molecules for regulating gene expression. App340 teaches (¶3) their nucleic acid molecules are for producing desired products in a subject for conferring beneficial characteristics to the subject. App340 teaches that (¶13) the nucleic acid molecule can be an mRNA or RNA replicon.
Regarding Claims 1, 38, and 74: App340 teaches that (¶11) the coding sequence can encode a polypeptide, a therapeutic polypeptide, or an antigen or immune modulator.
Regarding Claims 1, 11, 38, 48, and 77: App340 teaches that (¶9) the nucleic acid molecules can have a 5’UTR, a coding sequence for a gene of interest, and a 3’UTR.
Regarding Claims 1 and 33: App340 teaches (¶47) their nucleic acid molecules can be used to formulate a vaccine.
App340 teaches (¶19) the nucleic acid molecule can comprise additional transcription regulatory sequences.
Regarding Claims 12-13, 49, and 75: App340 teaches (¶299) an example of a plasmid for transcription of an mRNA containing a 5’UTR and 3’UTR and a T7 promoter. App340’s 5’UTR is derived from human β-globin and comprises SEQ ID NO 36. SEQ ID NO 36 is a 59-mer that comprises a segment of 100% identity to claimed SEQ ID NO 12, as shown by the following alignment:
RESULT 17
US-15-831-230-36
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 36, US/15831230
Publication No. US20180171340A1
GENERAL INFORMATION
APPLICANT: SYNTHETIC GENOMICS INC
TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR ENHANCING GENE EXPRESSION
FILE REFERENCE: SGI.012A
CURRENT APPLICATION NUMBER: US/15/831,230
CURRENT FILING DATE: 2017-12-04
PRIOR APPLICATION NUMBER: 62/430,250
PRIOR FILING DATE: 2016-12-05
PRIOR APPLICATION NUMBER: 62/486,361
PRIOR FILING DATE: 2017-04-17
PRIOR APPLICATION NUMBER: 62/587,954
PRIOR FILING DATE: 2017-11-17
NUMBER OF SEQ ID NOS: 52
SEQ ID NO 36
LENGTH: 59
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic polynucleotide
FEATURE:
NAME/KEY: misc_feature
OTHER INFORMATION: 5 human beta globin UTR
Query Match 100.0%; Score 46; Length 59;
Best Local Similarity 73.9%;
Matches 34; Conservative 12; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGA 46
|||:::||::|:||||||||:|:|::|||:|||||||:||||||||
Db 1 ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGA 46
App340 teaches (¶104) producing a self-amplifying RNA replicon can be of benefit in vaccine applications because immune responses can shut down protein production.
App340 does not teach the mRNA comprises an initial transcribed sequence comprising SEQ ID NOs 8 or 9 or at least 8-12 nt of SEQ ID NOs 10 or 11 (i.e., Claims 1-2 and 38-39).
However, regarding SEQ ID NO 8 and at least 8-12 nt of SEQ ID NO 10: Sandig teaches a phage T7 promoter (pT7) that functions as a polymerase II promoter in mammalian cells. Sandig teaches that (§Summary) the pT7 has properties of an initiator element and that their results have practical implications for the use of pT7 in mammalian expression systems. Sandig’s Fig. 4 shows the T7 promoter (underlined) and the region following it comprises the following sequence: AATACGACTCACTATAGGGAGACCG. An excerpt of Fig. 4 is shown here:
PNG
media_image1.png
97
599
media_image1.png
Greyscale
That sequence comprises SEQ ID NO 8 (underlined) and at least 8 consecutive nt of SEQ ID NO 10, as shown by this alignment:
RESULT 1
NASEQ2_11142025_125307
Query Match 53.3%; Score 8; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 8; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGGAGACC 8
||||||||
Db 17 GGGAGACC 24
Regarding SEQ ID NO 9 and at least 8-12 nt of SEQ ID NO 11: App320, drawn to compositions for modulating gene expression, teaches (¶3-4) nt sequences that can upregulate expression of a target gene in cells. App320 teaches (same ¶) their sequences cause gene upregulation by inhibiting binding of the polycomb repressor complex 2. App320 teaches (¶89) their sequences can be used in vaccine compositions. App320 teaches (¶9) their nt sequences can comprise any of a large number of sequences including SEQ ID NO 318199 or at least 8 nt of SEQ ID NO 318199. SEQ ID NO 318199 is a 15-mer that comprises a 6-mer fragment (underlined) that is 100% complementary to claimed SEQ ID NO 9 and a 14-mer fragment that is 100% complementary to 14 consecutive nt of claimed SEQ ID NO 11, as shown by the following alignment:
RESULT 44
US-14-401-248-318199/c
Sequence 318199, US/14401248