Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office Action has been withdrawn pursuant to 37 CFR 1.114. Applicant’s submission filed on February 20, 2026 has been entered.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Status of Claims
Claims 1, 2 and 10-12 are currently pending. Claims 1 and 2 have been amended by Applicants’ amendment filed 02-20-2026. Claims 3 and 4 have been canceled by Applicants’ amendment filed 02-20-2026. No claims have been added by Applicants’ amendment filed 02-20-2026.
Therefore, claims 1, 2 and 10-12 are under consideration to which the following grounds of rejection are applicable.
Priority
The present application filed May 23, 2022, claims the benefit of US Provisional Patent Application 63/191553, filed May 21, 2021.
Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 120 as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of the first paragraph of 35 U.S.C. 112. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application 63/191553, filed May 21, 2021, fails to provide adequate support or enablement in the manner provided by the first paragraph of 35 U.S.C. 112 for one or more claims of this application. The specific method steps recited in independent claim 1 does not have support for; “wherein biotinylated lysines are incorporated at random subsets of lysine residues in the transcription factor polypeptide of interest”. Therefore, the priority date for the presently claimed invention is May 23, 2022, the filing date of US Patent Application 17/750,844.
Applicants are invited to specifically indicate the location of the cited phrase pertinent to claim 1 of the instant application.
Withdrawn Objections/Rejections
Applicants’ amendment and arguments filed February 20, 2026 are acknowledged and have been fully considered. The Examiner has re-weighed all the evidence of record. Any rejection and/or objection not specifically addressed below are herein withdrawn.
Maintained Objections/Rejections
Claim Rejections - 35 USC § 112(b)
The rejection of claims 1, 2 and 10-12 is maintained under 35 U.S.C. 112(b) paragraph as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention.
Claim 1 is indefinite for the recitation of the term “associated with a species-specific barcode” such as recited in claim 1, line 9 because the origin of the species-specific barcode and the association between the amplicon and the barcode is completely unclear given that no barcode is recited to be bound to any component in the amplification reaction. Thus, it is unclear whether the species-specific barcode is bound to the cellular nucleic acids, the primers, the promoter sequence, and/or the amplicon and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “step” such as recited in claim 1, lines 10, 16, 19n 23, 41 and 44 because claim 1 does not recite a “step (a)”, “step (b)”, “step (c)”, etc. Instead, instant claim 1 recites (a), (b), (c), etc. and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “wherein the population of nucleic acid template in step (a) are distributed into individual wells and transcribe and translated in vitro in the individual wells” such as recited in claim 1, lines 15-17 because it is unclear when the population of nucleic acid templates are distributed into wells given that claim 1, lines 10-14 recites ‘transcribing a population of nucleic acid templates in step (a) and translating the RNA’. Thus, it is unclear whether distribution into wells occurs after (a), after (b); whether it occurs twice, both after (a) and after (b); and/or at some other point in the method and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “wherein the population of biotinylated transcription factor polypeptides in step (b) are expressed from templates that are PCR amplified directly from genomic DNA in a clone-free workflow” such as recited in claim 1, lines 15-17 because the limitation as recited is completely unclear and confusing. More specifically, it is unclear when the recited expression takes place (e.g., after (c), after (b), both after (b) and after (c), etc.); it is unclear what templates are PCR amplified; the origin of the genomic DNA is unclear; and/or it is unclear what specific steps, processes, components, procedures, etc. are encompassed by the term “clone-free workflow” and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “each gDNA fragment being associated with a species-specific barcode” such as recited in claim 1, line 29 because the association between the gDNA and the species-specific barcode is unclear. It is unclear whether the biotinylated transcription factor polypeptides-gDNA complexes comprise a single species-specific barcode (e.g., from the amplicons of (a)), or whether the complexes are doubly barcoded (e.g., one from the amplicons recited claim 1, line 9 and one from incubation of the gDNA fragments) and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “unbound genomic DNA fragments” such as recited in claim 1, line 33. There is insufficient antecedent basis for the term “unbound genomic DNA fragments” in the claim because claim 1, lines 27-28 recites the term “a pool of barcoded genomic DNA fragments.” Additionally, it is noted that claim 16 does not recite the generation of ‘bound genomic DNA fragments’ and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “recovering the genomic DNA fragments bound to the population of immobilized biotinylated transcription factor polypeptides for sequence analysis” such as recited in claim 1, lines 34-36 because claims 16 does not recite the presence of ‘genomic DNA fragments bound to the population of polypeptides’. Moreover, since no specific steps of “recovering” are recited (e.g., cleaving, washing, treating with an enzyme, fragmentation, etc.), it is unclear whether the genomic DNA fragments that are recovered are bound to the population of immobilized biotinylated transcription factor polypeptides; or are not bound to the population of immobilized biotinylated transcription factor polypeptides and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “the genomic DNA fragments” such as recited in claim 1, lines 34 and 41. There is insufficient antecedent basis for the term “the genomic DNA fragments” in the claim because claim 1, lines 27-28 recites the term “a pool of barcoded genomic DNA fragments.”
Claim 1 is indefinite for the recitation of the term “the DNA fragments” such as recited in claim 1, lines 39-40. There is insufficient antecedent basis for the term “the DNA fragments” in the claim because claim 1, lines 27-29 recites the term “a pool of barcoded genomic DNA fragments” and the term “each genomic DNA fragment.”
Claim 1 is indefinite for the recitation of the term “the nucleotide sequences” such as recited in claim 1, line 41. There is insufficient antecedent basis for the term “the nucleotide sequences” in the claim.
Claim 1 is indefinite for the recitation of the term “the sequences” such as recited in claim 1, line 41. There is insufficient antecedent basis for the term “the sequences” in the claim because claim 1, line 39 recites the term “the nucleotide sequences.”
Claim 1 is indefinite for the recitation of the term “the genomic DNA fragments identified in step (g)” such as recited in claim 1, line 41 because instant claim 1(g) does not recite ‘identifying genomic DNA fragments’ and, thus, the metes and bounds of the claim cannot be determined.
Claim 1 is indefinite for the recitation of the term “the respective species” such as recited in claim 1, line 42. There is insufficient antecedent basis for the term “the respective species” in the claim because claim 1, lines 2-3 recites the term “a plurality of species of organisms.”
Claim 2 is indefinite for the recitation of the term “PCR amplifications” in claim 2, line 2 because claim 2 depends from instant claim 1, wherein claim 1, lines 22-23 already recites that the population of biotinylated transcription factor polypeptides in step (b) are expressed from templates that are “PCR amplified” and, thus, the metes and bounds of the claim cannot be determined.
Claim 12 is indefinite for the recitation of the term “wherein (f) comprises an amplification reaction” such that it is unclear how a step of “recovering the genomic DNA fragments bound to the population of immobilized biotinylated transcription factor polypeptides” can comprise an amplification reaction and, thus, the metes and bounds of the claim cannot be determined.
Claims 10 and 11 are indefinite insofar as they ultimately depend from instant claim 1.
Claim Rejection - 35 USC § 103
The rejection of claims 1, 2 and 10-12 is maintained under 35 U.S.C. 103 as being unpatentable over O’Malley et al. (hereinafter “O’Malley”) (Cell, 2016, 165, 1280-1292; and Supplemental Information, 2016, 165, 1-2; of record) in view of Hook et al. (hereinafter “Hook”) (Promega Corporation, 2011, 1-11; of record) as evidenced by Promega 1 (Promega, Part #9PIL567, 2018, 1-2; of record); and Promega 2 (Promega, Part #9PIL568, 2018, 1-2; of record); and Blommel et al. (hereinafter “Blommel”) (Methods in Molecular Biology, Sharon Doyle Ed., Humana Press, Chapter 4, 2009, 498, 55-81; of record).
Regarding claims 1 (in part), 2 and 10-12, O’Malley teaches DAP-Seq, which is an in vitro TF-DNA binding assay that allows low-cost and rapid generation of genome-wide binding site maps for a large number of TFs (interpreted as a DNA binding assay, with gDNA), DAP-Seq comprises: Step (1): fragmenting and capturing gDNA, while capturing properties that impact binding in vivo; including ligating adaptors to create a DAP library prepared as a standard high-throughput gDNA sequencing library for the Illumina platform; and PCR to produce ampDAP library (Figure 1A; DAP library) (interpreted as gDNA fragments; NGS or multiplex reactions; and captured onto beads); Step (2): in a separate reaction, an affinity-purified FT is prepared by in vitro expression of the expression vector comprising the transcription factor and affinity-tag such as an affinity-Halo tag bound to ligand-coupled beads, and washed to remove non-specific cellular components, wherein expressed proteins were directly captured by incubation with Magne HaloTag Beads; and the beads washed three times with wash/bind buffer (Figure 1B) (interpreted as transcribing a nucleic acid template encoding the transcription factor; magnetic beads; and translating the RNA in an in vitro translation reaction comprising a tRNA charged with a tag); Step (3): DNA affinity purification is carried out, wherein the gDNA library is added to the affinity-bound TF and the unbound DNA is washed away (Figure 1C) (interpreted as incubating affinity-labeled transcription factor with an affinity binding partner on a solid support; and washing to remove unbound fragmented gDNA); Step (4): the bound fraction is eluted, amplified with PCR primers to introduce an indexed adaptor; Step (5): the DNA is sequenced (interpreted as amplifying by PCR, and sequencing), such that by mapping the reads to a reference genome, enriched loci (peaks) can be used to identify TFBS and motifs; and Step (6): inspection of DAP-Seq peaks for the bZIP TF ABI5 revealed enrichment at a known regulatory site that contains two adjacent G-box motifs (CACGTG) (Figure 1D) (interpreted as teaching the limitations of claims 1-4 and 10-12, claims 1-4 and 10-12) (pg. 1282, col 1; second full paragraph; pg. 1283, Figure 1; and Supplemental Information, pg. 1281, first full paragraph, lines 1-2; and pg. 1282, first partial paragraph). Figure 1 is shown below:
PNG
media_image1.png
313
876
media_image1.png
Greyscale
PNG
media_image2.png
301
859
media_image2.png
Greyscale
.
PNG
media_image3.png
315
891
media_image3.png
Greyscale
O’Malley teaches that the protein-bound beads were then incubated with 50ng of adapter-ligated gDNA fragments on a rotator for 1hr at RT in 50μL wash/bind buffer, wherein beads were washed again three times using the same wash buffer to remove unbound DNA fragments, such that the HaloTag beads were then resuspended in 30uL EB and heated to 98°C for 10 minutes to denature the protein and release the bound DNA fragments into solution; the supernatant was transferred to a new well, such that for HaloTag protein reactions, 25μL were used in a 50μL PCR reaction using Phusion polymerase and the same cycling conditions as described above for ampDAP-seq for 20 cycles; wherein PCR primers consisted of the full-length Illumina TruSeq Universal primer (5’AATGATACGGCGAC-CACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and an Illumina TruSeq Index primer (5’GATCGGAAGAGCACACGTCTGAAC-TCCAGTCACNNNNNNATCTCGTATGCCGTCTTCT GCTTG) where NNNNNN represents the 6 base pair sequence index used for sample identification (interpreted as incubating adaptor-ligated fragmented gDNA; amplification with PCR primers; DNA fragments bound to a bead; comprising a HaloTag; and multiplexing, claims 1-4 (Supplemental Information, pg. 1282, first full paragraph). O’Malley teaches that HALO-tagged TFs were expressed in an in vitro wheat germ system (interpreted as a clone-free workflow) (pg. 1292, col 1, first full paragraph).
O’Malley does not specifically exemplify tRNA charged with a biotinylated lysine; and the use of primers comprising a promoter sequence (instant claim 1, in part).
Regarding claim 1 (in part), Hook teaches the cell-free expression is a convenient method for producing protein rapidly, wherein radioactive [35S] methionine labeling is a traditional method for detecting and tracking proteins produced in cell-free expression systems; and that other detection methods with high specificity and sensitivity are becoming more common, such that following non-radioactive techniques to detect five proteins produced in both rabbit reticulocyte lysate-based and wheat germ extract-based cell-free protein expression systems: FluoroTect™ GreenLys in vitro Translation Labeling System, Transcend™ Chemiluminescent Translation Detection System and Western blot analysis with both HRP-and Alexa Fluor® 647-conjugated secondary antibodies; where all of these techniques yielded low background and sensitive detection, allowing researchers to distance themselves from traditional radioactive detection methods (Abstract). Hook teaches that cell-free expression systems generate protein from nucleic acid in as little as 60 minutes, where some systems require an mRNA template, but coupled transcription/translation systems can use plasmid DNA or a PCR product as a template, eliminating the need to transcribe DNA into RNA first such that Promega offers cell-free protein expression systems based on lysates from mammalian, plant, bacterial and insect cells, which provides the researcher has the flexibility to choose the type of template and cell-free expression system; and the speed and ease of use of cell-free protein expression provide researchers options in addition to traditional cell-based expression (pg. 1, Introduction, first full paragraph). Hook teaches the detection of proteins expressed using cell-free systems is required for most application such as protein:protein interaction and protein:nucleic acid interaction studies (pg. 1, Introduction, second full paragraph). Hook teaches cell-free expression systems generate protein from nucleic acid in as little as 60 minutes, where some systems require an mRNA template, but coupled transcription/translation systems can use plasmid DNA or a PCR product as a template, eliminating the need to transcribe DNA into RNA first, wherein Promega offers cell-free expression systems based on lysates from mammalian, plant, bacterial, and insect cells (pg. 1, last partial paragraph; and pg. 2, first partial paragraph) (interpreted as a clone-free workflow). Hook teaches that Figure 1 illustrates: Panel A illustrates non-radioactive detection methods for cell-free expression; Panel B represents a schematic diagram showing detection by Western blot using a fluorescently labeled secondary antibody; Panel C shows FluoroTect™ tRNA, wherein the tRNA is charged with a BODIPY®-FL-labeled lysine residue; and Panel D shows the Transcend™ tRNA, wherein the tRNA is charged with a biotin-labeled lysine residue; and the black circles represent the relative time required for each detection method (FIG. 1) (interpreted as a biotinylated lysine, claim 1) (pg. 2, Figure 1). Figure 1, Panels A-D are shown below:
PNG
media_image4.png
208
478
media_image4.png
Greyscale
PNG
media_image5.png
186
542
media_image5.png
Greyscale
Panel A Panel B Panel C Panel D
Hook teaches that the FluoroTect™ GreenLys in vitro Translation Labeling System (Cat.# L5001) and Transcend™ Chemiluminescent Non-Radioactive Translation Detection System (Cat.# L5080) are two methods for detecting proteins expressed in cell-free systems, wherein the FluoroTect™ System employs a tRNA charged with a lysine that is labeled at the ε position with the BODIPY®-FL fluorophore (Figure 1, Panel C), such that these fluorescently labeled lysine residues are incorporated into synthesized proteins during in vitro translation; and the Transcend™ System relies on incorporation of biotinylated lysine residues into nascent proteins during translation, wherein the biotinylated lysine is added to the translation reaction as a charged ε-labeled biotinylated-lysine:tRNA complex (Transcend™ tRNA; Figure 1, Panel D) rather than a free amino acid, such that after SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and electroblotting, biotinylated proteins can be visualized by binding Streptavidin-AP or Streptavidin-HRP, followed by colorimetric or chemiluminescent detection, respectively, such that these methods can detect 0.5–5ng of protein, with a sensitivity equivalent to that achieved with [35S] methionine incorporation and autoradiographic detection (interpreted as biotinylated lysine incorporation, claim 1) (pg. 2, (pg. 2, Introduction, third full paragraph; and pg. 2, Figure 1). Hook teaches that the genes in Table 1 were amplified with PCR primers designed using the Flexi® Vector Primer Design Tool, then cloned into pF1A T7 Flexi® Vector (Cat.# C8441) and pF3A WG (BYDV) Flexi® Vector (Cat.# L5671) using the Flexi® Cloning System (Cat.# C8640) (interpreted as performing amplification using primers having a T7 promoter sequence, claim 1) (pg. 5, first full paragraph; and Table 1); where it is known that the pF3A WG (BYDV) Flexi Vector and the pF3K WG (BYDV) Flexi Vector comprise T7 and SP6 RNA polymerase promoters that allow production of RNA for subsequent translation applications as evidenced by Promega 1 and Promega 2 (pg. 1, Description; and Table 1); and where it is known that flexi vector cloning for DNA analysis uses a T7 terminator sequencing primer in PCR as evidenced by Blommel (pg. 58, Section 4.2.7). Hook teaches that proteins were expressed using RRL-based and WGE-based cell-free expression systems and labeled using the FluoroTect GreenLys tRNA (interpreted as a clone-free workflow, claim 1) (pg. 6, last partial paragraph).
It is prima facie obvious to combine prior art elements according to known methods to yield predictable results; the court held that, "…a conclusion that a claim would have been obvious is that all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded nothing more than predictable results to one of ordinary skill in the art. KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1395 (2007); Sakraida v. AG Pro, Inc., 425 U.S. 273, 282, 189 USPQ 449, 453 (1976); Anderson’s-Black Rock, Inc. v. Pavement Salvage Co., 396 U.S. 57, 62-63, 163 USPQ 673, 675 (1969); Great Atlantic & P. Tea Co. v. Supermarket Equipment Corp., 340 U.S. 147, 152, 87 USPQ 303, 306 (1950)”. Therefore, in view of the benefits of detecting and tracking proteins produced in cell-free expression systems as exemplified by Hook, it would have been prima facie obvious for one of skill in the art before the effective filing date of the claimed invention to modify the method identifying transcription factor binding sites (TFBS) in a genome using DAP-Seq including the immobilization of TFs on Magne HaloTag beads as disclosed by O’Malley to replace the Halo-tags and in vitro expression system taught by O’Malley with other non-radioactive detection methods including the Transcend™ Chemi-luminescent Non-Radioactive Translation Detection System and/or cell free expression systems such as PCR, with a reasonable expectation of success in using a coupled transcription/translation systems to produce PCR products that can be used as a template; in providing researchers with the flexibility to choose the type of template including protein expression systems based on lysates from plant, mammalian, bacterial, and insect cells; in producing charged ε-labeled biotinylated-lysine:tRNA complexes; and/or in providing a cost-effective method for the identification of transcription factor in vivo binding sites in a genome of an organism including for the characterization of regulatory elements and TF function.
Thus, in view of the foregoing, the claimed invention, as a whole, would have been obvious to one of ordinary skill in the art at the time the invention was made. Therefore, the claims are properly rejected under 35 USC §103 as obvious over the art.
Response to Arguments
Applicant’s arguments filed February 20, 2026 have been fully considered but they are not persuasive. Applicants essentially asserts: (a) the combined references do not teach
"generating a population of immobilized biotinylated transcription factor polypeptides, wherein the population of biotinylated transcription factor polypeptides in step (b) are expressed from templates that are PCR amplified directly from genomic DNA in a clone-free workflow" as recited in claim 1 (Applicant Remarks, pg. 8, fifth and sixth full paragraphs).
Regarding (a), it is noted that although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26USPQ2d 1057 (Fed. Cir. 1993). Moreover, none of the references has to teach each and every claim limitation. If they did, this would have been anticipation and not an obviousness-type rejection. One cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Additionally,
MPEP 2112.01(I) indicates that,
where the claimed and prior art products are identical or substantially identical in structure or composition, or are produced by identical or substantially identical processes, a prima facie case of either anticipation or obviousness has been established. In re Best, 562 F.2d 1252, 1255, 195 USPQ 430, 433 (CCPA 1977). "When the PTO shows a sound basis for believing that the products of the applicant and the prior art are the same, the applicant has the burden of showing that they are not." In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990) (underline added).
Applicant’s assertion that the combined references do not teach "generating a population of immobilized biotinylated transcription factor polypeptides, wherein the population of biotinylated transcription factor polypeptides in step (b) are expressed from templates that are PCR amplified directly from genomic DNA in a clone-free workflow" as recited in claim 1, is not found persuasive. Please see the discussion supra regarding step (c), and that the term “wherein the population of biotinylated transcription factor polypeptides in step (b) are expressed from templates that are PCR amplified directly from genomic DNA in a clone-free workflow” is indefinite under 35 USC 112(b). As an initial matter, the placement of this limitation in claim 1(c) is confusing because it recites a limitation with respect to claim 1(b), and where claim 1(b) recites a limitation that reads on claim 1(a). As noted supra, although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. Additionally, MPEP § 2173 states that the specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the Applicant regards as his invention. However, the meaning, procedures, processes, and/or components encompassed by the term “clone-free workflow” is completely unclear.
Moreover, the Examiner contends that the combined references teach all of the limitations of the claims. For example –
O’Malley teaches:
DAP-seq, a high throughput assay that uses in vitro expressed TF to interrogate naked gDNA fragments to establish binding locations and sequence motifs (interpreted as transcription factor polypeptides expressed from templates, and genomic DNA) (pg. 1281, col 1; first full paragraph).
HALO-tagged TFs were expressed in an in vitro wheat germ system (interpreting the wheat germ system as a clone-free workflow) (pg. 1292, col 1, first full paragraph).
A gDNA library is prepared by in vitro expression, bound to ligand-coupled beads. The gDNA library is added to the affinity-bound TF, the unbound DNA is washed away, and the bound fraction is eluted, amplified with PCR primers to introduce an indexed adaptor (interpreted as transcription factor polypeptides in step (b) are expressed from templates that are PCR amplified directly from genomic DNA) (pg. 1281, col 1, second full paragraph).
Hook teaches:
Cell-free expression systems generate protein from nucleic acid in as little as 60 minutes, where some systems require an mRNA template, but coupled transcription/translation systems can use plasmid DNA or a PCR product as a template, eliminating the need to transcribe DNA into RNA first (interpreted as a clone-free workflow).
The Transcend System, wherein tRNA is charged with a biotin-labeled lysine residue; where biotinylated lysine is added to the translation reaction as a charged e-labeled biotinylated lysine:tRNA complex (interpreted as Biotin-Dap-Seq), wherein the as-filed Specification teaches that Biotin-Dap-seq is a clone-free workflow (paragraph [0039])..
Promega offers cell-free expression systems based on lysates from mammalian, plant, bacterial, and insect cells (interpreted as a clone-free workflow).
Proteins were expressed using RRL-based and WGE-based cell-free expression systems and labeled using the FluoroTect GreenLys tRNA (interpreted as a clone-free workflow).
The combined references of O’Malley and Hook teach all of the limitations of the claims. Thus, the claims remain rejected.
New Objections/Rejections
Claim Objections
Claims 1, 2 and 10-12 are objected to because of the following informalities: a clean copy of the claims is respectfully requested because Applicant has made a multitude of changes to the claims resulting in significant portions of the recitation being lined-through, such that the claims are visually challenging to the Examiner, and it is difficult for the Examiner to correctly decipher the claimed invention.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 2 and 10-12 are rejected under 35 U.S.C. 102(a1)/102(a2) as being anticipated by Baumgart et al. (hereinafter “Baumgart”) (Nature Methods, November 2021, 18, 1499-1505).
Regarding claims 1, 2 and 10-12, Baumgart teaches biotin-DAP-seq, a streamlined clone-free workflow where tagged TF proteins are expressed from templates that are PCR-amplified directly from gDNA or complementary DNA (cDNA) (Fig. 1), where first, primers were designed flanking the TF of interest, such that the primers contained a T7 promoter and other required components for expression with a commercial in vitro coupled transcription and translation mix but did not contain an affinity tag sequence; instead, a biotin tag was introduced directly during translation by spiking in a transfer RNA loaded with biotinylated lysine, which resulted in the incorporation of biotin tags at a random subset of lysine codons within the protein sequence, wherein this biotin tag allowed for downstream affinity capture of TFs along with bound DNA sequences using streptavidin-coated magnetic beads (interpreted as PCR amplification; and magnetic beads, claim 1, 2, and 10-12) (pg. 1149, col 2, last partial paragraph; and pg. 1500, col 1, first partial paragraph). Baumgart teaches in Figure 1, a schematic illustration of biotin-DAP-seq for streamlined protein expression directly from PCR products amplified from gDNA or cDNA, which circumvents the need for plasmid construction, wherein tRNA loaded with biotinylated lysine results in incorporation of biotin tags at a random subset of positions that encode a lysine within the TF amnio acid sequence (interpreted as steps (a)-(i) including biotinylated TF proteins are expressed from templates that are PCR amplified directly from genomic DNA in a clone-free workflow, claims 1 and 2) (pg. 1500, col 1, Figure 1). Baumgart teaches that Figure 2 is an overview of the multiDAP experimental setup and example of the resulting data, wherein: (a) Schematic illustration of biotin-OAP-seq for E.coli or P. simiae; (b) schematic illustration of multiDAP for 48 bacterial species, each with a unique molecular i5 barcode; (c) coverage plots for a P. simiae TF Ps356 are shown in black across a 10,000-bp window, wherein genes predicted to be regulated by Ps356 in each species are colored by predicted gene function; the percentages indicate BLAST amino acid identity to P. simiae orthologs (interpreted as the steps (b)-(i) as recited in claim 1, claims 1, 2 and 12) (pg. 1500, col 2, Figure 2). Figures 1 & 2 are shown below:
PNG
media_image6.png
104
480
media_image6.png
Greyscale
PNG
media_image7.png
550
490
media_image7.png
Greyscale
Baumgart teaches that based on the combination of molecular barcodes from each sequencing read, the dataset was computationally demultiplexed to yield the equivalent of one DAP-seq dataset per TF per organism; and after alignment to the corresponding genomes, regions that contained TF binding sites were apparent as peaks, resulting from the pileup of DNA fragments bound by the TF; and that by mapping the binding of the 354 TFs from E. coli and P. simiae across the set of 48 bacterial genomes, a combinatorial dataset equivalent to 17,000 DAP-seq experiments was produced, wherein this dataset allowed direct comparison across divergent bacterial species to reveal conserved patterns of TF binding at orthologous genes (Fig. 2c), such that binding information for 113 of the 138 (82%) P. simiae TFs and 107 of 216 (50%) of the E. coli TFs were recovered in a single-pass experiment (interpreted as mapping and comparing, claims 1h and 1i) (pg. 1500, col 2, last full paragraph).
Baumgart meets all the limitations of the claims and, therefore, anticipates the claimed invention.
For clarity, the Examiner suggests that Applicant amend claim 1 to recite each step as an individual active step that occurs in order. For example: “(a) obtaining cellular nucleic acids from a plurality of species of organisms; (b) amplifying the cellular nucleic acids…; (c) distributing a population of nucleic acid templates into individual wells…; (d) transcribing the population of nucleic acid template…, (e) expressing the population of biotinylated transcription factor polypeptides…; (f) incubating the population of biotinylated…,etc.”
Conclusion
Claims 1, 2 and 10-12 are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMY M BUNKER whose telephone number is (313) 446-4833. The examiner can normally be reached on Monday-Friday (6am-2:30pm).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached on (571) 272-2876. The fax phone number for the organization where this application or proceeding is assigned is (571) 273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY M BUNKER/Primary Examiner, Art Unit 1684