Prosecution Insights
Last updated: April 19, 2026
Application No. 17/753,368

ESCHERICHIA COLI-BASED RECOMBINANT STRAIN, CONSTRUCTION METHOD THEREFOR AND USE THEREOF

Non-Final OA §103
Filed
Feb 28, 2022
Examiner
STEADMAN, DAVID J
Art Unit
1656
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Heilongjiang Eppen Biotech Co. Ltd.
OA Round
3 (Non-Final)
58%
Grant Probability
Moderate
3-4
OA Rounds
3y 1m
To Grant
87%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allow Rate
553 granted / 955 resolved
-2.1% vs TC avg
Strong +29% interview lift
Without
With
+29.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 1m
Avg Prosecution
50 currently pending
Career history
1005
Total Applications
across all art units

Statute-Specific Performance

§101
9.0%
-31.0% vs TC avg
§103
26.7%
-13.3% vs TC avg
§102
19.4%
-20.6% vs TC avg
§112
29.6%
-10.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 955 resolved cases

Office Action

§103
DETAILED CORRESPONDENCE Status of the Application A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on December 16, 2025 has been entered. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1 and 4-13 are pending in the application. Applicant’s amendment to the claims, filed December 16, 2025, is acknowledged. This listing of the claims replaces all prior versions and listings of the claims. Applicant’s remarks and declaration under 37 CFR 1.132 (hereafter “Wei Declaration”) filed December 16, 2025 in response to the final rejection mailed September 16, 2025 and the advisory action mailed November 20, 2025 have been fully considered. The text of those sections of Title 35, U.S. Code or judicially created doctrine not included in this action can be found in a prior Office action. Restriction/Election In response to a requirement for restriction/election mailed March 25, 2025, applicant elected with traverse Group I, pending claims 1 and 5-8, in the reply filed May 14, 2025. The requirement was deemed proper and made FINAL in the Office communication mailed June 5, 2025. Claims 4 and 9-13 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to nonelected inventions, there being no allowable generic or linking claim. Claim Objections The objection to claim 1 is withdrawn in view of applicant’s amendment to recite “nucleic acid molecule consisting of.” The objection to claim 8 is withdrawn in view of applicant’s amendment to recite “wherein the host strain is selected from E. coli K12, a derivative of E. coli K12, E. coli K12 (W3110), or an E. coli CGMCC 7.232.” Claim 8 is objected to in the recitation of “E. coli K12 (W3110)” and in the interest of improving claim form, it is suggested that the noted phrase be amended to remove the parentheses from “(W3110)” and recite “E. coli K12 W3110.” Claim Rejections - 35 USC § 103 Claims 1 and 5-8 are rejected under 35 U.S.C. 103 as being unpatentable over Schneider et al. (US 2015/0072382 A1; cited on Form PTO-892 mailed June 5, 2025; hereafter “Schneider”) in view of “Start Codons” (University of Washington, obtained from https://depts.washington.edu/agro/genomes/students/stanstart.htm, 2004, 3 pages; cited on Form PTO-892 mailed September 16, 2025). As amended, claim 1 is drawn to a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 14; claims 5 and 6 are drawn to a recombinant vector, comprising the nucleic acid molecule according to claim 1; and claims 7 and 8 are drawn to a recombinant strain, comprising the nucleic acid molecule according to claim 1. Regarding claim 1, Schneider teaches SEQ ID NO: 1, which is an E. coli spoT gene encoding ppGppase (pp. 17-20). SEQ ID NO: 1 of Schneider has two nucleotide differences relative to instant SEQ ID NO: 14 – the first nucleotide difference being that SEQ ID NO: 1 of Schneider has T at nucleotide position 1, while instant SEQ ID NO: 14 has A at nucleotide position 1, and the second nucleotide difference being that SEQ ID NO: 1 of Schneider has G at nucleotide position 520, while instant SEQ ID NO: 14 has T at nucleotide position 520 (see Appendix for sequence alignment). Regarding the second nucleotide difference, Schneider teaches a mutation at position G174 (paragraphs [0016] and [0144]) and specifically teaches a G520T mutation (paragraph [0281]), which, as shown by SEQ ID NO: 1 of Schneider, replaces the codon GGT encoding glycine at position 174 with the codon TGT, which encodes cysteine. One of ordinary skill in the art would recognize that Schneider is teaching and/or suggesting a mutant spoT gene with a G520T mutation, thus teaching and/or suggesting the second nucleotide difference. The difference between Schneider and claim 1 is that Schneider does not teach and/or suggest the first nucleotide difference as described above. “Start Codons” teaches (p. 1, second full paragraph) there are many varieties of codons that can be used as start codons in bacteria, including ATG and TTG. According to “Start Codons,” while ATG is the most common start codon, all of these will put a methionine amino acid in the first position of the protein. “Start Codons” teaches that it is important to note that most start codons are ATG (>90%). In view of Schneider and “Start Codons,” it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Schneider’s mutant spoT gene with a G520T mutation (hereafter “Schneider’s mutant spoT gene” for brevity) by substituting T with A at nucleotide position 1. One of ordinary skill would have expected success and could have substituted T with A at nucleotide position 1 of Schneider’s mutant spoT gene because “Start Codons” taught either ATG or TTG can be used as a start codon in bacteria as each results in a methionine in the first position of the protein. One of ordinary skill would have found it obvious to make the substitution because, based on the relevant teachings of “Start Codons,” an ordinarily skilled artisan would have predicted that an ATG start codon in Schneider’s mutant spoT gene would result in a methionine in the first position of the protein. See MPEP 2143.I.B regarding a “simple substitution” obviousness rationale. Regarding claim 5, Schneider teaches a vector comprising the nucleic acid molecule (paragraph [0183]). Regarding claim 6, the recitation of “wherein the recombinant vector is constructed by…” is interpreted as a product-by-process limitation and does not structurally and/or functionally limit the recombinant vector. Regarding claim 7, Schneider teaches a cell overexpressing the variant nucleic acid (paragraph [0016]). Regarding claim 8, Schneider teaches the cell is E. coli strain W3110 (paragraph [0206]). Therefore, the invention of claims 1 and 5-8 would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. RESPONSE TO REMARKS: Applicant’s remarks and the Wei Declaration each contend that the relationship between structure and function of a protein is known to be rather predictable (it is presumed that applicant intended to rather state “unpredictable”), noting that even a single codon change can dramatically change a protein’s characteristics. Applicant’s arguments and Wei Declaration have been fully considered and are not found persuasive. Schneider teaches and/or suggests a mutant spoT gene with a G520T mutation. The only difference between Schneider’s mutant spoT gene and instant SEQ ID NO: 14 is that Schneider’s mutant spoT gene has T at nucleotide position 1, while instant SEQ ID NO: 14 has A at nucleotide position 1. As described above, in view of the teachings of “Start Codons,” it would have been obvious to modify Schneider’s mutant spoT gene by substituting T with A at nucleotide position 1. As taught by “Start Codons,” such a mutation would not have changed the encoded amino acid, i.e., the TTG codon of Schneider’s mutant spoT gene encodes methionine and Schneider’s mutant spoT gene modified with A at nucleotide position 1 also encodes methionine. As such, one of ordinary skill in the art would have expected no structural and/or functional differences between the polypeptide encoded by Schneider’s mutant spoT gene and the polypeptide encoded by Schneider’s mutant spoT gene modified with A at nucleotide position 1. Applicant’s remarks and the Wei Declaration each contend that Schneider’s encoded protein is for methionine synthesis, while the protein encoded by the nucleic acid molecule of claim 1 is for threonine synthesis. According to applicant, because of differences in the biosynthetic pathways for methionine and threonine, Schneider’s protein would not be fit for threonine synthesis. Applicant’s arguments and Wei Declaration have been fully considered and are not found persuasive. The rejected claims do not recite an intended use for threonine biosynthesis. Even assuming arguendo the rejected claims recited an intended use for threonine biosynthesis, the intended use of the claimed invention for threonine biosynthesis does not result in a structural and/or functional difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. See MPEP 2113 regarding product by process claims. For these reasons, it is the examiner’s position that the claimed invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Conclusion Status of the claims: Claims 1 and 4-13 are pending. Claims 4 and 9-13 are withdrawn. Claims 1 and 5-8 are rejected. No claim is in condition for allowance. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DAVID J STEADMAN whose telephone number is (571)272-0942. The examiner can normally be reached Monday to Friday, 7:30 AM to 4:00 PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MANJUNATH N RAO can be reached on 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /David Steadman/Primary Examiner, Art Unit 1656 APPENDIX US-14-375-940A-1 Filing date in PALM: 2014-07-31 Sequence 1, US/14375940A Publication No. US20150072382A1 GENERAL INFORMATION APPLICANT: Evonik Industries AG TITLE OF INVENTION: A cell with reduced ppGppase activity FILE REFERENCE: 201100331 CURRENT APPLICATION NUMBER: US/14/375,940A CURRENT FILING DATE: 2014-07-31 NUMBER OF SEQ ID NOS: 19 SEQ ID NO 1 LENGTH: 2109 TYPE: DNA ORGANISM: Escherichia coli str. K12 substr. MG1655 FEATURE: NAME/KEY: CDS LOCATION: (1)..(2106) OTHER INFORMATION: spoT(b3650, ECK3640) Accession NP_418107; bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase [Escherichia coli str. K-12 substr. MG1655]. Query Match 99.9%; Score 2106.4; Length 2109; Best Local Similarity 99.9%; Matches 2107; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 2 TGTATCTGTTTGAAAGCCTGAATCAACTGATTCAAACCTACCTGCCGGAAGACCAAATCA 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2 TGTATCTGTTTGAAAGCCTGAATCAACTGATTCAAACCTACCTGCCGGAAGACCAAATCA 61 Qy 62 AGCGTCTGCGGCAGGCGTATCTCGTTGCACGTGATGCTCACGAGGGGCAAACACGTTCAA 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 62 AGCGTCTGCGGCAGGCGTATCTCGTTGCACGTGATGCTCACGAGGGGCAAACACGTTCAA 121 Qy 122 GCGGTGAACCCTATATCACGCACCCGGTAGCGGTTGCCTGCATTCTGGCCGAGATGAAAC 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 122 GCGGTGAACCCTATATCACGCACCCGGTAGCGGTTGCCTGCATTCTGGCCGAGATGAAAC 181 Qy 182 TCGACTATGAAACGCTGATGGCGGCGCTGCTGCATGACGTGATTGAAGATACTCCCGCCA 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 182 TCGACTATGAAACGCTGATGGCGGCGCTGCTGCATGACGTGATTGAAGATACTCCCGCCA 241 Qy 242 CCTACCAGGATATGGAACAGCTTTTTGGTAAAAGCGTCGCCGAGCTGGTAGAGGGGGTGT 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 242 CCTACCAGGATATGGAACAGCTTTTTGGTAAAAGCGTCGCCGAGCTGGTAGAGGGGGTGT 301 Qy 302 CGAAACTTGATAAACTCAAGTTCCGCGATAAGAAAGAGGCGCAGGCCGAAAACTTTCGCA 361 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 302 CGAAACTTGATAAACTCAAGTTCCGCGATAAGAAAGAGGCGCAGGCCGAAAACTTTCGCA 361 Qy 362 AGATGATTATGGCGATGGTGCAGGATATCCGCGTCATCCTCATCAAACTTGCCGACCGTA 421 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 362 AGATGATTATGGCGATGGTGCAGGATATCCGCGTCATCCTCATCAAACTTGCCGACCGTA 421 Qy 422 CCCACAACATGCGCACGCTGGGCTCACTTCGCCCGGACAAACGTCGCCGCATCGCCCGTG 481 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 422 CCCACAACATGCGCACGCTGGGCTCACTTCGCCCGGACAAACGTCGCCGCATCGCCCGTG 481 Qy 482 AAACTCTCGAAATTTATAGCCCGCTGGCGCACCGTTTATGTATCCACCACATTAAAACCG 541 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Db 482 AAACTCTCGAAATTTATAGCCCGCTGGCGCACCGTTTAGGTATCCACCACATTAAAACCG 541 Qy 542 AACTCGAAGAGCTGGGTTTTGAGGCGCTGTATCCCAACCGTTATCGCGTAATCAAAGAAG 601 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 542 AACTCGAAGAGCTGGGTTTTGAGGCGCTGTATCCCAACCGTTATCGCGTAATCAAAGAAG 601 Qy 602 TGGTGAAAGCCGCGCGCGGCAACCGTAAAGAGATGATCCAGAAGATTCTTTCTGAAATCG 661 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 602 TGGTGAAAGCCGCGCGCGGCAACCGTAAAGAGATGATCCAGAAGATTCTTTCTGAAATCG 661 Qy 662 AAGGGCGTTTGCAGGAAGCGGGAATACCGTGCCGCGTCAGTGGTCGCGAGAAGCATCTTT 721 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 662 AAGGGCGTTTGCAGGAAGCGGGAATACCGTGCCGCGTCAGTGGTCGCGAGAAGCATCTTT 721 Qy 722 ATTCGATTTACTGCAAAATGGTGCTCAAAGAGCAGCGTTTTCACTCGATCATGGACATCT 781 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 722 ATTCGATTTACTGCAAAATGGTGCTCAAAGAGCAGCGTTTTCACTCGATCATGGACATCT 781 Qy 782 ACGCTTTCCGCGTGATCGTCAATGATTCTGACACCTGTTATCGCGTGCTGGGCCAGATGC 841 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 782 ACGCTTTCCGCGTGATCGTCAATGATTCTGACACCTGTTATCGCGTGCTGGGCCAGATGC 841 Qy 842 ACAGCCTGTACAAGCCGCGTCCGGGCCGCGTGAAAGACTATATCGCCATTCCAAAAGCGA 901 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 842 ACAGCCTGTACAAGCCGCGTCCGGGCCGCGTGAAAGACTATATCGCCATTCCAAAAGCGA 901 Qy 902 ACGGCTATCAGTCTTTGCACACCTCGATGATCGGCCCGCACGGTGTGCCGGTTGAGGTCC 961 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 902 ACGGCTATCAGTCTTTGCACACCTCGATGATCGGCCCGCACGGTGTGCCGGTTGAGGTCC 961 Qy 962 AGATCCGTACCGAAGATATGGACCAGATGGCGGAGATGGGTGTTGCCGCGCACTGGGCTT 1021 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 962 AGATCCGTACCGAAGATATGGACCAGATGGCGGAGATGGGTGTTGCCGCGCACTGGGCTT 1021 Qy 1022 ATAAAGAGCACGGCGAAACCAGTACTACCGCACAAATCCGCGCCCAGCGCTGGATGCAAA 1081 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1022 ATAAAGAGCACGGCGAAACCAGTACTACCGCACAAATCCGCGCCCAGCGCTGGATGCAAA 1081 Qy 1082 GCCTGCTGGAGCTGCAACAGAGCGCCGGTAGTTCGTTTGAATTTATCGAGAGCGTTAAAT 1141 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1082 GCCTGCTGGAGCTGCAACAGAGCGCCGGTAGTTCGTTTGAATTTATCGAGAGCGTTAAAT 1141 Qy 1142 CCGATCTCTTCCCGGATGAGATTTACGTTTTCACACCGGAAGGGCGCATTGTCGAGCTGC 1201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1142 CCGATCTCTTCCCGGATGAGATTTACGTTTTCACACCGGAAGGGCGCATTGTCGAGCTGC 1201 Qy 1202 CTGCCGGTGCAACGCCCGTCGACTTCGCTTATGCAGTGCATACCGATATCGGTCATGCCT 1261 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1202 CTGCCGGTGCAACGCCCGTCGACTTCGCTTATGCAGTGCATACCGATATCGGTCATGCCT 1261 Qy 1262 GCGTGGGCGCACGCGTTGACCGCCAGCCTTACCCGCTGTCGCAGCCGCTTACCAGCGGTC 1321 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1262 GCGTGGGCGCACGCGTTGACCGCCAGCCTTACCCGCTGTCGCAGCCGCTTACCAGCGGTC 1321 Qy 1322 AAACCGTTGAAATCATTACCGCTCCGGGCGCTCGCCCGAATGCCGCTTGGCTGAACTTTG 1381 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1322 AAACCGTTGAAATCATTACCGCTCCGGGCGCTCGCCCGAATGCCGCTTGGCTGAACTTTG 1381 Qy 1382 TCGTTAGCTCGAAAGCGCGCGCCAAAATTCGTCAGTTGCTGAAAAACCTCAAGCGTGATG 1441 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1382 TCGTTAGCTCGAAAGCGCGCGCCAAAATTCGTCAGTTGCTGAAAAACCTCAAGCGTGATG 1441 Qy 1442 ATTCTGTAAGCCTGGGCCGTCGTCTGCTCAACCATGCTTTGGGTGGTAGCCGTAAGCTGA 1501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1442 ATTCTGTAAGCCTGGGCCGTCGTCTGCTCAACCATGCTTTGGGTGGTAGCCGTAAGCTGA 1501 Qy 1502 ATGAAATCCCGCAGGAAAATATTCAGCGCGAGCTGGATCGCATGAAGCTGGCAACGCTTG 1561 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1502 ATGAAATCCCGCAGGAAAATATTCAGCGCGAGCTGGATCGCATGAAGCTGGCAACGCTTG 1561 Qy 1562 ACGATCTGCTGGCAGAAATCGGACTTGGTAACGCAATGAGCGTGGTGGTCGCGAAAAATC 1621 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1562 ACGATCTGCTGGCAGAAATCGGACTTGGTAACGCAATGAGCGTGGTGGTCGCGAAAAATC 1621 Qy 1622 TGCAACATGGGGACGCCTCCATTCCACCGGCAACCCAAAGCCACGGACATCTGCCCATTA 1681 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1622 TGCAACATGGGGACGCCTCCATTCCACCGGCAACCCAAAGCCACGGACATCTGCCCATTA 1681 Qy 1682 AAGGTGCCGATGGCGTGCTGATCACCTTTGCGAAATGCTGCCGCCCTATTCCTGGCGACC 1741 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1682 AAGGTGCCGATGGCGTGCTGATCACCTTTGCGAAATGCTGCCGCCCTATTCCTGGCGACC 1741 Qy 1742 CGATTATCGCCCACGTCAGCCCCGGTAAAGGTCTGGTGATCCACCATGAATCCTGCCGTA 1801 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1742 CGATTATCGCCCACGTCAGCCCCGGTAAAGGTCTGGTGATCCACCATGAATCCTGCCGTA 1801 Qy 1802 ATATCCGTGGCTACCAGAAAGAGCCAGAGAAGTTTATGGCTGTGGAATGGGATAAAGAGA 1861 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1802 ATATCCGTGGCTACCAGAAAGAGCCAGAGAAGTTTATGGCTGTGGAATGGGATAAAGAGA 1861 Qy 1862 CGGCGCAGGAGTTCATCACCGAAATCAAGGTGGAGATGTTCAATCATCAGGGTGCGCTGG 1921 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1862 CGGCGCAGGAGTTCATCACCGAAATCAAGGTGGAGATGTTCAATCATCAGGGTGCGCTGG 1921 Qy 1922 CAAACCTGACGGCGGCAATTAACACCACGACTTCGAATATTCAAAGTTTGAATACGGAAG 1981 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1922 CAAACCTGACGGCGGCAATTAACACCACGACTTCGAATATTCAAAGTTTGAATACGGAAG 1981 Qy 1982 AGAAAGATGGTCGCGTCTACAGCGCCTTTATTCGTCTGACCGCTCGTGACCGTGTGCATC 2041 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1982 AGAAAGATGGTCGCGTCTACAGCGCCTTTATTCGTCTGACCGCTCGTGACCGTGTGCATC 2041 Qy 2042 TGGCGAATATCATGCGCAAAATCCGCGTGATGCCAGACGTGATTAAAGTCACCCGAAACC 2101 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2042 TGGCGAATATCATGCGCAAAATCCGCGTGATGCCAGACGTGATTAAAGTCACCCGAAACC 2101 Qy 2102 GAAATTAA 2109 |||||||| Db 2102 GAAATTAA 2109
Read full office action

Prosecution Timeline

Feb 28, 2022
Application Filed
Jun 04, 2025
Non-Final Rejection — §103
Aug 27, 2025
Response Filed
Sep 12, 2025
Final Rejection — §103
Nov 17, 2025
Response after Non-Final Action
Dec 16, 2025
Response after Non-Final Action
Dec 16, 2025
Request for Continued Examination
Dec 17, 2025
Response after Non-Final Action
Jan 12, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12601016
GENETICALLY ENCODED FLUORESCENT INDICATORS UNDER OPTOGENETIC CONTROL AND USES THEREOF
2y 5m to grant Granted Apr 14, 2026
Patent 12589139
Clostridial Neurotoxins Comprising an Exogenous Activation Loop
2y 5m to grant Granted Mar 31, 2026
Patent 12577597
TRANSGENIC MICROORGANISMS AND SYNTHESIS OF PIPERAZIC ACID, PIPERAZIC ACID CONTAINING PRODUCTS, AND DERIVATIVES THEREOF
2y 5m to grant Granted Mar 17, 2026
Patent 12570693
METHOD OF PRODUCING A TRIPEPTIDE GAMMA-GLU-VAL-GLY USING ENTEROBACTERIACEAE
2y 5m to grant Granted Mar 10, 2026
Patent 12545860
MANNANASE VARIANTS
2y 5m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
58%
Grant Probability
87%
With Interview (+29.1%)
3y 1m
Median Time to Grant
High
PTA Risk
Based on 955 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month