Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
This action is in response to the papers filed March 17, 2026.
Amendments
Applicant's amendments, filed March 17, 2026, is acknowledged. Applicant has cancelled Claims 2, 4-5, 10, 12, 14, and 17-19, and amended Claims 1, 13, and 15.
Claims 1, 3, 6-9, 11, 13, and 15-16 are pending and under consideration.
Priority
This application is a continuation of PCT/US2020/058795 filed on November 4, 2020. Applicant’s claim for the benefit of a prior-filed application provisional applications 63/024,959 filed on May 14, 2020 and 62/930,520 filed on November 4, 2019 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is/are acknowledged.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on March 17, 2026 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
1. The prior rejection of Claims 1, 3, 6-9, 11, 13, and 15-16 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, is withdrawn in light of Applicant’s amendment to Claim 1 cancelling recitation of the New Matter.
2. The prior rejections of Claim 13 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, are withdrawn in light of Applicant’s amendment to the claim cancelling recitation of “locally”, and instead reciting “administered to a semicircular canal, transtympanically, intratympanically, through the oval wind or round window, or to the horizontal canal, which the Examiner finds persuasive.
3. Claims 1, 3, 6-9, 11, 13, and 15-16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 has been amended to recite the limitation “a nucleotide sequence of SEQ ID NO:4 or SEQ ID NO:5”.
As a first matter, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claim 1 recites the broad recitation “a nucleotide sequence of” and the claim also recites “SEQ ID NO:4 or SEQ ID NO:5” which is/are the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
As a second matter, the phrase “a… nucleotide acid sequence of SEQ ID NO…” renders the claim indefinite because the reference SEQ ID NO’s are each composed of a plurality of nucleic acid subsequences, respectively, and it is unclear to which subsequence(s) of the reference SEQ ID NO(s) Applicant refers.
As a third matter, the phrase “a… nucleotide acid sequence of SEQ ID NO…” renders the claim indefinite because the referenced SEQ ID NO is/are composed of a plurality of nucleic acid subsequences, respectively.
The Directors Technology Center 1600 Memorandum, Nucleic Acid and Peptide Claim Interpretation: “A” and “The” (December 29, 2005) informs the TC1600 Examiners that the phrase “A nucleic acid comprising a nucleotide sequence of SEQ ID NO:1” encompasses nucleic acids that comprise any portion of SEQ ID NO:1; whereas, the phrase “A nucleic acid comprising the nucleotide sequence of SEQ ID NO:1” is directed only to nucleic acids that comprise the full length of SEQ ID NO:1.
English has two articles: ‘the’, and ‘a/an’.
‘the’ is a definite article, referring to a specific or particular noun; whereas, ‘a/an’ is an indefinite article, modifying non-specific or non-particular nouns.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
The Examiner suggests amending the claims cancelling recitation of “a nucleotide sequence of”, and instead recite “the nucleotide sequence of SEQ ID NO”.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
4. Claim(s) 1, 6, and 9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Trinklein et al (U.S. 2007/0161031).
With respect to Claim 1, Trinklein et al is considered relevant prior art for having disclosed a promoter library, wherein said promoter library comprises a nucleotide sequence (SEQ ID NO:44366; 2300nts) comprising a promoter, said promoter’s nucleotide sequence that is 99.6% identical (2 mismatches) to instant SEQ ID NO:4. Trinklein et al disclosed wherein the nucleic acid vector is a plasmid or a viral vector, including an AAV vector (e.g. [0132-133]).
Furthermore, Applicant’s amendment to Claim 1 does not require the promoter to be at least 95% identical to SEQ ID NO:4. Rather, the promoter is to be at least 95% identical to an SLC6A14 promoter.
It is axiomatic that the nucleic acid molecule comprising a SLC6A14 promoter isolated by Trinklein et al is at least 100% identical to the SLC6A14 promoter region encoded by the genomic DNA from which it was isolated, and thus per natural law of cell biology and genetics comprises one or more nucleotide sequences of SEQ ID NO:4.
To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection.
With respect to Claims 1 and 6, Trinklein et al disclosed wherein the nucleic acid sequence comprising a promoter is operably linked to a transgene encoding a protein, e.g. a luciferase cDNA (e.g. Figure 3a).
With respect to Claim 9, Trinklein et al disclosed wherein the nucleic acid vector is a plasmid (e.g. Figure 10A, “purify plasmid DNAs”; 11A, “array plasmid DNAs”).
Thus, Trinklein et al anticipate the claims.
Response to Arguments
Applicant argues that Trinklein et al do not disclose the SLC6A14 promoter to comprise a nucleotide sequence of, e.g., SEQ ID NO:4.
Applicant’s argument(s) has been fully considered, but is not persuasive. It is axiomatic that the nucleic acid molecule comprising a SLC6A14 promoter isolated by Trinklein et al is at least 100% identical to the SLC6A14 promoter region encoded by the genomic DNA from which it was isolated, and thus per natural law of cell biology and genetics comprises one or more nucleotide sequences of SEQ ID NO:4.
To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection.
To put it another way, instant independent Claim 1 does not require the SLC6A14 promoter to comprise all of the nucleotide sequences of, e.g. SEQ ID NO:4. Rather, the claim is directed to a genus of structural variants of, e.g. SEQ ID NO:4, having some, but not all, of the nucleotides of SEQ ID NO:4.
The Examiner suggests amending the claims cancelling recitation of “a nucleotide sequence of”, and instead recite “the nucleotide sequence of SEQ ID NO”.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
5. Claims 1, 6-7, 9, and 11 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Karunakaran et al (2011; of record) in view of Wang et al (2016; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 1, Karunakaran et al is considered relevant prior art for having taught a plasmid nucleic acid vector comprising a SLC6A14 promoter is operably linked to a transgene encoding a protein, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
Karunakaran et al taught the use of two primers to amplify/isolate the human SLC6A14 promoter (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid).
As evidenced by GenBank NB_021305.2, the human SLC6A14 promoter isolated by Karunakaran et al (upper line) is overall 94% identical to instant SEQ ID NO:4, and comprises a nucleotide sequence that is 100% identical to nucleotides 1-786 of instant SEQ ID NO:4 (lower line), as shown below:
1585 AAGCTGGGATGTTTCCTCATAGTTTACTTTCTAGGCCTCATCTTTCTTACAGAGTGTGCT 1644
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 AAGCTGGGATGTTTCCTCATAGTTTACTTTCTAGGCCTCATCTTTCTTACAGAGTGTGCT 60
1645 CCTTTGTTAAGGTTAGAATTTCCCATAAACCTGCTCAATAATTTGTTTGTGTTTGGCTTC 1704
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
61 CCTTTGTTAAGGTTAGAATTTCCCATAAACCTGCTCAATAATTTGTTTGTGTTTGGCTTC 120
1705 TTTGAAATACTACACAAAGCAATCCCTGTAAAAGGCAAAGCTGTCCTGAAGGCTGAGAAA 1764
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
121 TTTGAAATACTACACAAAGCAATCCCTGTAAAAGGCAAAGCTGTCCTGAAGGCTGAGAAA 180
1765 GGAGCCTGAGACATAGGCTCCAAGTTGCTCTTTTCAGGCAGAGCCAGCTGGGTAATCTTA 1824
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
181 GGAGCCTGAGACATAGGCTCCAAGTTGCTCTTTTCAGGCAGAGCCAGCTGGGTAATCTTA 240
1825 TCTCAGATGGCTGCTTTTCAAGGTGCCCAATTCAGGGGCTTTTCCTCTGGGAGCAGCATT 1884
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
241 TCTCAGATGGCTGCTTTTCAAGGTGCCCAATTCAGGGGCTTTTCCTCTGGGAGCAGCATT 300
1885 TGCCCCAGGGAATCAAGTGCTTTCTAGTCAGGGGCAAAACTTTGGGAAATCTGAGGACCC 1944
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
301 TGCCCCAGGGAATCAAGTGCTTTCTAGTCAGGGGCAAAACTTTGGGAAATCTGAGGACCC 360
1945 AGGGTGGTATGGTCTGTTCAGGAGAATTTTGGGGAACAGAATGGCCCCCTTCTCCCTCCA 2004
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
361 AGGGTGGTATGGTCTGTTCAGGAGAATTTTGGGGAACAGAATGGCCCCCTTCTCCCTCCA 420
2005 GCACTTGTACAGATCAGCACTTGGCCCCAGAACAGAGACCAGACTGAGAGGCGAGGTTAG 2064
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
421 GCACTTGTACAGATCAGCACTTGGCCCCAGAACAGAGACCAGACTGAGAGGCGAGGTTAG 480
2065 GAGGAAACAGGGGACCCAGGAAAGGCGGCTAGATTGCAAACGTACCTACACAGCTCTGAG 2124
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
481 GAGGAAACAGGGGACCCAGGAAAGGCGGCTAGATTGCAAACGTACCTACACAGCTCTGAG 540
2125 TCAAAGGCTGTCAGTCATCTCGGCTCAGACTGCTCTGCTCTCCAGCAGCCCAGCCCTTTC 2184
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
541 TCAAAGGCTGTCAGTCATCTCGGCTCAGACTGCTCTGCTCTCCAGCAGCCCAGCCCTTTC 600
2185 CCAGGGCTGGGGCAGGAGATTGCTACATGTAGGCTTATCTGGGGAAAAACCAGAGCCTCA 2244
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
601 CCAGGGCTGGGGCAGGAGATTGCTACATGTAGGCTTATCTGGGGAAAAACCAGAGCCTCA 660
2245 CTTTAGTCCCTTCCGGTAATTGACACTACTGGACACCCAGGAGGGGGAGGAGAGAGCTTC 2304
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
661 CTTTAGTCCCTTCCGGTAATTGACACTACTGGACACCCAGGAGGGGGAGGAGAGAGCTTC 720
2305 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 2364
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
721 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 780
2365 AGAGTG 2370
||||||
781 AGAGTG 786
Thus, it is axiomatic that the SLC6A14 promoter of Karunakaran et al inherently and naturally comprises one or more nucleotide sequences of, e.g. SEQ ID NO:4.
To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection.
To put it another way, instant independent Claim 1 does not require the SLC6A14 promoter to comprise all of the nucleotide sequences of, e.g. SEQ ID NO:4. Rather, the claim is directed to a genus of structural variants of, e.g. SEQ ID NO:4, having some, but not all, of the nucleotides of SEQ ID NO:4.
The Examiner suggests amending the claims cancelling recitation of “a nucleotide sequence of”, and instead recite “the nucleotide sequence of SEQ ID NO”.
Karunakaran et al do not teach wherein the nucleic acid vector is a viral vector, more specifically an AAV viral vector comprising an AAV8 capsid.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 1, 7, and 11, Wang et al is considered relevant prior art for having taught the use of AAV8 viral vectors whose genomes comprise a 5’ ITR, a promoter, a transgene, a WPRE element, a bGH polyA sequence, and a 3’ ITR (e.g. Figure 1a).
Wang et al taught that AAV8 vectors are prepared using a helper cell expressing the plasmid encoding the AAV8 vector expression cassette, and the AAV rep and cap proteins, thereby packaging the AAV8 vector expression cassette within the AAV8 capsids (e.g. pg 287, col. 1, Methods, Preparation of rAAV8 vectors).
Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons (e.g. pg 289, col. 2), and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes (e.g. Abstract).
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and rAAV expression vectors. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first nucleic acid vector, e.g. a plasmid, as taught by Karunakaran et al, with a second nucleic acid vector, to wit, an rAAV8 viral vector, as taught by Wang al, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first nucleic acid vector, e.g. a plasmid, with a second nucleic acid vector, to wit, an rAAV8 viral vector, because those of ordinary skill in the art have long-recognized the use of plasmids encoding rAAV expression constructs, thereby packaging the expression construct into AAV virus particles, and Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons, and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 1 and 6, Karunakaran et al taught wherein the SLC6A14 promoter is operably linked to a transgene encoding a protein, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
With respect to Claim 9, Karunakaran et al taught wherein the nucleic acid vector is a plasmid (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid).
Those of ordinary skill in the art have long-recognized the use of plasmids encoding rAAV expression constructs, as per Wang et al (e.g. pg 287, col. 1, Methods, Preparation of rAAV8 vectors), thereby packaging the expression construct into AAV virus particles,
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Karunakaran et al do not disclose the SLC6A14 promoter to comprise a nucleotide sequence of, e.g., SEQ ID NO:4.
Applicant’s argument(s) has been fully considered, but is not persuasive. As shown in the rejection, the human SLC6A14 promoter isolated by Karunakaran et al (upper line) is overall 94% identical to instant SEQ ID NO:4, and comprises a nucleotide sequence that is 100% identical to nucleotides 1-786 of instant SEQ ID NO:4. Thus, it is axiomatic that the SLC6A14 promoter of Karunakaran et al inherently and naturally comprises one or more nucleotide sequences of, e.g. SEQ ID NO:4.
To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection.
To put it another way, instant independent Claim 1 does not require the SLC6A14 promoter to comprise all of the nucleotide sequences of, e.g. SEQ ID NO:4. Rather, the claim is directed to a genus of structural variants of, e.g. SEQ ID NO:4, having some, but not all, of the nucleotides of SEQ ID NO:4.
The Examiner suggests amending the claims cancelling recitation of “a nucleotide sequence of”, and instead recite “the nucleotide sequence of SEQ ID NO”.
Applicant argues that Karunakaran et al is directed to treating estrogen receptor (ER)-positive breast cancer, and fails to provide any motivation to construct the instant AAV vector with a reasonable expectation of success in a method of expressing a transgene in a human vestibular supporting cell.
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, instant claims are directed to an rAAV expression vector, not a method of use.
As a second matter, in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Karunakaran et al is considered relevant prior art for having taught a plasmid nucleic acid vector comprising a SLC6A14 promoter is operably linked to a transgene encoding a protein, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
Wang et al is considered relevant prior art for having taught the use of AAV8 viral vectors whose genomes comprise a 5’ ITR, a promoter, a transgene, a WPRE element, a bGH polyA sequence, and a 3’ ITR (e.g. Figure 1a).
Wang et al taught that AAV8 vectors are prepared using a helper cell expressing the plasmid encoding the AAV8 vector expression cassette, and the AAV rep and cap proteins, thereby packaging the AAV8 vector expression cassette within the AAV8 capsids (e.g. pg 287, col. 1, Methods, Preparation of rAAV8 vectors).
Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons (e.g. pg 289, col. 2), and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes (e.g. Abstract).
rAAV expression vectors have long-been routinely and predictably synthesized by the ordinary artisan for decades (since the 1980’s) prior to the effective filing date of the instantly claimed invention. Applicant fails to provide objective evidence of record that the ordinary artisan is entirely prohibited from cloning and synthesizing the instantly claimed rAAV expression vector in light of what those of ordinary skill in the art have been doing for the past 40 years.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first nucleic acid vector, e.g. a plasmid, as taught by Karunakaran et al, with a second nucleic acid vector, to wit, an rAAV8 viral vector, as taught by Wang al, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first nucleic acid vector, e.g. a plasmid, with a second nucleic acid vector, to wit, an rAAV8 viral vector, because those of ordinary skill in the art have long-recognized the use of plasmids encoding rAAV expression constructs, thereby packaging the expression construct into AAV virus particles, and Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons, and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes.
Applicant does not contest Applicant does not contest the teachings of Wang et al as applied to the obviousness to substitute a first nucleic acid vector, e.g. a plasmid, as taught by Karunakaran et al, with a second nucleic acid vector, to wit, an rAAV8 viral vector, as taught by Wang al, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first nucleic acid vector, e.g. a plasmid, with a second nucleic acid vector, to wit, an rAAV8 viral vector, because those of ordinary skill in the art have long-recognized the use of plasmids encoding rAAV expression constructs, thereby packaging the expression construct into AAV virus particles, and Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons, and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes.
6. Claims 6 and 15-16 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Karunakaran et al (2011; of record) in view of Wang et al (2016; of record), as applied to Claims 1, 6-7, 9, and 11 above, and in further view of Sajan et al (2007; of record), Campbell et al (available online January 20, 2016; of record), and Parker et al (2014; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Karunakaran et al taught a plasmid nucleic acid vector comprising a SLC6A14 promoter is operably linked to a reporter transgene, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
Wang et al taught rAAV plasmid expression vectors whose genomes comprise a 5’ ITR, a promoter, a transgene, a WPRE element, a bGH polyA sequence, and a 3’ ITR (e.g. Figure 1a).
Wang et al taught that AAV8 vectors are prepared using a helper cell expressing the plasmid encoding the AAV8 vector expression cassette, and the AAV rep and cap proteins, thereby packaging the AAV8 vector expression cassette within the AAV8 capsids (e.g. pg 287, col. 1, Methods, Preparation of rAAV8 vectors).
Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons (e.g. pg 289, col. 2), and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes (e.g. Abstract).
Wang et al taught the AAV8 expression vector transgenes may encode a therapeutic transgene (e.g. Abstract, “transgene expression in gene therapy”), whereby the transgene encodes a protein (e.g. pg 290, col. 2, “WPRE clearly enhanced transgene expression at both the protein and mRNA levels”).
Neither Karunakaran et al nor Wang et al teach wherein the transgene encodes a therapeutic protein, e.g. Atoh1.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 6 and 15-16, Sajan et al is considered relevant prior art for having taught that SLC6A14 is a signature gene in the inner ear vestibular sense organ saccule (e.g. pg 631, col. 2; Table 4).
Campbell et al is considered relevant prior art for having taught that Notch signaling plays an important and instructive role in the differentiation, homeostasis, and repair of glial-like supporting cells of the cochlea (e.g. Abstract), whereupon activated Notch signaling, the expression of SLC6A14 is significantly increased (e.g. pg 5, last para).
Parker et al is considered relevant prior art for having taught that Atoh1 is required for cochlear hair cells that function as mechanosensory cells, and that forced expression of Atoh1 in cochlear-supporting cells may provide a way to regenerate hair cells, and provide for a therapy for hearing loss (e.g. Abstract).
Parker et al taught nucleic acid expression vectors whose genomes encoded a promoter operably linked to:
a reporter transgene, e.g. DsRed;
a reporter transgene, e.g. DsRed, and a transgene encoding a therapeutic protein, e.g. Atoh1; or
a transgene encoding a therapeutic protein, e.g. Atoh1 (Figure 1).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first transgene, e.g. encoding a reporter protein, as taught by Karunakaran et al, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, as taught by Parker al, in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first transgene, e.g. encoding a reporter protein, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, in a nucleic acid expression vector because those of ordinary skill in the art previously recognized SLC6A14 is inherently and naturally expressed in the inner ear cochlear support cells, including vestibular saccule (e.g. Sajan et al; Campbell et al), and have long-recognized the use of nucleic acid expression vectors to encode reporter transgenes and/or therapeutic protein transgenes, whereby Parker et al successfully demonstrated the ability of the routineer to substitute a first transgene encoding a reporter protein with a second transgene encoding a therapeutic protein, e.g. Atoh1.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claim 4, Karunakaran et al taught wherein the SLC6A14 promoter is operably linked to a transgene, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
Parker et al taught wherein the promoter is operably linked to a transgene (Figure 1).
With respect to Claim 9, Karunakaran et al taught wherein the nucleic acid vector is a plasmid (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid).
Parker et al taught wherein the nucleic acid vector is a plasmid (e.g. 2, Methods, Generation of the Atoh1…constructs, “plasmid obtained from…”).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Wang, Sajan, Campbell, and Parker do not cure the defect of Karunakaran.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Karunakaran et al are discussed above and incorporated herein. Applicant does not contest the teachings of Wang, Sajan, Campbell, and Parker as applied to the obviousness to substitute a first transgene, e.g. encoding a reporter protein, as taught by Karunakaran et al, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, as taught by Parker al, in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first transgene, e.g. encoding a reporter protein, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, in a nucleic acid expression vector because those of ordinary skill in the art previously recognized SLC6A14 is inherently and naturally expressed in the inner ear cochlear support cells, including vestibular saccule (e.g. Sajan et al; Campbell et al), and have long-recognized the use of nucleic acid expression vectors to encode reporter transgenes and/or therapeutic protein transgenes, whereby Parker et al successfully demonstrated the ability of the routineer to substitute a first transgene encoding a reporter protein with a second transgene encoding a therapeutic protein, e.g. Atoh1.
7. Claim 3 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Karunakaran et al (2011; of record) and Wang et al (2016; of record), as applied to Claims 1, 6-7, 9, and 11 above, and in further view of Trinklein et al (U.S. 2007/0161031; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
As discussed above, the human SLC6A14 promoter isolated by Karunakaran et al is overall 94% identical to instant SEQ ID NO:4, and comprises a nucleotide sequence that is 100% identical to nucleotides 1-786 of instant SEQ ID NO:4.
The human SLC6A14 promoter isolated by Karunakaran et al differs from instant SEQ ID NO:4 in that it does not comprise the remaining 48 nucleotides of SEQ ID NO:4, to wit:
CACCTGCTACCAGTCAAGCTCAGCCAGACTGCAAGAGGAGGCGAGGCG
However, GenBank NB_021305.2 taught that SLC6A14 mRNA transcription begins at coordinate 4993, which corresponds to coordinate 2310 (underlined), as shown below:
2305 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 2364
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
721 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 780
2365 AGAGTG 2370
||||||
781 AGAGTG 786
Thus, the promoters of both Karunakaran et al and instant SEQ ID NO:4 comprise nucleotide sequences that are downstream of the SLC6A14 transcription start site, and upstream of the SLC6A14 translation start site (GenBank NB_021305.2 coordinate 5124; 23 nucleotides downstream of instant SEQ ID NO:4).
Trinklein et al is considered relevant prior art for having disclosed a promoter library, wherein said promoter library comprises a nucleotide sequence (SEQ ID NO:44366; 2300nts) comprising a promoter, said promoter’s nucleotide sequence that is 99.6% identical (2 mismatches) to instant SEQ ID NO:4. Trinklein et al disclosed wherein the nucleic acid vector is a plasmid or a viral vector, including an AAV vector (e.g. [0132-133]).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first SCL6A14 promoter that is 94% identical to instant SEQ ID NO:4, as taught by Karunakaran et al, with a second SLC6A14 promoter that is 99.6% identical to instant SEQ ID NO:4, as disclosed by Trinklein et al, in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first SCL6A14 promoter that is 94% identical with instant SEQ ID NO:4 with a second SCL6A14 promoter that is 99.6% identical to instant SEQ ID NO:4 in a nucleic acid expression vector because those of ordinary skill in the art have long-recognized and successfully reduced to practice the ability to substitute promoters having different lengths in an expression vector (e.g. Trinklein et al, Figure 3A).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the additional 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter, and Karunakaran et al successfully demonstrated the ability of their SLC6A14 promoter to drive expression of the artisan’s desired transgene.
Neither the instant specification, prior art, nor post-filing art teach the presence of any particular transcription factor binding site(s) the additional 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter that are material to SLC6A14 promoter function/activity, be it in vitro and/or in vivo.
Instant specification fails to disclose an element of criticality for an additional 2, 5, 10, 12, 17, 21, 26, 32, 37, 40, 42, 45, and/or 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter, nor the 2 nucleotide mismatches of the Trinklein et al SLC6A14 promoter.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Wang and Trinklein do not cure the defect of Karunakaran.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Karunakaran et al are discussed above and incorporated herein. Applicant does not contest the teachings of Wang and Trinklein as applied to the obviousness to substitute a first SCL6A14 promoter that is 94% identical to instant SEQ ID NO:4, as taught by Karunakaran et al, with a second SLC6A14 promoter that is 99.6% identical to instant SEQ ID NO:4, as disclosed by Trinklein et al, in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first SCL6A14 promoter that is 94% identical with instant SEQ ID NO:4 with a second SCL6A14 promoter that is 99.6% identical to instant SEQ ID NO:4 in a nucleic acid expression vector because those of ordinary skill in the art have long-recognized and successfully reduced to practice the ability to substitute promoters having different lengths in an expression vector (e.g. Trinklein et al, Figure 3A).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the additional 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter, and Karunakaran et al successfully demonstrated the ability of their SLC6A14 promoter to drive expression of the artisan’s desired transgene.
Neither the instant specification, prior art, nor post-filing art teach the presence of any particular transcription factor binding site(s) the additional 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter that are material to SLC6A14 promoter function/activity, be it in vitro and/or in vivo.
Rather, as discussed in the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections, the breadth of the independent claim encompasses as many as 125 (85% identity) nucleotide substitutions, insertions, and/or deletions anywhere in the SCL6A14 promoter, for which the Karunakaran et al SLC6A14 promoter is at least 94% identical to instant SEQ ID NO:4, but for the remaining 48 nucleotides 3’ downstream.
Instant specification fails to disclose an element of criticality for an additional 2, 5, 10, 12, 17, 21, 26, 32, 37, 40, 42, 45, and/or 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter, nor the 2 nucleotide mismatches of the Trinklein et al SLC6A14 promoter.
8. Claims 1, 3, 6-8, and 15-16 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Karunakaran et al (2011; of record), Wang et al (2016; of record), and Trinklein et al (U.S. 2007/0161031; of record), as applied to Claims 1, 3, 6-7, 9, and 11 above, and in further view of Sajan et al (2007; of record), Campbell et al (available online January 20, 2016; of record), Parker et al (2014; of record), Edge (U.S. Patent 9,896,658; of record), and Wang et al (U.S. 2019/0076550; filed October 15, 2018; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Claim 8 is directed to a nucleic acid vector whose genome encodes, in 5’ to 3’ order (Specification Table 4, pgs 33-38):
a 5’ inverted terminal repeat nucleotide sequence at least 80% identical to nucleotides 1-130 of SEQ ID NO:7;
an SLC6A14 promoter comprising the nucleotide sequence of nucleotides 233-1066 of SEQ ID NO:7 (syn. SEQ ID NO:4);
an Atoh1 cDNA comprising the nucleotide sequence of nucleotides 1083-2144 of SEQ ID NO:7;
a woodchuck posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of nucleotides 2155-2702 of SEQ ID NO:7;
a bovine growth hormone (bGH) polyadenylation sequence comprising the nucleotide sequence of nucleotides 2715-2922 of SEQ ID NO:7; and
a 3’ inverted terminal repeat nucleotide sequence at least 80% identical to nucleotides 3010-3139 of SEQ ID NO:7.
As discussed above, Karunakaran et al and Trinklein et al teach/disclose a SCL6A14 promoter that is 94% or 99.6% identical to instant SEQ ID NO:4.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the additional 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter, and Karunakaran et al successfully demonstrated the ability of their SLC6A14 promoter to drive expression of the artisan’s desired transgene.
Neither the instant specification, prior art, nor post-filing art teach the presence of any particular transcription factor binding site(s) the additional 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter that are material to SLC6A14 promoter function/activity, be it in vitro and/or in vivo.
Instant specification fails to disclose an element of criticality for an additional 2, 5, 10, 12, 17, 21, 26, 32, 37, 40, 42, 45, and/or 48 nucleotides 3’ downstream of the Karunakaran et al SLC6A14 promoter, nor the 2 nucleotide mismatches of the Trinklein et al SLC6A14 promoter.
As discussed above, Sajan et al, Campbell et al, and Parker et al renders obvious the substitution of a first transgene, e.g. encoding a reporter protein, as taught by Karunakaran et al and/or Trinklein et al, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, as taught by Parker al, being operably linked to a SLC6A14 promoter in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06.
Wang et al is considered relevant prior art for having disclosed rAAV expression vectors whose genomes encode:
a 5’ inverted terminal repeat nucleotide sequence 100% identical to nucleotides 1-130 of SEQ ID NO:7;
a woodchuck posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of nucleotides 2155-2702 of SEQ ID NO:7;
a bovine growth hormone (bGH) polyadenylation sequence comprising the nucleotide sequence of nucleotides 2715-2922 of SEQ ID NO:7; and
a 3’ inverted terminal repeat nucleotide sequence 100% identical to nucleotides 3010-3139 of SEQ ID NO:7, as illustrated in Figure 1.
Thus, the combination of these elements has long-been known and successfully reduced to practice in rAAV expression vectors.
Edge is considered relevant prior art for having disclosed plasmids or viral vectors, including rAAV vectors (e.g. col. 14, lines 35-44) encoding an Atoh1 nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7.
Thus, mere placement of an Atoh1 cDNA nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7 into an rAAV expression vector comprising the 5’ITR, WPRE element, bGH polyA, and 3’ITR is obvious, as such is merely cloning the previously known Atoh1 cDNA into the previously known rAAV expression vector.
Similarly, mere placement of the SLC6A14 promoter nucleotide sequence of SEQ ID NO:4 operably linked to a Atoh1 cDNA nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7 into an rAAV expression vector comprising the 5’ITR, WPRE element, bGH polyA, and 3’ITR is obvious, as such is merely cloning the prior art SLC6A14 promoter(s) and/or obvious variant(s) thereof to the previously known Atoh1 cDNA into the previously known rAAV expression vector.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the specific vector backbone nucleotide sequences that intervene:
the SLC6A14 promoter comprising the nucleotide sequence of nucleotides 233-1066 of SEQ ID NO:7;
the Atoh1 cDNA comprising the nucleotide sequence of nucleotides 1083-2144 of SEQ ID NO:7;
the woodchuck posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of nucleotides 2155-2702 of SEQ ID NO:7; and
the bovine growth hormone (bGH) polyadenylation sequence comprising the nucleotide sequence of nucleotides 2715-2922 of SEQ ID NO:7.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Wang, Sajan, Campbell, Parker, Trinklein, Edge, and Wang 2 do not cure the defect of Karunakaran.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Karunakaran et al are discussed above and incorporated herein. Applicant does not contest the teachings of Wang, Sajan, Campbell, Parker, Trinklein, Edge, and Wang 2 as applied to the obviousness of the mere placement of an Atoh1 cDNA nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7 into an rAAV expression vector comprising the 5’ITR, WPRE element, bGH polyA, and 3’ITR, as such is merely cloning the previously known Atoh1 cDNA into the previously known rAAV expression vector.
Similarly, mere placement of the SLC6A14 promoter nucleotide sequence of SEQ ID NO:4 operably linked to a Atoh1 cDNA nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7 into an rAAV expression vector comprising the 5’ITR, WPRE element, bGH polyA, and 3’ITR is obvious, as such is merely cloning the prior art SLC6A14 promoter(s) and/or obvious variant(s) thereof to the previously known Atoh1 cDNA into the previously known rAAV expression vector.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the specific vector backbone nucleotide sequences that intervene:
the SLC6A14 promoter comprising the nucleotide sequence of nucleotides 233-1066 of SEQ ID NO:7;
the Atoh1 cDNA comprising the nucleotide sequence of nucleotides 1083-2144 of SEQ ID NO:7;
the woodchuck posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of nucleotides 2155-2702 of SEQ ID NO:7; and
the bovine growth hormone (bGH) polyadenylation sequence comprising the nucleotide sequence of nucleotides 2715-2922 of SEQ ID NO:7.
9. Claim 13 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Stankovic et al (WO 17/100791) in view of Trinklein et al (U.S. 2007/0161031; of record), Karunakaran et al (2011; of record), Sajan et al (2007; of record), and Campbell et al (available online January 20, 2016; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 13, Stankovic et al is considered relevant prior art for having disclosed methods of expressing a transgene of interest in a vestibular supporting cell in a mammalian subject (e.g. Title; pg 56, claims 2-3 and 5), wherein the mammalian subject may be mouse or human (e.g. pg 30, lines 17-26, “a useful vector for gene delivery into human vestibular organs”, “can transduce both mouse and human hair cells”), the method comprising the step of administering an rAAV expression vector comprising said transgene to the mammalian subject via transtympanically or the oval round window or round window (e.g. pg 16, lines 15-16; pg 22, line 7, “across the tympanic membrane and/or through the round window”; pg 58, claim 18-19).
Stankovic et al do not disclose the transgene is operably linked to an SLC6A14 promoter.
However, prior to the effective filing date of the instantly claimed invention, Trinklein et al is considered relevant prior art for having disclosed a promoter library, wherein said promoter library comprises a nucleotide sequence (SEQ ID NO:44366; 2300nts) comprising a promoter, said promoter’s nucleotide sequence that is 99.6% identical (2 mismatches) to instant SEQ ID NO:4. Trinklein et al disclosed wherein the nucleic acid vector is a plasmid or a viral vector, including an AAV vector (e.g. [0132-133]).
It is axiomatic that the nucleic acid molecule comprising a SLC6A14 promoter isolated by Trinklein et al is at least 100% identical to the SLC6A14 promoter region encoded by the genomic DNA from which it was isolated, and thus per natural law of cell biology and genetics comprises one or more nucleotide sequences of SEQ ID NO:4.
To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection.
Similarly, Karunakaran et al is considered relevant prior art for having taught a plasmid nucleic acid vector comprising a SLC6A14 promoter is operably linked to a transgene encoding a protein, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
Karunakaran et al taught the use of two primers to amplify/isolate the human SLC6A14 promoter (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid).
As evidenced by GenBank NB_021305.2, the human SLC6A14 promoter isolated by Karunakaran et al (upper line) is overall 94% identical to instant SEQ ID NO:4, and comprises a nucleotide sequence that is 100% identical to nucleotides 1-786 of instant SEQ ID NO:4 (lower line), as shown below:
1585 AAGCTGGGATGTTTCCTCATAGTTTACTTTCTAGGCCTCATCTTTCTTACAGAGTGTGCT 1644
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 AAGCTGGGATGTTTCCTCATAGTTTACTTTCTAGGCCTCATCTTTCTTACAGAGTGTGCT 60
1645 CCTTTGTTAAGGTTAGAATTTCCCATAAACCTGCTCAATAATTTGTTTGTGTTTGGCTTC 1704
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
61 CCTTTGTTAAGGTTAGAATTTCCCATAAACCTGCTCAATAATTTGTTTGTGTTTGGCTTC 120
1705 TTTGAAATACTACACAAAGCAATCCCTGTAAAAGGCAAAGCTGTCCTGAAGGCTGAGAAA 1764
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
121 TTTGAAATACTACACAAAGCAATCCCTGTAAAAGGCAAAGCTGTCCTGAAGGCTGAGAAA 180
1765 GGAGCCTGAGACATAGGCTCCAAGTTGCTCTTTTCAGGCAGAGCCAGCTGGGTAATCTTA 1824
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
181 GGAGCCTGAGACATAGGCTCCAAGTTGCTCTTTTCAGGCAGAGCCAGCTGGGTAATCTTA 240
1825 TCTCAGATGGCTGCTTTTCAAGGTGCCCAATTCAGGGGCTTTTCCTCTGGGAGCAGCATT 1884
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
241 TCTCAGATGGCTGCTTTTCAAGGTGCCCAATTCAGGGGCTTTTCCTCTGGGAGCAGCATT 300
1885 TGCCCCAGGGAATCAAGTGCTTTCTAGTCAGGGGCAAAACTTTGGGAAATCTGAGGACCC 1944
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
301 TGCCCCAGGGAATCAAGTGCTTTCTAGTCAGGGGCAAAACTTTGGGAAATCTGAGGACCC 360
1945 AGGGTGGTATGGTCTGTTCAGGAGAATTTTGGGGAACAGAATGGCCCCCTTCTCCCTCCA 2004
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
361 AGGGTGGTATGGTCTGTTCAGGAGAATTTTGGGGAACAGAATGGCCCCCTTCTCCCTCCA 420
2005 GCACTTGTACAGATCAGCACTTGGCCCCAGAACAGAGACCAGACTGAGAGGCGAGGTTAG 2064
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
421 GCACTTGTACAGATCAGCACTTGGCCCCAGAACAGAGACCAGACTGAGAGGCGAGGTTAG 480
2065 GAGGAAACAGGGGACCCAGGAAAGGCGGCTAGATTGCAAACGTACCTACACAGCTCTGAG 2124
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
481 GAGGAAACAGGGGACCCAGGAAAGGCGGCTAGATTGCAAACGTACCTACACAGCTCTGAG 540
2125 TCAAAGGCTGTCAGTCATCTCGGCTCAGACTGCTCTGCTCTCCAGCAGCCCAGCCCTTTC 2184
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
541 TCAAAGGCTGTCAGTCATCTCGGCTCAGACTGCTCTGCTCTCCAGCAGCCCAGCCCTTTC 600
2185 CCAGGGCTGGGGCAGGAGATTGCTACATGTAGGCTTATCTGGGGAAAAACCAGAGCCTCA 2244
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
601 CCAGGGCTGGGGCAGGAGATTGCTACATGTAGGCTTATCTGGGGAAAAACCAGAGCCTCA 660
2245 CTTTAGTCCCTTCCGGTAATTGACACTACTGGACACCCAGGAGGGGGAGGAGAGAGCTTC 2304
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
661 CTTTAGTCCCTTCCGGTAATTGACACTACTGGACACCCAGGAGGGGGAGGAGAGAGCTTC 720
2305 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 2364
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
721 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 780
2365 AGAGTG 2370
||||||
781 AGAGTG 786
Thus, it is axiomatic that the SLC6A14 promoter of Karunakaran et al inherently and naturally comprises one or more nucleotide sequences of, e.g. SEQ ID NO:4.
To the extent Applicant argues otherwise, see above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection.
To put it another way, instant independent Claims 1 and 13 do/does not require the SLC6A14 promoter to comprise all of the nucleotide sequences of, e.g. SEQ ID NO:4. Rather, the claim is directed to a genus of structural variants of, e.g. SEQ ID NO:4, having some, but not all, of the nucleotides of SEQ ID NO:4.
The Examiner suggests amending the claims cancelling recitation of “a nucleotide sequence of”, and instead recite “the nucleotide sequence of SEQ ID NO”.
Nevertheless, the "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the specific SLC6A14 promoter consisting of the sequence of SEQ ID NO:4, as opposed to the SLC6A14 promoter(s) of Trinklein et al and/or Karunakaran et al that inherently and naturally comprise one or more nucleotide sequences of, e.g. instant SEQ ID NO:4.
Sajan et al is considered relevant prior art for having taught that SLC6A14 is a signature gene in the inner ear vestibular sense organ saccule (e.g. pg 631, col. 2; Table 4).
Campbell et al is considered relevant prior art for having taught that Notch signaling plays an important and instructive role in the differentiation, homeostasis, and repair of glial-like supporting cells of the cochlea (e.g. Abstract), whereupon activated Notch signaling, the expression of SLC6A14 is significantly increased (e.g. pg 5, last para).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first promoter in an rAAV expression vector encoding the artisan’s transgene of interest to be expressed in vestibular supporting cells, as disclosed by Stankovic et al, with a second promoter, to wit, an SLC6A14 promoter, as taught/disclosed by Trinklein et al and Karunakaran et al, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first promoter in an rAAV expression vector encoding the artisan’s transgene of interest to be expressed in vestibular supporting cells with a second promoter, to wit, an SLC6A14 promoter, because those of ordinary skill in the art previously recognized that SLC6A14 is inherently and naturally expressed in the inner ear cochlear support cells, including vestibular saccule (e.g. Sajan et al; Campbell et al), and have long-recognized the use of an SLC6A14 promoter to drive expression of the artisan’s transgene of interest in nucleic acid expression vectors, including rAAV expression vectors.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Conclusion
10. Claims 1, 3, 6-9, 11, 13, and 15-16 are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638
Prosecution Insights