Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Amendments
In the reply filed 10/14/2025, Applicant has amended Claims 1, 2, 7, 10-11 and 16-18, and cancelled Claims 6 and 8.
Claims 12-14 and 19 are pending but withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a non-elected invention, there being no allowable generic or linking claim.
Claims 1-5, 7, 9-11 and 15-18 are under consideration.
Priority
The present application was filed 5/12/2022 is a continuation in part (CIP) of U.S. Application Serial No. 16/478,633, filed 7/17/2019, which is the 371 National Phase of International Application No. PCT/EP2018/051214, filed January 18, 2018. Review of the application No. 16/478,633 did not reveal support for a hybrid nucleic acid molecule comprising SEQ ID NO:246 of Claim 10, nor SEQ ID NO: 249 of Claim 11, which correspond to an RNA Endotag belonging to the isocitrate dehydrogenase 1 (IDH1) gene.
Thus, instant claims 10 and 11 are being given the filing date of 5/12/2022.
Withdrawn Objections Specification
The objection to disclosure because it contained an embedded hyperlink and/or other form of browser-executable code is withdrawn due to Applicant’s amendment.
Withdrawn Claim Objections
The objection to Claims 1, 2, 8, 17, and 18 are withdrawn. It is correctly noted by Applicant that the objection of Claim 18 was in error and that Claim 17 was the subject of the objection.
New Claim Objections
Claims 1 is objected to because of the following informalities: where a claim sets forth a plurality of elements or steps, [to wit, first region, second region, third region] each element or step of the claim should be separated by a line indentation, 37 CFR 1.75(i). See MPEP §608.01(m).
Withdrawn 35 USC § 112(b)
The prior rejection of Claims 16 and 18 under 35 U.S.C. § 112(b) pre-AIA 2nd paragraph as being indefinite is withdrawn in light of Applicant’s amendments of Claims 1, 16, and 18 to describe the gene contained in the third region of the first nucleic acid molecule.
Withdrawn 35 USC § 112(d)
The prior rejection of Claims 9 and 11 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form is withdrawn in light of Applicant’s amendments of instant claims to be independent claims.
Withdrawn 35 USC § 103
The prior rejection of Claims 1-5, 7 and 15-18 under 35 U.S.C. 103 as being unpatentable over Arnold (US 6,107,541, patented 8/22/200), in view of Biekle et al. (US 8,252,535, patented 8/28/2012) and Sood et al. (US 8,895,717, patented 11/25/2014) is withdrawn in light of Applicant’s amendment of Claim 1 to limit the target sequence in the third region to consisting of 14-59 nucleotides, which is a limitation not made obvious by Arnold, Biekle nor Sood.
Allowable Claims
Claim 9 is allowed.
The following is an examiner’s statement of reasons for allowance:
Claim 9 is directed to nucleic acid molecules comprising SEQ ID NO:242 or 243, which benefit from priority to parent application 16/478,633 as obvious fragments of SEQ ID NO:18, without the Endotag or multiple cloning sites (see Example p.11 [0233, 0299-0300] of ‘633).
The prior art does not teach nor reasonably suggest SEQ ID NOs:242 or 243, wherein SEQ ID NOs:242 and 243 are hybrid nucleic acid molecules of 968 and 987 nucleotides, respectively, comprising a Kozak sequence followed by a mouse Cyclin D1 transgene wherein the an extra leucine (L) and glutamate (E) are inserted at the very amino terminus after the start methionine, and followed by an untranslated HA tag sequence and the scrambled siRNA target sequence of SEQ ID NO:232, wherein SEQ ID NO:243 further comprises the NdeI/MfeI multiple cloning site.
Any comments considered necessary by applicant must be submitted no later than the payment of the issue fee and, to avoid processing delays, should preferably accompany the issue fee. Such submissions should be clearly labeled “Comments on Statement of Reasons for Allowance.”
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
Claim 11 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bienvenu (WO2018/134305, published 7/26/2018).
With respect to claim 11, Bienvenu teaches the hybrid molecule of SEQ ID NO:19, which is 100% identical to instant SEQ ID NO:247.
Accordingly, Bienvenu anticipates instant claim.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 10/14/2025 are acknowledged.
Applicant notes that claim 11 was not rejection under prior art in the non-final Office action.
Applicant's arguments have been fully considered but they are not persuasive.
Claim 11 was rejection under 112(d) as being of improper dependency because it did not further limit the independent claim. Now that Applicant has amended Claim 11 to independent form, prior art can be reasonably applied.
As stated supra, Claim 11 does not have priority to the parent application because it contains a limitation (i.e., SEQ ID NO:249) not supported by the 16/478,633 parent. According to MPEP § 211 and § 2154, if a claim in a later-filed application (i.e., the continuation-in-part of instant application) includes subject matter not supported by the earlier-filed parent application, that claim is not entitled to the earlier priority date. The examiner will use the actual filing date of the application for that claim. The claim is analyzed as a whole, and if it contains new matter, the entire claim receives the later filing date.
New Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-5, 7, and 15-18 are rejected under 35 U.S.C. 103 as being unpatentable over Arnold (US 6,107,541, patented 8/22/200), in view of Biekle et al. (US 8,252,535, patented 8/28/2012) and Sood et al. (US 8,895,717, patented 11/25/2014), and Davidson (US2004/0023390, filed 5/05/2003).
In regard to claim 1, Arnold teaches a nucleic acid molecule comprising a nucleic acid sequence for a Cyclin D1 protein (alias PRAD1) operably linked to a heterologous promoter to be used in a transgenic mouse (Abstract, and see Claim 1 of Arnold). Specifically, Arnold teaches the nucleic acid sequence of SEQ ID NO:1 (col 4, 2nd para.), which encodes the human CCDN1 protein comprising the amino acid sequence as set forth in SEQ ID NO:231 (see SEQ ID NO:2 and Fig. 6C of Arnold).
Although Arnold contemplates antisense oligonucleotides for reducing expression of Cyclin D1 to examine neoplastic effects in vivo (col 5, 2nd para.), Arnold does not teach such antisense oligonucleotides. Furthermore, Arnold teaches that endogenous cyclin D1 mRNA expressed in many tissues and is highly conserved across species, and has significant sequence similarity to all three types of cyclins (col 4, 2nd and 3rd para., see also Fig. 7 of Arnold).
However, Arnold is silent to the cyclin D1 transgene comprising an antisense tag.
Biekle teaches methods for inhibiting expression of target gene by including an antisense tag in the target gene (Abstract, see Fig. 1).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare a nucleic acid comprising a encoding the human cyclin D1 for transgenic expression as taught by Arnold, and combine an antisense tag as taught by Bielk with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Bielk because the tags avoid the time-consuming and low-efficiency procedures of deriving antisense molecules, as well as minimizing the risk of having antisense molecules with off-target effects (col 1, 6th para., col 2, 1st para.). This, would be especially important for the in vivo embodiments of Arnold and because the cyclin family is so conserved in its sequences.
However, although Biekle teaches the siRNA tag incorporated into the target gene have no homology with eukaryotic gene sequences so as to minimize the risk of the siRNA directed against the siRNA tag causing nonspecific effects (col 8, 3rd para.), they are silent to the siRNA tag comprising SEQ ID NO: 232.
Sood teaches the control siRNA sequence of AATTCTCCGAACGTGTCACGT, which targets the reverse complementary sequence of instant SEQ ID NO: 232, and teaches that as shown by BLAST search does not share sequence homology with any known human mRNA (col 32, 2nd para.).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare a nucleic acid comprising the human cyclin D1 and a unique antisense tag as suggested by Arnold in view of Bielk, and choose the scramble sequence targeted by the siRNA of Sood with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Sood because this sequence is not found in human mRNAs and would therefore minimize off-target effects.
However, although Arnold teaches the presence of a polyadenylation signal in the Cyclin D1 transgene (col 9, 2nd para., see Fig. 6G), they are silent to a mutated polyA of between 14-59 nucleotides flanked by restriction sites.
Davidson teaches a modified minipolyA of 57 nucleotides (underlined with consensus AAUAAA highlighted) flanked by SpeI and SalI restriction sites, which is not translated into a protein and not found in a wild-type transcribed region of a gene coding for a coded RNA (Example 1 [0200-0208], see sequence below):
PNG
media_image1.png
85
816
media_image1.png
Greyscale
In regard to the wherein clauses of claim 1, Davidson teaches the polyadenylation signal corresponds to a sequence of the transcribed region of a gene coding for a coded RNA, and affects the transcription and stability of the coded RNA [0051, 0120]. Note that the “gene coding for a coded RNA” is not part of the claimed composition, only a sequence “corresponding” to a transcribed region, and this gene’s coded RNA is recited with such a high degree of generality it essentially encompasses the RNA from any gene. Furthermore, the contingent limitations directed the functions of the polyA should the RNA encode for a protein, or not, are clearly taught or reasonably suggested by Davidson, wherein polyadenylation sequences were known to improve stability of both mRNA encoding a protein and siRNA not encoding a protein.
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare a nucleic acid comprising the human cyclin D1 and a unique siRNA target sequence as suggested by Arnold in view of Bielk and Sood, and to combine a modified minipolyA as taught by Davidson with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Davidson because this sequence improves the expression and stability of siRNA, or the like such as mRNA [0051, 0059, 0120].
In regard to claim 2, as stated supra, the nucleic acid of Arnold translates into human cyclin D1, which comprises instant SEQ ID NO:3.
In regard to claim 3, as shown in Fig. 6, the nucleic acid of Arnold comprises a 5’ Kozak sequence, and a “tga” STOP codon in frame with the sequence coding for the CCND1 gene.
In regard to claim 4, as stated supra, Arnold teaches a Kozak sequence of “ggaagagccccagcc-”, which is 100% identical to instant SEQ ID NO:239.
In regard to claim 5, Bielk teaches the antisense tag follows the target gene in a 5’ to 3’ direction (see Fig. 1B of Bielk), and this would have been predictably obvious position considering the genus of options.
In regard to claim 7, as stated supra, Davidson makes obvious the third region comprising the modified minipolyA being 3’ UTR ([0051], Fig. 1A), and Bielk makes obvious the RNA tag being 3’ UTR (Fig. 1A). This arrangement of the position of the polyA would have obvious because it has been held that rearranging parts of an invention involves only routine skill in the art. In re Japikse, 86 USPQ 70.
In regard to claim 15, as multiple copies of the nucleic acid of Arnold et al. would have been produced for purposes of transfection/transgenesis, there would have been a second nucleic acid encoding the same first and second regions.
In regard to claim 16, as stated supra, Davidson suggests the modified minipolyA of 57 nucleotides as the third region of the first nucleic acid. However, Arnold teaches the wildtype polyA sequence for the Cyclin D1, which terminates the transcript on Fig. 6G. Specifically, Arnold teaches the terminal sequence of “AATAAAACTGGTAAAACCCCAAAAAAAAAAAAAAAA” comprising the “AATAAA” hexamer consensus sequence (highlighted) with the adjacent GT rich region (underlined) and last 15 nucleotides being the polyA tail itself (bolded). Thus, Arnold discloses a wildtype polyA sequence for the human Cyclin D1 gene without the genetic modification as compared to the modified minipolyA of Davidson in the third region of the first nucleic acid molecule. As stated supra, the “gene coding for a coded RNA” is not part of the claimed composition, and instant claim only requires a sequence “corresponding” to a transcribed region of a wild-type gene (i.e., human Cyclin D1). Furthermore, the nature of the “genetic modification” is extremely broad and encompasses essentially any variant of the human Cyclin D1 polyA sequence (e.g., the modified minipA of Davidson).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare a second set of nucleic acid molecules comprising the human cyclin D1 and a maintain the native polyA sequence as taught by Arnold with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so in order to establish the role of polyadenylation in Cyclin D1 mRNA stability when using the siRNA inhibitor.
In regard to claim 17, as stated supra, as multiple copies of the nucleic acid of Arnold et al. would have been produced for purposes of transfection/transgenesis, there would have been a third and fourth nucleic acid encoding the same first and second regions.
However, in regard to claim 17, Arnold is silent to further including a His tag reporter protein with the cyclin D1 transgene.
Nevertheless, Bielke teaches the use of a translated His tag reporter with the antisense tag (see Fig. 2A).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare a nucleic acid suggested by Arnold et al., and combine a His tag reporter as taught by Bielk with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Bielk in order to facilitate detection and/or purification of the target gene (col 5, 4th para.).
In regard to claim 18, as stated supra, as multiple copies of the nucleic acid of Arnold et al. would have been produced for purposes of transfection/transgenesis, and Arnold in view of Bielk make obvious a fourth nucleic acid encoding the same first region with a HA reporter and second region found in the first nucleic acid.
Furthermore, in regard to claim 18, as stated supra, Arnold teaches the wildtype polyA sequence for the Cyclin D1, which terminates the transcript on Fig. 6G. Specifically, Arnold teaches the terminal sequence of “AATAAAACTGGTAAAACCCCAAAAAAAAAAAAAAAA” comprising the “AATAAA” hexamer consensus sequence (highlighted) with the adjacent GT rich region (underlined) and last 15 nucleotides being the polyA tail itself (bolded). Thus, Arnold discloses a wildtype polyA sequence for the human Cyclin D1 gene without the genetic modification for the third region of the fourth nucleic acid as compared to the modified minipolyA of Davidson in the third region of the first nucleic acid molecule. As stated supra, the “gene coding for a coded RNA” is not part of the claimed composition, and instant claim only requires a sequence “corresponding” to a transcribed region of a wild-type gene (i.e., human Cyclin D1). Furthermore, the nature of the “genetic modification” is extremely broad and encompasses essentially any variant of the human Cyclin D1 polyA sequence (e.g., the modified minipA of Davidson).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare a second set of nucleic acid molecules comprising a fourth nucleic acid comprising the human cyclin D1 with translated HA tag and siRNA-Tag, and a maintain the native polyA sequence as taught by Arnold with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so in order to establish the role of polyadenylation in Cyclin D1 mRNA stability when using the siRNA inhibitor.
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 10/14/2025 are acknowledged.
First, Applicant argues that the amended claims limit the third region to consisting of 14-59 nucleotides, which is not taught by the cited prior art. Applicant argues that the claimed third region allows siRNA to be discriminated for a given mutation.
Second, Applicant argues that Arnold does not use CCND1 as a biological reporter, and only suggests antisense oligonucleotides to serve as anticancer therapy. Applicant argues these features are unrelated to the instant invention that are directed to an siRNA tag that excludes off-target noise and targeting of the wildtype version of the RNAi-tag.
Third, Applicant argues that Biekle teaches the antisense tag is to be as different as possible from the target region, and is used for inhibiting the expression of a target gene. On the contrary, instant claims recite a third region that is the anchor point for screening RNAs and corresponds to a target sequence in a sick cell.
Fourth, Applicant argues that Sood teaches scrambled siRNA (related to SEQ ID NO: 232), as a negative control. On the contrary, the scrambled siRNA sequence claimed in the second region is used as a positive control, wherein it is possible to screen mutated cells. By contrast Applicant argues that if the sequence of Sood is used as the siRNA-tag, it is not possible to discriminate the effects of a candidate molecule.
Applicant's arguments have been fully considered but they are not persuasive.
In response to Applicant's first argument, Davidson makes obvious a third region comprising a modified polyadenylation sequence consisting of 14-59 nucleotides flanked by restriction sites, and as stated in the pending rejections the third region is extremely broad in its defining structure and reasonably encompasses a modified polyA sequence. In regard to Applicant’s arguments directed to the intended use of the third region, MPEP 2144 (IV) states that the reason or motivation to modify a reference may often suggest what the inventor has done, but for a different purpose or to solve a different problem. It is not necessary that the prior art suggest the combination to achieve the same advantage or result discovered by Applicant. See, e.g., In re Kahn, 441 F.3d 977, 987, 78 USPQ2d 1329, 1336 (Fed. Cir. 2006). In instant case, the prior art teaches to the use of a polyA sequence to promote RNA expression/stability. The fact that Applicant has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious. See Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985).
In response to Applicant's second argument, that the teachings of Arnold are unrealted to the claimed siRNA tag, a 35 U.S.C. § 103(a) based test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In instant case, Arnold teaches the transgenic animal and cells thereof for models of neoplastic disease and contemplates antisense oligonucleotides for reducing expression of Cyclin D1 to examine neoplastic effects in vivo (col 5, 2nd para.). Furthermore, Arnold raises the issue that endogenous cyclin D1 mRNA expressed in many tissues and is highly conserved across species, and has significant sequence similarity to all three types of cyclins (col 4, 2nd and 3rd para., see also Fig. 7 of Arnold). Thus, prior art directed to sequence specific antisense tags would have been recognized by one of ordinary skill in the art as applicable to the issues disclosed by Arnold. As such, the prior art of Biekle who teaches methods for inhibiting expression of target gene by including an antisense tag in the target gene would have been obvious to combine with Arnold in order to minimize the risk of having antisense molecules with off-target effects because the cyclin family is so conserved in its sequences.
In response to Applicant's third argument that the references fail to show certain features of applicant’s invention with respect to the third region, it is noted that the features upon which applicant relies (i.e., third region that is the anchor point for screening RNAs and corresponds to a target sequence in a sick cell) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997) (The court held that the PTO is not required, in the course of prosecution, to interpret claims in applications in the same manner as a court would interpret claims in an infringement suit. Rather, the “PTO applies to verbiage of the proposed claims the broadest reasonable meaning of the words in their ordinary usage as they would be understood by one of ordinary skill in the art, taking into account whatever enlightenment by way of definitions or otherwise that may be afforded by the written description contained in applicant’s specification.”). See MPEP 2111].
Finally, in response to Applicant’s fourth argument, as stated above, a 35 U.S.C. § 103(a) based test for obviousness is based on what the combined teachings of the references would have suggested to those of ordinary skill in the art. As outlined in the pending regions, Arnould in view of Biekle make obvious a CCND1 transgene with an siRNA-Tag because of the high sequence similarity among cyclins. Furthermore, Sood teaches the scrambled siRNA (directed to SEQ ID NO: 232) would have been an obvious choice because had been “shown by BLAST search to not share sequence homology with any known human mRNA”. Furthermore, Applicant arguments directed to the claimed siRNA-tag as a means for discriminating the effects of a candidate molecule are not recited in the rejected claims.
Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Champagne et al., (Oncogene, 2020, 39:935-945), in view of Bienvenu (WO2018/134305, published 7/26/2018).
[AltContent: textbox ([img-media_image2.png])]Champagne teaches a nucleic acid comprising first region hCCND1 transgene, and a second region comprising an ectopic 21 nucleotide scrambled RNA sequence (p. 940 col 2, 2nd para., see also Fig. S4A, excerpt adjacent). Importantly, Champagne teaches that the RNA tags are not to translated into peptide, and serve as artificial target sites for anti-scrambled siRNAs that can specifically inhibit transgenic CCND1 expression while off-target effects can be measured. Furthermore, in regard the second region, Champagne teaches the scrambled siRNA sequence of “ACGUGACACGUUCGGAGAAUU” (Supplemental Table 1, line 1), which corresponds to the DNA sequence of SEQ ID NO:232.
However, in regard to the first region comprising the CCND1 transgene, although Champagne teaches the sequence corresponds to human Cyclin D1 (p. 19, Supplemental Methods, last para.), Champagne is silent to the human Cyclin D1 sequence comprising SEQ ID NO: 231.
Nevertheless, Champagne discloses that the corresponding author Bienvenu is also the inventor of WO2018134305 (p. 945, 1st para.).
Bienvenu (WO2018/134305) teaches the amino acid sequence for human Cyclin D1 as SEQ ID NO:3 (p.5, 3rd para.), which encompasses the amino acid sequence instant SEQ ID NO:231.
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the nucleic acid comprising the first region of CCND1 as taught by Champagne and choose the sequence of SEQ ID NO:231 as taught by Bienvenu with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so because the successful cloning and sequencing of the cDNA encoding a known protein is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the cDNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009).
Furthermore, Champagne teaches subcloning steps for generating the Cyclin D1 genetic constructs comprising restriction sites flanking the inserts (pgs 19-20 of Supplemental Methods). Accordingly, it would have been obvious to have a third region between the first and second region comprising a restriction enzyme site after the translational STOP of the first region in order to subclone in the second region.
However, in regard to claim 10, although Champagne teaches that the third region comprises a V600E-Raf tag sequence (see Supplemental Table 1), they are silent to the 41 nucleotide sequence of SEQ ID NO:244.
Nevertheless, Bienvenu teaches the nucleic acid sequence of the hybrid nucleic acid molecule can comprise the mutated Braf tag (i.e., V600E Raf Endotag) of SEQ ID NO: 229 (see Fig. 41 of Bienvenu), which is 100% identical to SEQ ID NO:244.
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the nucleic acid as taught by Champagne and combine the V600E Raf endotag sequence as taught by Bienvenu with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so for several reasons. First, Bienvenu reduces to practice several hybrid nucleic acids comprising the CCND1 gene followed by both the scrambled siRNA TAG of instant SEQ ID NO:232 and the V600E Raf Endotag of instant SEQ ID NO:244 (e.g., see SEQ ID NOs:19 and 44 of Bienvenu), which is 41 nucleotides in length. Furthermore, it would have been obvious to incorporate these embodiments into the hybrid nucleic acids of Champagne because then two distinct siRNA could be used to determine the functional impact of oncogene targeting. In other words, Champagne teaches that both the anti-Raf and anti-scrambled siRNA can significantly impact the level of mRNAs other than CCND1, and using both TAGs would allow one to determine which mRNAs are differentially expressed in common between the Raf and Scrambled-siRNA treatments ((p. 936, last para. to 938, 2nd para.).
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
RESPONSE TO ARGUMENTS
Applicant's arguments filed on 10/14/2025 are acknowledged.
Applicant's arguments have been fully considered but they are not persuasive.
Applicant is reminded that by having a dependent claim with a different priority date, two claim sets exist, one with just that independent claim followed by parent-supported dependent claims, and the other with that independent claim (or a slight variation of it) and the dependent claim supported in the CIP but not supported in the parent application. The single independent claim (as well as the parent-supported dependent claims) would have the priority date of the parent application, and the variation independent claim with the newer dependent claim would have the priority date of the CIP application.
In response to applicant's argument that the pending rejection did not address all the limitations of the parent claim and dependent claim 10, a 35 U.S.C. § 103(a) based test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In instant case, Champagne and Bienvenu make obvious all of the elements directed to the first, second, and third regions of the claimed nucleic acid molecule.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Claim 9 is allowed.
Examiner Contact Information
Any inquiry concerning this communication or earl ier communications from the examiner should be directed to ARTHUR S LEONARD whose telephone number is (571)270-3073. The examiner can normally be reached on Mon-Fri 9am-5pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James Doug Schultz can be reached on 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ARTHUR S LEONARD/Examiner, Art Unit 1631