Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
This action is in response to the papers filed September 2, 2025.
Amendments
Applicant's response and amendments, filed September 2, 2025, is acknowledged. Applicant has cancelled Claims 1-3 and 7, and amended Claims 4, 8, and 11-14.
Claims 4-6 and 8-14 are pending.
Priority
This application is a 371 of PCT/IB2020/059975 filed on October 23, 2020.
Acknowledgment is made of Applicant’s claim for foreign priority to EPO 19210760.5 filed on November 21, 2019 under 35 U.S.C. 119(a)-(d).
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on September 2, 2025 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
The Examiner cites below Applicant's own prior art, not cited in an IDS, to wit:
Hartl et al (WO 17/093931).
Applicant is reminded of their duty to disclose information material to patentability. See MPEP §2001 and 37 C.F.R. 1.56.
The individuals covered by 37 CFR 1.56 have a duty to bring to the attention of the examiner, or other Office official involved with the examination of a particular application, information within their knowledge as to other copending United States applications which are "material to patentability" of the application in question. As set forth by the court in Armour & Co. v. Swift & Co., 466 F.2d 767, 779, 175 USPQ 70, 79 (7th Cir. 1972):
[W]e think that it is unfair to the busy examiner, no matter how diligent and well informed he may be, to assume that he retains details of every pending file in his mind when he is reviewing a particular application . . . [T]he applicant has the burden of presenting the examiner with a complete and accurate record to support the allowance of letters patent.
See MPEP §2001.06(b).
Pursuant to the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.), a copy of the Applicant's own publication(s) are not provided with the instant Office Action because it is presumed that Applicant has a copy of their own publications, as such is routine practice in the art, and that Applicant has provided their representative with a copy of said publications to establish a prosecution record. However, if Applicant’s representative insists upon receiving a copy of the entire references, then the Examiner will make attempts to provide it in the next Office Action.
Claim Objections
1. The prior objection to Claim 8 is withdrawn in light of Applicant’s amendment to the claim.
Claim Rejections - 35 USC § 101
2. The prior rejection of Claims 1, 3, and 12 under 35 U.S.C. 101 is withdrawn in light of Applicant’s cancellation of Claims 1 and 3, and amendment to Claim 12.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
3. The prior rejection of Claim(s) 3 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of the claim.
4. The prior rejection of Claim(s) 4-6 and 9-10 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to Claim 4, which the Examiner finds persuasive.
5. The prior rejection of Claim(s) 8 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to Claim 8, which the Examiner finds persuasive.
6. The prior rejection of Claim(s) 1-6 and 8-14 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to Claim 4 to recite “comprising the nucleic acid sequence of SEQ ID NO:1”, which the Examiner finds persuasive.
7. The prior rejections of Claim(s) 1-6 and 9-14 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement, are withdrawn in light of Applicant’s amendment to Claim 4 to recite “comprising the nucleic acid sequence of SEQ ID NO:1”, which the Examiner finds persuasive.
8. Claim(s) 8 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 4 has been amended to recite an isolated nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:1 (2000 nucleotides in length) [structure].
Claim 8 recites “an expression cassette according to claim 4”, and thus is broader in scope than the nucleic acid sequence of SEQ ID NO:1. That is to say, the breadth of the claim reasonably encompasses a genus of SEQ ID NO:1 variants [structures] that are to have the functional property of “promoting gene expression in agmat-positive cells in layer 2/3 of mouse cortex” [function].
The claim denotes that not all nucleic acid molecules comprising SEQ ID NO:1 (2000 nucleotides in length) [structure] and/or not all nucleic acid molecules comprising at least 1400 nucleotides having at least 80% identity to SEQ ID NO:1 [structure] will necessarily and predictably have the recited functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex [function] when said exogenous gene is operatively linked to said SEQ ID NO:1 or variant thereof.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The claims are broad for reasonably encompassing an enormously vast genus of structurally and functionally undisclosed SEQ ID NO:1 promoter variants.
The promoter of SEQ ID NO:1 is 2000 nucleotides in length.
The promoter of at least 1400 nucleotides (70% identity to SEQ ID NO:1) and having at least 80% identity to SEQ ID NO:1 encompasses variants having as little as 56% identity to SEQ ID NO:1, as it comprises at least 600 nucleotide deletions and 280 nucleotide substitutions and/or insertions dispersed across the claimed length.
56% identity to SEQ ID NO:1 allows for 880 nucleotide substitutions, deletions, and/or insertion.
80% identity of 1400 nucleotides allows for 280 substitutions, deletions, and/or insertions.
90% identity of 1400 nucleotides allows for 140 substitutions, deletions, and/or insertions.
95% identity of 1400 nucleotides allows for 70 substitutions, deletions, and/or insertions.
4^880 = an essentially infinite genus of structurally and functionally undisclosed SEQ ID NO:1 promoter variants.
4^280 = 4x10^168 structurally and functionally undisclosed SEQ ID NO:1 promoter variants.
4^140 = 2x10^84 structurally and functionally undisclosed SEQ ID NO:1 promoter variants.
4^70 = 2x10^25 structurally and functionally undisclosed SEQ ID NO:1 promoter variants.
(www.calculator.net/exponent-calculator; last visited April 3, 2025)
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
The claims fail to recite, and the specification fails to disclose, a first nucleic acid of an essentially infinite genus of structurally and functionally undisclosed variants of SEQ ID NO:1 that necessarily and predictably has the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, as opposed to a second nucleic acid of an essentially infinite genus of structurally and functionally undisclosed variants of SEQ ID NO:1 that does not have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, for example.
The claims fail to recite, and the specification fails to disclose, a first nucleic acid of an enormously vast genus of about 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that necessarily and predictably has the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, as opposed to a second nucleic acid of an enormously vast genus of about 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that does not have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, for example.
The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first nucleic acid of an essentially infinite genus of structurally and functionally undisclosed variants of SEQ ID NO:1 that does not have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, into a second nucleic acid of an essentially infinite genus of structurally and functionally undisclosed variants of SEQ ID NO:1 that now, necessarily and predictably has the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, for example.
The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first nucleic acid of an enormously vast genus of about 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that does not have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, into a second nucleic acid of an enormously vast genus of about 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that now, necessarily and predictably has the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variant, for example.
The specification is silent to a structure/function nexus and analysis of different nucleotide sequences within SEQ ID NO:1 and/or one or more, as many as 70, 140, 280, and/or 880, substitutions, deletions, and/or insertion variants of SEQ ID NO:1, thereby identifying and disclosing the actual required nucleotides that necessarily and predictably achieve the recited functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variants.
Rather, the only species disclosed is SEQ ID NO:1 itself.
"The claimed invention as a whole may not be adequately described if the claims require an essential or critical element which is not adequately described in the specification and which is not conventional in the art", "when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus", "in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus''. MPEP §2163
An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention. Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997).
Possession may also be shown in a variety of ways including description of an actual reduction to practice, or by showing that the invention was ''ready for patenting'' such as by the disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention. See, e.g., Pfaff v. Wells Elecs., Inc., 525 U.S. 55, 68, 1 19 S.Ct. 304, 312, 48 USPQ2d 1641, 1647 (1998), Regents of the University of California v. Eli Lilly, 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997)*, Amgen, Inc. v. Chugai Pharmaceutical, 927 F.2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) (one must define a compound by ''whatever characteristics sufficiently distinguish it'').
Therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. See Fiers v. Revel, 25 USPQ2d 1602 at 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. In Fiddes, claims directed to mammalian FGF's were found to be unpatentable due to lack of written description for that broad class. The specification provided only the bovine sequence.
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function … does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the promoter comprises SEQ ID NO:1 tells you nothing about the enormously vast genus of about infinite, 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that are to have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variants.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
In the instant case, Applicant seeks to monopolize an enormously vast genus of about infinite, 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that are to have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variants.
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Rather, the only species disclosed is SEQ ID NO:1 itself.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
See further discussion below in the 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, enablement rejection.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
Response to Arguments
Applicant argues that the amendment to Claim 4 renders the rejection moot.
Applicant’s argument(s) has been fully considered, but is not persuasive. Claim 8 recites “an expression cassette according to claim 4”, and thus is broader in scope than the nucleic acid sequence of SEQ ID NO:1. That is to say, the breadth of the claim reasonably encompasses a genus of SEQ ID NO:1 variants [structures] that are to have the functional property of “promoting gene expression in agmat-positive cells in layer 2/3 of mouse cortex” [function].
The Examiner suggests amending Claim 8 to recite “the expression cassette of claim 4”.
9. Claim 8 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, while being enabling for a promoter comprising SEQ ID NO:1 having the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1,
does not reasonably provide enablement for an enormously vast genus of about infinite, 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that are to have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variants.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention. If not, whether an artisan would have required undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make or use the invention based on the content of the disclosure is “undue” (In re Wands, 858 F.2d 731, 737, 8 USPQ2ds 1400, 1404 (Fed. Cir. 1988)). Furthermore, USPTO does not have laboratory facilities to test if an invention will function as claimed when working examples are not disclosed in the specification. Therefore, enablement issues are raised and discussed based on the state of knowledge pertinent to an art at the time of the invention. And thus, skepticism raised in the enablement rejections are those raised in the art by artisans of expertise.
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejection.
With respect to Claim 8, there is a gap in the nexus of the claims because while the claim preamble recites “a method of expressing a gene in agmat-positive cells in layer 2/3 of mouse cortex”, the positively recited step is the transfection of an isolated cell, an isolated cell line, or an isolated cell population. This is an in vitro/ex vivo context, not in vivo context.
The positively recited action-taking step(s) are not sufficient to achieve the requirement of the preamble.
The claim is rejected for lack of enablement for failing to positively recite the method step that achieves the preamble of the claim. In order for the claimed method to be enabled, the claim must recite a method step that provides for the results of the method as claimed.
The cell, cell line, and/or cell population is recited at a high level of generality, e.g. stem cells, fibroblasts, lung cells, skin cells, bacterial cells, yeast cells, plant cells, etc…, for which the specification discloses that the enormously vast genus of biologically different host cells would necessarily and predictably achieve “expressing a gene in agmat-positive cells in layer 2/3 of mouse cortex”, when isolated, nor let alone if implanted into mouse brain.
Skarnes et al (A conditional knockout resource for the genome-wide study of mouse gene function, Nature 474: 8 pages, doi: 10.1038/nature10163, 2011), as evidenced by GenBank JN950189.1, mouse agamnitase knock-out tagged allele, 2011) is considered relevant prior art for having taught an isolated nucleic acid molecule, e.g. long-range PCR of genomic DNA from genomic knock-out/tagged insertion alleles (e.g. pg 5, col. 2, Methods, LR-PCR genotyping) comprising a nucleic acid sequence that is 100% identical to instant SEQ ID NO:1, as evidenced by GenBank JN950189.1.
Skarnes et al taught a population of isolated embryonic stem cells whose genomes comprise a mouse agamnitase promoter operably linked to a heterologous transgene, e.g. LacZ reporter (e.g. pg 5, col. 2, Methods, ES cells).
Skarnes et al do not teach wherein the nucleic acid molecule “leads to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex”.
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the promoter comprises SEQ ID NO:1 tells you nothing about the enormously vast genus of about infinite, 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that are to have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variants.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
In the instant case, Applicant seeks to monopolize an enormously vast genus of about infinite, 4x10^168, 2x10^84, and/or 2x10^25 structurally and functionally undisclosed variants of SEQ ID NO:1 that are to have the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variants.
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
The specification is silent to a structure/function nexus and analysis of different nucleotide sequences within SEQ ID NO:1 and/or one or more, as many as 70, 140, 280, and/or 880, substitutions, deletions, and/or insertion variants of SEQ ID NO:1, thereby identifying and disclosing the actual required nucleotides that necessarily and predictably achieve the recited functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1 variants.
Rather, the only species disclosed is SEQ ID NO:1 itself.
Accordingly, limiting the claims to a promoter comprising SEQ ID NO:1 having the functional property of leading to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex when said exogenous gene is operatively linked to said SEQ ID NO:1, is proper.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
Response to Arguments
Applicant argues that the amendment to Claim 4 renders the rejection moot.
Applicant’s argument(s) has been fully considered, but is not persuasive. Claim 8 recites “an expression cassette according to claim 4”, and thus is broader in scope than the nucleic acid sequence of SEQ ID NO:1. That is to say, the breadth of the claim reasonably encompasses a genus of SEQ ID NO:1 variants [structures] that are to have the functional property of “promoting gene expression in agmat-positive cells in layer 2/3 of mouse cortex” [function].
The Examiner suggests amending Claim 8 to recite “the expression cassette of claim 4”.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
10. The prior rejection of Claim(s) 1 and 3 under 35 U.S.C. 102(a)(1) as being anticipated by Morris et al (U.S. Patent 7,892,730) is withdrawn in light of Applicant’s cancellation of the claims.
11. Claim(s) 4-5, 9-10, and 12 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Skarnes et al (A conditional knockout resource for the genome-wide study of mouse gene function, Nature 474: 8 pages, doi: 10.1038/nature10163, 2011), as evidenced by GenBank JN950189.1 (mouse agamnitase knock-out tagged allele, 2011).
With respect to Claim 4, Skarnes et al is considered relevant prior art for having taught an isolated nucleic acid molecule, e.g. long-range PCR of genomic DNA from genomic knock-out/tagged insertion alleles (e.g. pg 5, col. 2, Methods, LR-PCR genotyping) comprising a nucleic acid sequence that is 100% identical to instant SEQ ID NO:1, as evidenced by GenBank JN950189.1.
Skarnes et al do not teach wherein the nucleic acid molecule “leads to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex”.
However, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The phrase “leads to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex” is an intended use limitation, which does not contain any further structural limitations with respect to claimed nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 comprising the lacZ-tagged mutant allele (see MPEP §2114).
Furthermore, "products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product does not inherently possess the same properties as the instantly claimed product.
The LR-PCR amplified DNA inherently and naturally comprises an expression cassette per the LacZ transgene now operatively linked to the mouse agamnitase promoter comprising SEQ ID NO:1.
With respect to Claim 12, the term “kit” is recited at a high level of generality, and reasonably encompasses the isolated nucleic acid itself.
However, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The phrase “kit” is an intended use limitation, which does not contain any further structural limitations with respect to claimed nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 comprising the lacZ-tagged mutant allele (see MPEP §2114).
Furthermore, "products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product does not inherently possess the same properties as the instantly claimed product.
With respect to Claims 9-10, Skarnes et al taught ES cells whose genomes have been genetically modified to comprise the heterologous expression cassette operably linked to the mouse agamnitase promoter (e.g. pg 5, col. 2, Methods, ES cells).
Thus, Skarnes et al anticipate the claim.
Response to Arguments
Applicant argues that the expression vector of Skarnes et al comprises a human beta actin promoter.
Applicant’s argument(s) has been fully considered, but is not persuasive. The presence of a human beta actin promoter does not take away from the fact that the expression vector of Skarnes et al inherently comprises a nucleic acid sequence that is 100% identical to instant SEQ ID NO:1 upstream of and operably linked to an exogenous gene.
The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Instant claims do not prohibit the presence of a human beta actin promoter in the claimed expression vector recited at a high level of generality.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
12. Claim(s) 11 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Skarnes et al (2011) and GenBank JN950189.1 (2011), as applied to Claims 4-5, 9-10, and 12 above, and in further view of Spergel et al (Using reporter genes to label selected neuronal populations in transgenic mice for gene promoter, anatomical, and physiological studies, Progress in Neurobiology 63: 673-686, 2001).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Skarnes et al taught wherein the promoter is operably linked to a LacZ-tagged expression cassette.
Skarnes et al do not teach wherein the promoter is operably linked to light-sensitive protein-tagged expression cassette.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 11, Spergel et al is considered relevant prior art for having taught the use of gene tagging vectors in mice, whereby the tagged reporter gene may be LacZ, GFP, or YFP (a variant of GFP) (e.g. Abstract; Figure 1; Figures 3-8; pg 683, col. 2).
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology, cloning, and designs of promoter-reporter constructs. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first reporter tag, e.g. LacZ, as taught by Skarnes et al, with a second reporter tag, i.e. the light-sensitive protein GFP of YFP (a variant of GFP) as taught be Spergel et al, in a promoter-tagged expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first reporter tag, e.g. LacZ, with a second reporter tag, i.e. the light-sensitive protein GFP or YFP, in a promoter-tagged expression cassette because Spergel et al taught that promoter activity can be easily and readily detected in vivo in live cells using GFP; whereas, it is difficult to deliver the LacZ substrate to live cells in the brain (e.g. Table 1), and successfully demonstrated imaging GFP in vivo in live cells (Figures 3-6 and 8).
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Spergel et al do not cure the defect of Skarnes et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Skarnes et al are discussed above and incorporated herein. Applicant does not contest the teachings of Spergel et al as applied to the obviousness to substitute a first reporter tag, e.g. LacZ, as taught by Skarnes et al, with a second reporter tag, i.e. the light-sensitive protein GFP of YFP (a variant of GFP) as taught be Spergel et al, in a promoter-tagged expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first reporter tag, e.g. LacZ, with a second reporter tag, i.e. the light-sensitive protein GFP or YFP, in a promoter-tagged expression cassette because Spergel et al taught that promoter activity can be easily and readily detected in vivo in live cells using GFP; whereas, it is difficult to deliver the LacZ substrate to live cells in the brain (e.g. Table 1), and successfully demonstrated imaging GFP in vivo in live cells (Figures 3-6 and 8).
13. Claim(s) 11 and 14 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Skarnes et al (2011), GenBank JN950189.1 (2011), and Spergel et al (2001), as applied to Claims 4-5, 9-10, and 12 above, and in further view of Zhao et al (Cell type–specific channelrhodopsin-2 transgenic mice for optogenetic dissection of neural circuitry function, Nature Methods 8(9): 745-755, 2011).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Skarnes et al nor Spergel et al teach wherein the promoter is operably linked to a light-sensitive protein, to wit, a channelrhodopsin.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 11 and 14, Zhao et al is considered relevant prior art for having taught the use of gene tagging vectors in mice, whereby the tagged reporter gene encodes a channelrhodopsin and YFP (a variant of GFP) (e.g. Abstract; pg 745, col. 2, “VGAT-ChR2-EYFP transgenic mice”).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify a gene tagging expression cassette to comprise a channelrhodopsin and YFP with a reasonable expectation of success because Zhao et al taught and successfully demonstrated the ability to use both the YFP marker to identify the artisan’s neural cell type of interest in vivo, followed by selectively activity said cell using the channelrhodopsin, thereby allowing the ordinary artisan to dissect the neural circuitry function of the target cell.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Zhao et al do not cure the defect of Skarnes et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Skarnes et al are discussed above and incorporated herein. Applicant does not contest the teachings of Zhao et al as applied to the obviousness to modify a gene tagging expression cassette to comprise a channelrhodopsin and YFP with a reasonable expectation of success because Zhao et al taught and successfully demonstrated the ability to use both the YFP marker to identify the artisan’s neural cell type of interest in vivo, followed by selectively activity said cell using the channelrhodopsin, thereby allowing the ordinary artisan to dissect the neural circuitry function of the target cell.
14. Claim(s) 4-5, 8-10, and 12 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Shao et al (Cloning and comparative analysis the proximal promoter activities of arginase and agmatinase genes in Apostichopus japonicus (sea cucumber), Dev. Comparative Immunology 65: 299-308, 2016) in view of Bernstein et al (The agmatine-degrading enzyme agmatinase: a key to agmatine signaling in rat and human brain? Amino Acids 40: 453-465, 2011; hereafter Bernstein-1), Bernstein et al (Agmatinase, an inactivator of the putative endogenous antidepressant agmatine, is strongly upregulated in hippocampal interneurons of subjects with mood disorders, Neuropharmacol. 62: 237-246, 2012; hereafter Bernstein-2), Santos et al (Mechanisms involved in the antinociception caused by agmatine in mice, Neuropharmacol. 48: 1021-1034, 2005), Meylan et al (Involvement of the agmatinergic system in the depressive-like phenotype of the Crtc1 knockout mouse model of depression Translational Psychiatry 6: e852, 11 pages, doi: 10.1038/tp.2016.116, July 12, 2016), Skarnes et al (2011), and GenBank JN950189.1 (2011).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Shao et al is considered relevant prior art for having taught the cloning of a sea cucumber agmatinase gene promoter (e.g. Figure 2, -699 to +202) into a promoter-reporter expression vector (e.g. Figure 4).
Shao et al do not teach wherein the agmatinase promoter is a mouse agmatinase promoter.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 4, Bernstein-1 is considered relevant prior art for having taught that agmatinase is specifically expressed in rat cortical interneurons (e.g. cerebral cortex layers II/II, pg 458, col. 1), and that agmatinase may be important for pathogenesis of some mental disorders (e.g. Abstract).
Bernstein-2 is considered relevant prior art for having taught that the human agmatinase gene has been linked to bipolar disorder and major depression, and shows strongly elevated, significantly increased, expression in the brains of depressive patients, suggesting a functional relevance of the enzyme in the pathophysiology of human affective disorders (e.g. Abstract).
Santos et al is considered relevant prior art for having taught that agmatine, which is broken down into putrescine and urea via agmatinase (e.g. pg 1022, col. 1), exerts neuromodulatory functions in the central nervous system, including pain inhibition (syn. antinociception) in mouse models.
Meylan et al is considered relevant prior art for having taught that agmatinase is strongly upregulated in the cortex of a mouse model for depression (Crtc1 knockout mice), and that there is an increased number of agmat-expressing cells, implicating mouse agmatinase in the depressive-like phenotype of the mice, and indicating that agmatinase has a role in major depression (e.g. Abstract).
Skarnes et al is considered relevant prior art for having taught an isolated nucleic acid molecule, e.g. long-range PCR of genomic DNA from genomic knock-out/tagged insertion alleles (e.g. pg 5, col. 2, Methods, LR-PCR genotyping) comprising a nucleic acid sequence that is 100% identical to instant SEQ ID NO:1, as evidenced by GenBank JN950189.1.
Skarnes et al do not teach wherein the nucleic acid molecule “leads to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex”.
However, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The phrase “leads to the specific expression of an exogenous gene in agmat-positive cells in layer 2/3 of mouse cortex” is an intended use limitation, which does not contain any further structural limitations with respect to claimed nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 comprising the lacZ-tagged mutant allele (see MPEP §2114).
Furthermore, "products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product does not inherently possess the same properties as the instantly claimed product.
Bernstein-1 taught that agmatinase is specifically expressed in rat cortical interneurons (e.g. cerebral cortex layers II/II, pg 458, col. 1).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first agmatinase promoter, as taught by Shao et al, with a second agmatinase promoter comprising the nucleotide sequence of SEQ ID NO:1, as taught be Skarnes et al, in a promoter-reporter expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first agmatinase promoter with a second agmatinase promoter comprising the nucleotide sequence of SEQ ID NO:1 in a promoter-reporter expression cassette because those of ordinary skill in the art previously recognized that agmatinase plays an important role in the pathophysiology of rodent and human affective disorders (e.g. Berstein-1, Bernstein-2, Santos et al, Meylan et al), and that those of ordinary skill in the art have long-recognized and successfully reduced to practice the use of promoter-reporter expression vectors to study the mechanism(s) by which transcription of the artisan’s target gene of interest is achieved (e.g. Shao et al), thereby identifying the core promoter and/or transcriptional regulatory elements the regulate the promoter.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claim 5, Shao et al taught the expression vector comprises an expression cassette comprising the agmatinase promoter operably linked to a heterologous gene of interest, to wit, luciferase.
The LR-PCR amplified DNA inherently and naturally comprises an expression cassette per the LacZ transgene now operatively linked to the mouse agamnitase promoter comprising SEQ ID NO:1.
With respect to Claim 12, the term “kit” is recited at a high level of generality, and reasonably encompasses the isolated nucleic acid itself.
However, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The phrase “kit” is an intended use limitation, which does not contain any further structural limitations with respect to claimed nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 comprising the lacZ-tagged mutant allele (see MPEP §2114).
Furthermore, "products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product does not inherently possess the same properties as the instantly claimed product.
Nevertheless, Shao et al taught that luciferase reporter vectors are routinely and commercially available in the art (e.g. pg 301, 2.2 Generation of reporter plasmid), and thus a promoter-reporter expression vector itself satisfies a “kit”.
With respect to Claims 9-10, Shao et al taught host cells into which the agmatinase promoter-reporter constructs were transfected (entire paper).
Skarnes et al taught ES cells whose genomes have been genetically modified to comprise the heterologous expression cassette operably linked to the mouse agamnitase promoter (e.g. pg 5, col. 2, Methods, ES cells).
With respect to Claim 8, Shao et al taught a method of expressing a heterologous gene operably linked to the agmatinase promoter, the method comprising the step of transfecting isolated host cells with the agmatinase promoter-reporter constructs (entire paper).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that it would not have been obvious to replace the Shao et al sea cucumber agmatinase gene promoter with an agmatinase non-promoter sequence of Skarnes et al because Skarnes et al taught the use of human beta actin promoter.
Applicant’s argument(s) has been fully considered, but is not persuasive. As discussed above, the expression vector of Skarnes et al inherently comprises SEQ ID NO:1 comprising the mouse agmatinase promoter region and a portion of exon, including translation start site (nt 1136 of SEQ ID NO:1).
The term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Instant claims do not prohibit the presence of a mouse agmatinase promoter in the claimed expression vector recited at a high level of generality.
Applicant argues that Bernstein-1, Bernstein-2, Santos et al, and Meylan et al do not cure the deficiencies of Skarnes et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
15. Claim(s) 11 is rejected under AIA 35 U.S.C. 103 as being unpatentable over Shao et al (2016) in view of Bernstein-1 (2011), Bernstein-2 (2012), Santos et al (2005), Meylan et al (2016), Skarnes et al (2011), and GenBank JN950189.1 (2011), as applied to Claims 4-5, 8-10, and 12 above, and in further view of Spergel et al (2001).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Shao et al nor Skarnes et al teach wherein the promoter is operably linked to light-sensitive protein-tagged expression cassette.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 11, Spergel et al is considered relevant prior art for having taught the use of gene tagging vectors in mice, whereby the tagged reporter gene may be LacZ, GFP, or YFP (a variant of GFP) (e.g. Abstract; Figure 1; Figures 3-8; pg 683, col. 2).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first reporter tag, e.g. luciferase or LacZ, as taught by Shao et al and/or Skarnes et al, with a second reporter tag, i.e. the light-sensitive protein GFP of YFP (a variant of GFP) as taught be Spergel et al, in a promoter-tagged expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first reporter tag, e.g. luciferase or LacZ, with a second reporter tag, i.e. the light-sensitive protein GFP or YFP, in a promoter-tagged expression cassette because Spergel et al taught that promoter activity can be easily and readily detected in vivo in live cells using GFP; whereas, it is difficult to deliver the LacZ substrate and luciferase substrate to live cells in the brain (e.g. Table 1), and successfully demonstrated imaging GFP in vivo in live cells (Figures 3-6 and 8).
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Spergel et al do not cure the defect of Skarnes et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Skarnes et al are discussed above and incorporated herein. Applicant does not contest the teachings of Spergel et al as applied to the obviousness to substitute a first reporter tag, e.g. LacZ, as taught by Skarnes et al, with a second reporter tag, i.e. the light-sensitive protein GFP of YFP (a variant of GFP) as taught be Spergel et al, in a promoter-tagged expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first reporter tag, e.g. LacZ, with a second reporter tag, i.e. the light-sensitive protein GFP or YFP, in a promoter-tagged expression cassette because Spergel et al taught that promoter activity can be easily and readily detected in vivo in live cells using GFP; whereas, it is difficult to deliver the LacZ substrate to live cells in the brain (e.g. Table 1), and successfully demonstrated imaging GFP in vivo in live cells (Figures 3-6 and 8).
16. Claim(s) 11 and 14 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Shao et al (2016) in view of Bernstein-1 (2011), Bernstein-2 (2012), Santos et al (2005), Meylan et al (2016), Skarnes et al (2011), GenBank JN950189.1 (2011), and Spergel et al (2001), as applied to Claims 4-5, and 8-12 above, and in further view of Zhao et al (2011).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Skarnes et al nor Spergel et al teach wherein the promoter is operably linked to a light-sensitive protein, to wit, a channelrhodopsin.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 11 and 14, Zhao et al is considered relevant prior art for having taught the use of gene tagging vectors in mice, whereby the tagged reporter gene encodes a channelrhodopsin and YFP (a variant of GFP) (e.g. Abstract; pg 745, col. 2, “VGAT-ChR2-EYFP transgenic mice”).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify a gene tagging expression cassette to comprise a channelrhodopsin and YFP with a reasonable expectation of success because Zhao et al taught and successfully demonstrated the ability to use both the YFP marker to identify the artisan’s neural cell type of interest in vivo, followed by selectively activity said cell using the channelrhodopsin, thereby allowing the ordinary artisan to dissect the neural circuitry function of the target cell.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Zhao et al do not cure the defect of Skarnes et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Skarnes et al are discussed above and incorporated herein. Applicant does not contest the teachings of Zhao et al as applied to the obviousness to modify a gene tagging expression cassette to comprise a channelrhodopsin and YFP with a reasonable expectation of success because Zhao et al taught and successfully demonstrated the ability to use both the YFP marker to identify the artisan’s neural cell type of interest in vivo, followed by selectively activity said cell using the channelrhodopsin, thereby allowing the ordinary artisan to dissect the neural circuitry function of the target cell.
17. Claim(s) 4-6 and 9-12 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Shao et al (2016) in view of Bernstein-1 (2011), Bernstein-2 (2012), Santos et al (2005), Meylan et al (2016), Skarnes et al (2011), GenBank JN950189.1 (2011), Spergel et al (2001), and Zhao et al (2011), as applied to Claims 4-5, 8-12, and 14 above, and in further view of Hioki et al (Efficient gene transduction of neurons by lentivirus with enhanced neuron-specific promoters, Gene Therapy 14: 872-882, 2007).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Shao et al nor Skarnes et al teach wherein the promoter-reporter vector is a viral vector.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 6, Hioki et al is considered relevant prior art for having taught the use lentivirus vectors encoding the artisan’s tissue-specific promoter-reporter expression cassette to transduce mammalian neurons, e.g. rat neurons (Title; Abstract; Figure 1).
Hioki et al taught that the lentiviral vectors efficiently transduce the neurons (Title).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify a gene tagging expression cassette to comprise a channelrhodopsin and YFP with a reasonable expectation of success because Zhao et al taught and successfully demonstrated the ability to use both the YFP marker to identify the artisan’s neural cell type of interest in vivo, followed by selectively activity said cell using the channelrhodopsin, thereby allowing the ordinary artisan to dissect the neural circuitry function of the target cell.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 4-5, Shao et al taught the expression vector comprises an expression cassette comprising the agmatinase promoter operably linked to a heterologous gene of interest, to wit, luciferase.
The LR-PCR amplified DNA inherently and naturally comprises an expression cassette per the LacZ transgene now operatively linked to the mouse agamnitase promoter comprising SEQ ID NO:1.
Hioki et al taught the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, to wit, GFP (Figure 1).
With respect to Claim 11, Spergel et al wherein the tagged reporter gene may be GFP or YFP (a variant of GFP) (e.g. Abstract; Figure 1; Figures 3-8; pg 683, col. 2).
Zhao et al taught wherein the tagged reporter gene encodes a channelrhodopsin and YFP (a variant of GFP) (e.g. Abstract; pg 745, col. 2, “VGAT-ChR2-EYFP transgenic mice”).
Hioki et al taught wherein the tagged reporter gene encodes YFP (a variant of GFP) (e.g. Figure 1).
With respect to Claim 12, the term “kit” is recited at a high level of generality, and reasonably encompasses the isolated nucleic acid itself.
However, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The phrase “kit” is an intended use limitation, which does not contain any further structural limitations with respect to claimed nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 comprising the lacZ-tagged mutant allele (see MPEP §2114).
Furthermore, "products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product does not inherently possess the same properties as the instantly claimed product.
Nevertheless, Shao et al taught that luciferase reporter vectors are routinely and commercially available in the art (e.g. pg 301, 2.2 Generation of reporter plasmid), and thus a promoter-reporter expression vector itself satisfies a “kit”.
Hioki et al taught that promoter reporter vectors are routinely and commercially available in the art (e.g. Figure 1, pENTR1A), and thus a promoter-reporter expression vector itself satisfies a “kit”.
With respect to Claims 9-10, Shao et al taught host cells into which the agmatinase promoter-reporter constructs were transfected (entire paper).
Skarnes et al taught ES cells whose genomes have been genetically modified to comprise the heterologous expression cassette operably linked to the mouse agamnitase promoter (e.g. pg 5, col. 2, Methods, ES cells).
Hioki et al taught neuronal host cells into which the promoter-reporter constructs were transduced (entire paper).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Hioki et al do not cure the defect of Skarnes et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Skarnes et al are discussed above and incorporated herein. Applicant does not contest the teachings of Hioki et al as applied to the obviousness to modify a gene tagging expression cassette to comprise a channelrhodopsin and YFP with a reasonable expectation of success because Zhao et al taught and successfully demonstrated the ability to use both the YFP marker to identify the artisan’s neural cell type of interest in vivo, followed by selectively activity said cell using the channelrhodopsin, thereby allowing the ordinary artisan to dissect the neural circuitry function of the target cell.
18. Claim(s) 4-6 and 8-13 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Shao et al (2016) in view of Bernstein-1 (2011), Bernstein-2 (2012), Santos et al (2005), Meylan et al (2016), Skarnes et al (2011), GenBank JN950189.1 (2011), Spergel et al (2001), Zhao et al (2011), and Hioki et al (2007), as applied to Claims 4-6, 8-12, and 14 above, and in further view of Matsuzaki et al (Generation of a neurodegenerative disease mouse model using lentiviral vectors carrying an enhanced synapsin I promoter, J. Neurosci. Methods 223: 133-143, 2014) and Hartl et al (WO 17/093931; Applicant’s own work; not cited in an IDS).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Shao et al, Skarnes et al, nor Hioki et al teach wherein the promoter of the promoter-reporter expression vector further comprises a minimal promoter.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 13, Matsuzaki et al is considered relevant prior art for having taught the use lentivirus vectors encoding the artisan’s tissue-specific promoter-reporter expression cassette to transduce mammalian neurons, e.g. rat neurons (Title; Abstract; Figure 1).
Matsuzaki et al taught the wherein the cell-specific promoter of the promoter-reporter expression vector further comprises a minimal promoter, e.g. minCMV promoter (e.g. Figure 1a).
Matsuzaki et al taught that the combination of the minimal CMV promoter with the cell-specific promoter exhibited robust promoter strength and excellent neuronal specificity (e.g. Abstract).
Masuzaki et al do not teach the viral minimal promoter is a SV40 minimal promoter, nor that it comprises the nucleotide sequence of SEQ ID NO:2.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 13, Hartl et al is considered relevant prior art for having disclosed a Synapsin promoter-reporter expression cassette (e.g. pg 4, Figure 1 legend, synP-GFP), wherein the Synapsin-reporter expression cassette further comprises a SV40 minimal promoter (SEQ ID NO:2, lower line) comprising the nucleotide sequence that is 100% identical to instant SEQ ID NO:2 (upper line) (e.g. pg 5, para 2; pg 20, para 2; claim 2), as shown below:
ATCCTCACATGGTCCTGCTGGAGTTAGTAGAGGGTATATAATGGAAGCTCGACTTCCAGC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ATCCTCACATGGTCCTGCTGGAGTTAGTAGAGGGTATATAATGGAAGCTCGACTTCCAGC 60
TATCACATCCACTGTGTTGTTGTGAACTGGAATCCACTATAGGCCA 106
||||||||||||||||||||||||||||||||||||||||||||||
TATCACATCCACTGTGTTGTTGTGAACTGGAATCCACTATAGGCCA 106
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify a promoter-reporter expression vector to further comprise a minimal promoter with a reasonable expectation of success because Matsuzaki et al taught that a major disadvantage of cell type-specific promoters is their weaker transcriptional activity when compared to constitutive viral promoters (e.g. pg 134, col. 1) and successfully demonstrated the ability to use the neuronal cell-specific promoter in combination with the CMV minimal promoter to thereby achieve robust promoter strength and excellent neuronal specificity.
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to substitute a first viral minimal promoter, e.g. minCMV promoter, as taught by Masuzaki et al, with a second viral minimal promoter, i.e. minSV40 promoter comprising the nucleotide sequence of SEQ ID NO:2, as disclosed by Applicant, in a promoter-tagged expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first viral minimal promoter, e.g. minCMV promoter, with a second viral minimal promoter, i.e. minSV40 promoter comprising the nucleotide sequence of SEQ ID NO:2, in a promoter-tagged expression cassette because Applicant themselves previously disclosed and successfully demonstrated combining the minSV40 promoter with the artisan’s cell-specific promoter in a promoter-reporter expression vector.
The instant specification fails to disclose an element of criticality for the minSV40 promoter, as opposed to the minCMV promoter.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 4-5, Shao et al taught the expression vector comprises an expression cassette comprising the agmatinase promoter operably linked to a heterologous gene of interest, to wit, luciferase.
The LR-PCR amplified DNA inherently and naturally comprises an expression cassette per the LacZ transgene now operatively linked to the mouse agamnitase promoter comprising SEQ ID NO:1.
Hioki et al taught the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, to wit, GFP (Figure 1).
Masuzaki et al taught the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, to wit, GFP (Figure 1).
Hartl et al disclosed the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, to wit, GFP (pg 4, Figure 1 legend).
With respect to Claim 11, Spergel et al wherein the tagged reporter gene may be GFP or YFP (a variant of GFP) (e.g. Abstract; Figure 1; Figures 3-8; pg 683, col. 2).
Zhao et al taught wherein the tagged reporter gene encodes a channelrhodopsin and YFP (a variant of GFP) (e.g. Abstract; pg 745, col. 2, “VGAT-ChR2-EYFP transgenic mice”).
Hioki et al taught the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, to wit, GFP (Figure 1).
Masuzaki et al taught the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, to wit, GFP (Figure 1).
Hartl et al disclosed the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, to wit, GFP (pg 4, Figure 1 legend).
With respect to Claim 6, Hioki et al taught the expression vector is a lentiviral vector (entire paper).
Masuzaki et al taught the expression vector is a lentiviral vector (entire paper).
Hartl et al disclosed wherein the expression vector is a viral vector, e.g. a lentiviral vector (e.g. pg 6, para 4).
With respect to Claim 12, the term “kit” is recited at a high level of generality, and reasonably encompasses the isolated nucleic acid itself.
However, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The phrase “kit” is an intended use limitation, which does not contain any further structural limitations with respect to claimed nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 comprising the lacZ-tagged mutant allele (see MPEP §2114).
Furthermore, "products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product does not inherently possess the same properties as the instantly claimed product.
Nevertheless, Shao et al taught that luciferase reporter vectors are routinely and commercially available in the art (e.g. pg 301, 2.2 Generation of reporter plasmid), and thus a promoter-reporter expression vector itself satisfies a “kit”.
Hioki et al taught that promoter reporter vectors are routinely and commercially available in the art (e.g. Figure 1, pENTR1A), and thus a promoter-reporter expression vector itself satisfies a “kit”.
Masuzaki et al taught that construction of the lentiviral promoter-reporter expression vector, and thus satisfies a “kit”.
Hartl et al disclosed wherein the expression vector may be provided as a kit (e.g. pg 6, para 2).
With respect to Claims 9-10, Shao et al taught host cells into which the agmatinase promoter-reporter constructs were transfected (entire paper).
Skarnes et al taught ES cells whose genomes have been genetically modified to comprise the heterologous expression cassette operably linked to the mouse agamnitase promoter (e.g. pg 5, col. 2, Methods, ES cells).
Hioki et al taught neuronal host cells into which the promoter-reporter constructs were transduced (entire paper).
Masuzaki et al taught neuronal host cells into which the promoter-reporter constructs were transduced (entire paper).
Hartl et al disclosed host cells into which the promoter-reporter expression vector is introduced (e.g. pg 5, last para; Figure 1).
With respect to Claim 14, Zhao et al is considered relevant prior art for having taught the use of gene tagging vectors in mice, whereby the tagged reporter gene encodes a channelrhodopsin and YFP (a variant of GFP) (e.g. Abstract; pg 745, col. 2, “VGAT-ChR2-EYFP transgenic mice”).
Hartl et al disclosed the expression vector comprises an expression cassette comprising the tissue-specific promoter operably linked to a heterologous gene of interest, e.g. channelrhodopsin (pg 6, para 2; claim 11).
With respect to Claim 8, Shao et al taught a method of expressing a heterologous gene operably linked to the agmatinase promoter, the method comprising the step of transfecting isolated host cells with the agmatinase promoter-reporter constructs (entire paper).
Hartl et al disclosed isolated host cells into which the promoter-reporter expression vector is introduced (e.g. pg 5, last para).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Masuzaki et al and Hartl do not cure the defect of Skarnes et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Skarnes et al are discussed above and incorporated herein. Applicant does not contest the teachings of Masuzaki et al as applied to the obviousness to modify a promoter-reporter expression vector to further comprise a minimal promoter with a reasonable expectation of success because Matsuzaki et al taught that a major disadvantage of cell type-specific promoters is their weaker transcriptional activity when compared to constitutive viral promoters (e.g. pg 134, col. 1) and successfully demonstrated the ability to use the neuronal cell-specific promoter in combination with the CMV minimal promoter to thereby achieve robust promoter strength and excellent neuronal specificity.
Applicant does not contest the teachings of Hartl et al as applied to the obviousness to to substitute a first viral minimal promoter, e.g. minCMV promoter, as taught by Masuzaki et al, with a second viral minimal promoter, i.e. minSV40 promoter comprising the nucleotide sequence of SEQ ID NO:2, as disclosed by Applicant, in a promoter-tagged expression cassette with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first viral minimal promoter, e.g. minCMV promoter, with a second viral minimal promoter, i.e. minSV40 promoter comprising the nucleotide sequence of SEQ ID NO:2, in a promoter-tagged expression cassette because Applicant themselves previously disclosed and successfully demonstrated combining the minSV40 promoter with the artisan’s cell-specific promoter in a promoter-reporter expression vector.
Conclusion
19. No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638