Prosecution Insights
Last updated: October 04, 2026
Application No. 17/756,996

USE OF CYP4V2 AND RDCVF IN THE MANUFACTURE OF MEDICAMENT

Non-Final OA §101§103§112§DP§Other
Filed
Jan 24, 2023
Priority
Dec 09, 2019 — CN 201911255192.X +1 more
Examiner
JADHAO, SAMADHAN JAISING
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Chigenovo Co. Ltd.
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
93%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allowance Rate
30 granted / 64 resolved
-13.1% vs TC avg
Strong +46% interview lift
Without
With
+46.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
45 currently pending
Career history
118
Total Applications
across all art units

Statute-Specific Performance

§101
5.0%
-35.0% vs TC avg
§103
40.5%
+0.5% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
24.4%
-15.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 64 resolved cases

Office Action

§101 §103 §112 §DP §Other
DETAILED ACTION Non-Final Rejection Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions 2. Applicant’s election without traverse of Group II claims 29-31, 34, 37, 39, 45, 49-50, 71, 73-75 and 78-80 in the reply filed on 04/30/2026 is acknowledged. Applicant elected without traverse the species: CYP4 V2 and RdCVF Nucleotide Sequences: a nucleotide sequence encoding CYP4V2 set forth in SEQ ID NO: 62 and a nucleotide sequence encoding RdCVF set forth in SEQ ID NO: 69. Vector Sequences: SEQ ID NO:90 and SEQ ID NO:96 for the vector expressing CYP4V2 and the vector expressing RdCVF, respectively. (c) Vector Type: the viral vector adeno-associated virus (AAV). Applicant indicated that claims 30, 31, 34, 39, 45, 49, 50, 71, 73-75 and 78-80 are generic (interpreted as reads on) to the elected species. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election/restriction is made final. For compact prosecution, in addition to the elected SEQ ID NOs from the Markush listing, the search for SEQ ID NOs was expanded and results were considered. Status of Claims 3. Claims 1-3, 6, 10, 14, 17, 19, 22, 24, 28, 29-31, 34, 37, 39, 45, 49-50, 71 and 73-82 filed on 03/17/2023 are pending. 4. Claims 1-3, 6, 10, 14, 17, 19, 22, 24, 28, 76-77, and 81-82 (Group I) are withdrawn from examination from Election/Restriction. 5. Claims 29-31, 34, 37, 39, 45, 49-50, 71, 73-75, and 78-80 (Group II) are under examination. Information Disclosure Statement 6. The information disclosure statements (IDSs) (six) submitted on 06/07/2022, 12/29/2022, 10/25/2023, 01/31/2024, 02/05/2024, and 06/17/2026 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Specification 7. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The instant specification page number 33 recited hyperlink: https://www.ncbi.nlm.nih.gov/clinvar/?term=CYP4V2[gene]. To overcome the objection, the applicant is required to delete the hyperlink. See MPEP § 608.01. Claim Rejections - 35 USC § 101 8. 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claims 74, 78 and 80 are rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claims 74, 78 and 80 (claim 80 is dependent on claim 74) are rejected under 35 U.S.C. 101 and AIA § 33(a) as being directed to or encompassing a human organism. The claims read on cells found in intact mammals, including humans that receive nucleic acids encoding the claimed vectors. See also Animals -Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). See e.g. specification page 14, definition of “pharmaceutical composition” the vector composition suitable for administration to a human patient that optionally contains an adjuvant. Note “cells” are not defined in the specification but reasonably may include a human under the broadest reasonable interpretation (BRI). Examiner’s Suggestion: amending claims 74, 78 and 80 to recite “an isolated cell” to overcome this rejection. See e.g. specification page 9 section “Description of Embodiments” para 3 for definition of “isolated”. Claim Rejections - 35 USC § 112 9. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 29-31, 34, 37, 39, 45, 49 and 78-79 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The instant specification page number 14 provides the definition of "preventing". “As used herein, the term "preventing" generally refers to the prophylactic administration of a combination to a healthy subject to prevent the occurrence of a certain disease or disorder.” It may also include the prophylactic administration of the combination to a patient in the early stage of an allergic disease to be treated. The term "preventing" does not require 100% elimination of the likelihood of a disease or disorder; in other words, the term "preventing" generally means that the likelihood of a disease or disorder is reduced in the presence of the administrated combination”. Thus, under BRI of instant claim 29, the claim comprises: (i) "preventing" prevent the occurrence of a certain disease or disorder associated with RPE in a healthy subject by administration of a composition comprising two vectors combination encoding CYP4V2 and RdCVF”, and (ii) treating, and or alleviating disorder associated with RPE in the diseased subjects. The "preventing" in healthy subjects read on absolute prevention (100% prevention), whereas the "preventing" in diseased subjects (RPE disease) does not require 100% elimination of the likelihood of a disease or disorder. The definition begins generally to broadly encompass prevention in a healthy patient and then appears to narrow the prevention. Where there is an ambiguity regarding an exemplary claim interpretation that leads to an ambiguous scope, the issue of indefinite should be raised. See e.g. MPEP 2173.05(d) Exemplary Claim Language. Therefore, the claim 29 indefinite regarding the limitation "preventing". Examiner’s suggestion: Applicant is required to amend the claim 29 and dependent claims appropriately to overcome the rejection in view of the instant specification. The applicant may amend claim 29 (and dependent claims) by replacing the term "preventing" with “reduction in the likelihood of a disease or disorder”. Claim Rejections - 35 USC § 112 10. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 29-31, 34, 37, 39, 45, 49 and 78-79 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. The Instant claim 29 is directed to a functional limitation because the claim requires a vector combination for treating, alleviating, and/or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy, comprising a first vector and a second vector, wherein the first vector comprises a polynucleotide encoding CYP4V2, and the second vector comprises a polynucleotide encoding RdCVF. As discussed in the indefinite rejection under 35 USC 112b, the specification definition of “prevention” under BRI reasonably encompass prevention in a healthy human being which is not exemplified in the specification; nor supported in the prior art. Additionally, the instant specification (see, page 24) recites the vector may include plasmid, phagemid, cosmid, artificial chromosome (such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or P1-derived artificial chromosome (PAC)), phage (such as X phage or M13 phage), and viral vectors. The instant specification (see, page 25) recites viral vector may include retrovirus (including lentivirus), adenovirus, adeno-associated virus (AAV vector), herpesvirus (such as herpes simplex virus), poxvirus, baculovirus, papillomavirus, and papovavirus (such as SV40) vectors. The AAV vectors may include serotypes or strains AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80, DJ, DJ/8, Rh10, variants of any known or mentioned AAV, or variants or mixtures thereof. The claimed vector is a genus (instant claim 29). When a claim covers a genus of inventions, the specification must provide written description support for the entire scope of the genus. Support for a genus is generally found where the applicant has provided a number of examples sufficient so that one in the art would recognize from the specification the scope of what is being claimed. However, the presence of multiple species within a claimed genus does not necessarily demonstrate possession of the genus. See, In re Smyth, 178 U.S.P.Q. 279 at 284-85 (CCPA 1973) (stating “where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus or combination claimed at a later date in the prosecution of a patent application.”); and University of California v. Eli Lilly and Co., 43 USPQ2d 1398, at 1405 (Fed Cir 1997)(citing Smyth for support). In the instant case, the specification does not provide adequate written description of of sufficient number of vectors or viral vectors or AAV vector that are reduced to the practice. The viral vector, AAV vector claimed in instant claims 37 and 73 are generic and there are sufficient number of species disclosed as reduced to practice. In view of the specification, the claims are directed to a functional limitation for expression of the CYP4V2 and RdCVF gene sequences in retina of eye of a subject for treatment of RPE. However, it is known in the AAV art that tropism of the AAV serotype and strains differ for tissues and cells of organs. The specification has although obtained (purchased) AAV2/2, AAV2/5, AAV2/8, and AAV2/9 serotypes, has disclosed working example (reduction to practice) for only AAV2/8 vector (see, Example 8 Viral Vector, page 43). The AAV serotype differ in amino acid sequence and thereby structure of capsid proteins and that affect the functional limitation of tropism to different organs and cells. The applicable standard for the written description requirement can be found in MPEP§ 2163; University of California v. Eli Lilly, 43 USPQ2d 1398 at 1407; PTO Written Description Guidelines; Enzo Biochem Inc. v. Gen-Probe Inc., 63 USPQ2d 1609; Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111; and University of Rochester v. G.D. Searle & Co., 69 USPQ2d 1886 (CAFC 2004). To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. In the instant case, the working example (reduction to practice) structure defined for only AAV2/8 vector is not applicable for the reasons cited above for other viral vectors and all other serotypes of AAV. Accordingly, in the absence of sufficient recitation of distinguishing identifying characteristics, the specification does not provide adequate written description of the claimed genus. The instant claims encompass an very large genus of viral vectors and their variants, AAV serotypes and its variants. Amgen Inc. vs Sanofi (2017-1480, Fed Cir, 2017) states that "an adequate written description must contain enough information about the actual makeup of the claim products - a precise definition such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other material," which may be present in "function "terminology "when the art has established a correlation between structure and function" (page 17,1st paragraph). The guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112, § 1 "Written Description” Requirement make clear that if a claimed genus does not show actual reduction to practice for a representative number of species, then the Requirement may be alternatively met by reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the genus (Federal Register, Vol. 66, No. 4, pages 1099-1111, Fri. January 5, 2001, see especially page 1106 column 3). In the instant case, the specification does not provide adequate written description of sufficient number of vectors or viral vectors or AAV vector that are reduced to the practice. The legal standard for sufficiency of a patent's (or a specification’s) written description is whether that description "reasonably conveys to the artisan that the inventor had possession at that time of the claimed subject matter", Vas-Cath, Inc. v. Mahurkar, 19 USPQ2d 1111 (Fed. Cir. 1991). In the instant case, the specification does not convey to the artisan that the applicant had possession at the time of invention of the claimed invention. The full breadth of the claims does not meet the written description provision of 35 U.S.C. 112, first paragraph. Claim Interpretation 11. The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art. Claim 29: The instant claim 29 is directed to a vector combination for treating, alleviating, and/or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy, comprising a first vector and a second vector, wherein the first vector comprises a polynucleotide encoding CYP4V2, and the second vector comprises a polynucleotide encoding RdCVF. In light of specification (see page 14) for the definition of preventing the disease in healthy subjects under BRI the instant claim 29 is interpreted to be required to absolutely prevent (100% prevention) of RPE disease in healthy subjects. The claim 29 has a functional limitation of treating, alleviating, and/or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy. For claim 37, the applicant has elected species of the viral vector “adeno-associated virus (AAV)” and indicated that the claims 30, 31, 34, 39, 45, 49, 50, 71, 73-75 and 78-80 are generic to the elected species. In view of the instant specification (page number 14), the limitation "preventing" is defined as prophylactic administration of a combination to a healthy subject to prevent the occurrence of a certain disease or disorder. It may also include the prophylactic administration of the combination to a patient in the early stage of an allergic disease to be treated. The term "preventing" does not require 100% elimination of the likelihood of a disease or disorder; in other words, the term "preventing" generally means that the likelihood of a disease or disorder is reduced in the presence of the administrated combination. In light of specification (see page 14) for the definition of preventing the disease in healthy subjects under BRI the instant claim 29 is interpreted to be required to absolutely prevent (100% prevention) of RPE disease in healthy subjects. Claim Rejections - 35 USC § 103 12. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 13. Claims 29-30, 37, 50, 71, 73-75, and 78-80 are rejected under 35 U.S.C. 103 as being unpatentable over Yang 2019 (WO2019025984A1, 02/07/2019), and further in view of Levelard et al 2004 (CN1529753A, 09/15/2004), Byrne et al 2015 (J Clin Invest. 2015 Jan;125(1):105-16), Germaschewski et al 2015 (US20150133641A1, 05/14/2015) and Hamel 2006 (Orphanet Journal of Rare Diseases 2006, 1:40). Claims 29-30, 37, 50, 71, 73-75, and 78-80: Yang 2019 (WO2019025984A1) discloses a composition for treating or preventing an ocular disease in a human subject, comprising a vector, the vector comprising an expression cassette, the expression cassette comprising a nucleic acid molecule or a non-pathogenic variant thereof encoding a functional or non-mutant CYP4V2 protein operably linked to one or more regulatory sequence, wherein the disease is associated with the dysfunction, dystrophy, disorder, degeneration, atrophy and/or death of ocular cells (see, claim 1). The ocular disease or ocular cell degeneration is an inherited retinal degeneration (IRD) or retinitis pigmentosa (RP) with bi- allelic mutation in the CYP4V2 gene (see, claims 2-3). The disease is or the ocular cell degeneration is associated with Bietti Crystalline Dystrophy (instant claim 30 limitation) (also known as Bietti Crystalline Corneoretinal Dystrophy; BCD) (see, claim 4). The vector is a viral vector, a plasmid, or a non-viral vector (see, claim 5). The viral vector is selected from the group consisting of an adeno-associated virus (AAV) vector (instant claim 37 limitation), an adenovirus vector, a lentivirus vector, a herpes simplex virus vector, a baculovirus vector, a sendai virus vector, and a retrovirus vector (see, claim 6). A host cell comprising the nucleic acid molecule and/or the vector (instant claim 74 limitation) (see, claim 83). The composition of any of the preceding claims, wherein the composition is formulated with a pharmaceutically acceptable carrier and additional components suitable for the specific route of administration, a pharmaceutically acceptable formulation (see, claim 29, claim 274). Yang 2019 do not disclose a vector comprising polynucleotide sequence encoding RdCVF and P2A self-cleaving peptide encoding nucleotide sequence. Hamel 2006 has reviewed Retinitis pigmentosa and disclosed a rod-derived cone viability factor (RdCVF) that appears to be a truncated thioredoxin like protein which significantly delays cone death in the rd1 mouse model of RP (See, page 10 col 1). Disclosed is Bietti's disease shows characteristic microcrystalline deposits in fundus and cornea. Patients undergo progressive RP evolving towards chorioretinal atrophy. The causative gene, encoding a form of cytochrome P450 (CYP4V2), has been recently discovered (see, page 4 col 2 last para). Levelard et al 2004 is in the art and teaches a retinal protective agent comprising RdCVF1 polypeptide, and a method for treating retinal dystrophy. Said method is used for treating retinitis pigmentosa, age-related macular degeneration, also discloses an AAV vector comprising nucleic acid molecule encoding polypeptides RdCVF1, RdCVF2 (See, abstract, claims, description). Byrne et al 2015 teaches AAV viral-mediated RdCVF and RdCVFL expression protects cone and rod photoreceptors in retinal degeneration (See, abstract, entire article). Germaschewski et al 2015 (US20150133641A1, 05/14/2015) is in the art and teaches P2A self-cleaving peptide encoding nucleotide sequence SEQ ID NO: 53 that has 100% identity with instant SEQ ID NO: 23. Query Match 100.0%; Score 63; Length 63; Best Local Similarity 100.0%; Matches 63; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGA 60 Qy 61 CCT 63 ||| Db 61 CCT 63 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Yang 2019 on CYP4V2 in treatment of RPE with additional teachings of Levelard et al 2004 on RdCVF in treatment of RPE, Germaschewski et al 2015 for P2A encoding nucleotide sequence and suggestion or motivation by Byrne et al 2015 on combination treatment CYP4V2 and RdCVF that protects cone and rod photoreceptors in retinal degeneration (RPE) and suggestion by Hamel 2006 on CYP4V2 and RdCVF as recited supra to arrive at the invention of claims 29-30, 37, 50, 71, 73-75, and 78-80 to develop a composition comprising Vectors, rAAV vectors for treatment of RPE in a subject. The motivation would be both CYP4V2 and RdCVF are known individually for the treatment of RPE and therefore it would have been obvious to combine the two compositions for the same treatment of RPE and arrive at a third composition to be used for the same purpose with a reasonable expectation for improved therapeutic effect. See MPEP 2144.06 Art Recognized Equivalence for the Same Purpose [R-01.2024]. "It is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose.... [T]he idea of combining them flows logically from their having been individually taught in the prior art." In re Kerkhoven, 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980) (citations omitted) (Claims to a process of preparing a spray-dried detergent by mixing together two conventional spray-dried detergents were held to be prima facie obvious.). See also In re Crockett, 279 F.2d 274, 126 USPQ 186 (CCPA 1960) (Claims directed to a method and material for treating cast iron using a mixture comprising calcium carbide and magnesium oxide were held unpatentable over prior art disclosures that the aforementioned components individually promote the formation of a nodular structure in cast iron.); Ex parte Quadranti, 25 USPQ2d 1071 (Bd. Pat. App. & Inter. 1992) (mixture of two known herbicides held prima facie obvious); and In re Couvaras, 70 F.4th 1374, 1378-79, 2023 USPQ2d 697 (Fed. Cir. 2023) (That the two claimed types of active agents, GABA-a agonists and ARBs, were known to be useful for the same purpose—alleviating hypertension—alone can serve as a motivation to combine). One of the ordinary skills in the art would have a reasonable expectation of success to arrive at the invention of claims 29-30, 37, 50, 71, 73-75, and 78-80 given the applied prior art teachings as recited supra. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), examples of rationales, A-G. 14. Claims 31 and 34 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Yang 2019 (WO2019025984A1, 02/07/2019), Levelard et al 2004 (CN1529753A, 09/15/2004) and Byrne et al 2015 (J Clin Invest. 2015 Jan;125(1):105-16), Germaschewski et al 2015 (US20150133641A1, 05/14/2015), Hamel 2006 (Orphanet Journal of Rare Diseases 2006, 1:40) as applied to claims 29-30, 37, 50, 71, 73-75, and 78-80 and further in view of Miller et al 2020 (WO2020117898A1, 06/11/2020, with an earlier priority to US 62/775,871, published 12/05/2018 and US 62/914,856 published 10/14/2019), Bennicelli et al 2018 (US20180369415A1, 12/27/2018). Claims 31 and 34: The combined teachings of Yang 2019, Levelard et al 2004 and Byrne et al 2015, and Germaschewski et al 2015 taught claim 29 as recited supra but do not disclose the instant claim 31 nucleotide sequence of CYP4V2 (elected species SEQ ID NOs: 62, 69) and claim 34 RdCVF (elected species SEQ ID NO: 69) and P2A elected sequence SEQ ID NO: 23. Miller et al 2020 (WO2020117898A1) is art and disclosed a nucleotide sequence encoding CYP4V2 SEQ ID NO: 116 (table 4, see the entire WO2020117898A1) that has 99.7% identity with 3 nucleotide mismatches that are synonymous mutations coding for same amino acids to that of instant SEQ ID NO: 62. The 3 nucleotide mismatch in the codons of instant SEQ ID NO: 62 and the prior art SEQ ID NO: 116 are both AGT and variant codon AGC code for amino acid Serine, both TAC and variant codon TAT code for amino acid Tyrosine, both GCG and variant codon GCT codes for amino acid Alanine. Query Match 99.7%; Score 1570.2; Length 1578; Best Local Similarity 99.8%; Matches 1572; Conservative 0; Mismatches 3;Indels 0; Gaps 0; Qy 1 ATGGCGGGGCTCTGGCTGGGGCTCGTGTGGCAGAAGCTGCTGCTGTGGGGCGCGGCGAGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCGGGGCTCTGGCTGGGGCTCGTGTGGCAGAAGCTGCTGCTGTGGGGCGCGGCGAGT 60 Qy 61 GCCCTTTCCCTGGCCGGCGCCAGTCTGGTCCTGAGTCTGCTGCAGAGGGTGGCGAGCTAC 120 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Db 61 GCCCTTTCCCTGGCCGGCGCCAGTCTGGTCCTGAGCCTGCTGCAGAGGGTGGCGAGCTAC 120 Qy 121 GCGCGGAAATGGCAGCAGATGCGGCCCATCCCCACGGTGGCCCGCGCCTACCCACTGGTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCGCGGAAATGGCAGCAGATGCGGCCCATCCCCACGGTGGCCCGCGCCTACCCACTGGTG 180 Qy 181 GGCCACGCGCTGCTGATGAAGCCGGACGGGCGAGAATTTTTTCAGCAGATCATTGAGTAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GGCCACGCGCTGCTGATGAAGCCGGACGGGCGAGAATTTTTTCAGCAGATCATTGAGTAC 240 Qy 241 ACAGAGGAATACCGCCACATGCCGCTGCTGAAGCTCTGGGTCGGGCCAGTGCCCATGGTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACAGAGGAATACCGCCACATGCCGCTGCTGAAGCTCTGGGTCGGGCCAGTGCCCATGGTG 300 Qy 301 GCCCTTTATAATGCAGAAAATGTGGAGGTAATTTTAACTAGTTCAAAGCAAATTGACAAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GCCCTTTATAATGCAGAAAATGTGGAGGTAATTTTAACTAGTTCAAAGCAAATTGACAAA 360 Qy 361 TCCTCTATGTACAAGTTTTTAGAACCATGGCTTGGCCTAGGACTTCTTACAAGTACTGGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TCCTCTATGTACAAGTTTTTAGAACCATGGCTTGGCCTAGGACTTCTTACAAGTACTGGA 420 Qy 421 AACAAATGGCGCTCCAGGAGAAAGATGTTAACACCCACTTTCCATTTTACCATTCTGGAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AACAAATGGCGCTCCAGGAGAAAGATGTTAACACCCACTTTCCATTTTACCATTCTGGAA 480 Qy 481 GATTTCTTAGATATCATGAATGAACAAGCAAATATATTGGTTAAGAAACTTGAAAAACAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GATTTCTTAGATATCATGAATGAACAAGCAAATATATTGGTTAAGAAACTTGAAAAACAC 540 Qy 541 ATTAACCAAGAAGCATTTAACTGCTTTTTTTACATCACTCTTTGTGCCTTAGATATCATC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATTAACCAAGAAGCATTTAACTGCTTTTTTTACATCACTCTTTGTGCCTTAGATATCATC 600 Qy 601 TGTGAAACAGCTATGGGGAAGAATATTGGTGCTCAAAGTAATGATGATTCCGAGTATGTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TGTGAAACAGCTATGGGGAAGAATATTGGTGCTCAAAGTAATGATGATTCCGAGTATGTC 660 Qy 661 CGTGCAGTTTATAGAATGAGTGAGATGATATTTCGAAGAATAAAGATGCCCTGGCTTTGG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CGTGCAGTTTATAGAATGAGTGAGATGATATTTCGAAGAATAAAGATGCCCTGGCTTTGG 720 Qy 721 CTTGATCTCTGGTACCTTATGTTTAAAGAAGGATGGGAACACAAAAAGAGCCTTCAGATC 780 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 721 CTTGATCTCTGGTATCTTATGTTTAAAGAAGGATGGGAACACAAAAAGAGCCTTCAGATC 780 Qy 781 CTACATACTTTTACCAACAGTGTCATCGCGGAACGGGCCAATGAAATGAACGCCAATGAA 840 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 781 CTACATACTTTTACCAACAGTGTCATCGCTGAACGGGCCAATGAAATGAACGCCAATGAA 840 Qy 841 GACTGTAGAGGTGATGGCAGGGGCTCTGCCCCCTCCAAAAATAAACGCAGGGCCTTTCTT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GACTGTAGAGGTGATGGCAGGGGCTCTGCCCCCTCCAAAAATAAACGCAGGGCCTTTCTT 900 Qy 901 GACTTGCTTTTAAGTGTGACTGATGACGAAGGGAACAGGCTAAGTCATGAAGATATTCGA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GACTTGCTTTTAAGTGTGACTGATGACGAAGGGAACAGGCTAAGTCATGAAGATATTCGA 960 Qy 961 GAAGAAGTTGACACCTTCATGTTTGAGGGGCACGATACAACTGCAGCTGCAATAAACTGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 GAAGAAGTTGACACCTTCATGTTTGAGGGGCACGATACAACTGCAGCTGCAATAAACTGG 1020 Qy 1021 TCCTTATACCTGTTGGGTTCTAACCCAGAAGTCCAGAAAAAAGTGGATCATGAATTGGAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TCCTTATACCTGTTGGGTTCTAACCCAGAAGTCCAGAAAAAAGTGGATCATGAATTGGAT 1080 Qy 1081 GACGTGTTTGGGAAGTCTGACCGTCCCGCTACAGTAGAAGACCTGAAGAAACTTCGGTAT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GACGTGTTTGGGAAGTCTGACCGTCCCGCTACAGTAGAAGACCTGAAGAAACTTCGGTAT 1140 Qy 1141 CTGGAATGTGTTATTAAGGAGACCCTTCGCCTTTTTCCTTCTGTTCCTTTATTTGCCCGT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CTGGAATGTGTTATTAAGGAGACCCTTCGCCTTTTTCCTTCTGTTCCTTTATTTGCCCGT 1200 Qy 1201 AGTGTTAGTGAAGATTGTGAAGTGGCAGGTTACAGAGTTCTAAAAGGCACTGAAGCCGTC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AGTGTTAGTGAAGATTGTGAAGTGGCAGGTTACAGAGTTCTAAAAGGCACTGAAGCCGTC 1260 Qy 1261 ATCATTCCCTATGCATTGCACAGAGATCCGAGATACTTCCCCAACCCCGAGGAGTTCCAG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 ATCATTCCCTATGCATTGCACAGAGATCCGAGATACTTCCCCAACCCCGAGGAGTTCCAG 1320 Qy 1321 CCTGAGCGGTTCTTCCCCGAGAATGCACAAGGGCGCCATCCATATGCCTACGTGCCCTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CCTGAGCGGTTCTTCCCCGAGAATGCACAAGGGCGCCATCCATATGCCTACGTGCCCTTC 1380 Qy 1381 TCTGCTGGCCCCAGGAACTGTATAGGTCAAAAGTTTGCTGTGATGGAAGAAAAGACCATT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TCTGCTGGCCCCAGGAACTGTATAGGTCAAAAGTTTGCTGTGATGGAAGAAAAGACCATT 1440 Qy 1441 CTTTCGTGCATCCTGAGGCACTTTTGGATAGAATCCAACCAGAAAAGAGAAGAGCTTGGT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CTTTCGTGCATCCTGAGGCACTTTTGGATAGAATCCAACCAGAAAAGAGAAGAGCTTGGT 1500 Qy 1501 CTAGAAGGACAGTTGATTCTTCGTCCAAGTAATGGCATCTGGATCAAGTTGAAGAGGAGA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 CTAGAAGGACAGTTGATTCTTCGTCCAAGTAATGGCATCTGGATCAAGTTGAAGAGGAGA 1560 Qy 1561 AATGCAGATGAACGC 1575 ||||||||||||||| Db 1561 AATGCAGATGAACGC 1575 Bennicelli et al 2018 (US20180369415A1, 12/27/2018) is in the art and disclosed compositions for treatment of ocular disorders and blinding diseases comprising codon optimized nucleic acid sequences for the long form and short form of RdCVF as well as recombinant viral vectors, such as AAV, expression cassettes, proviral plasmids or other plasmids containing the codon optimized sequences. Recombinant vectors are provided that express the codon optimized RdCVFL and RdCVF. Disclosed is SEQ ID NO: 6 that has 100% identity with instant SEQ ID NO: 69. Query Match 100.0%; Score 327; Length 12464; Best Local Similarity 100.0%; Matches 327; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCCTCCCTGTTCTCTGGCCGCATCCTGATCCGCAACAATAGCGACCAGGACGAGCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2727 ATGGCCTCCCTGTTCTCTGGCCGCATCCTGATCCGCAACAATAGCGACCAGGACGAGCTG 2786 Qy 61 GATACGGAGGCTGAGGTCAGTCGCAGGCTGGAGAACCGGCTGGTGCTGCTGTTCTTTGGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2787 GATACGGAGGCTGAGGTCAGTCGCAGGCTGGAGAACCGGCTGGTGCTGCTGTTCTTTGGT 2846 Qy 121 GCTGGGGCTTGTCCACAGTGCCAGGCCTTCGTGCCCATCCTCAAGGACTTCTTCGTGCGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2847 GCTGGGGCTTGTCCACAGTGCCAGGCCTTCGTGCCCATCCTCAAGGACTTCTTCGTGCGG 2906 Qy 181 CTCACAGATGAGTTCTATGTACTGCGGGCGGCTCAGCTGGCCCTGGTGTACGTGTCCCAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2907 CTCACAGATGAGTTCTATGTACTGCGGGCGGCTCAGCTGGCCCTGGTGTACGTGTCCCAG 2966 Qy 241 GACTCCACGGAGGAGCAGCAGGACCTGTTCCTCAAGGACATGCCAAAGAAATGGCTTTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2967 GACTCCACGGAGGAGCAGCAGGACCTGTTCCTCAAGGACATGCCAAAGAAATGGCTTTTC 3026 Qy 301 CTGCCCTTTGAGGATGATCTGAGGAGG 327 ||||||||||||||||||||||||||| Db 3027 CTGCCCTTTGAGGATGATCTGAGGAGG 3053 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Yang 2019 (CYP4V2 in treatment of RPE), Levelard et al 2004 (RdCVF in treatment of RPE), and Byrne et al 2015, Germaschewski et al 2015 with additional teachings of Miller et al 2020 (WO2020117898A1) on the prior art teachings polynucleotide encoding CYP4V2 comprised in SEQ ID NO: 62, and Bennicelli et al 2018 (US20180369415A1) on the prior art teachings polynucleotide encoding RdCVF comprised in SEQ ID NO: 69 as recited supra to arrive at the invention of claims 31 and 34 to develop a composition comprising Vectors, rAAV vectors for treatment of RPE in a subject. The motivation would be both CYP4V2 and RdCVF are known individually for the treatment of RPE and the disclosed polynucleotide sequences could be radially used to construct the vectors therefore it would have been obvious to combine the two compositions for the same treatment of RPE and arrive at a third composition to be used for the same purpose with a reasonable expectation for improved therapeutic effect. See MPEP 2144.06 Art Recognized Equivalence for the Same Purpose [R-01.2024]. "It is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose.... [T]he idea of combining them flows logically from their having been individually taught in the prior art." In re Kerkhoven, 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980) (citations omitted) (Claims to a process of preparing a spray-dried detergent by mixing together two conventional spray-dried detergents were held to be prima facie obvious.). See also In re Crockett, 279 F.2d 274, 126 USPQ 186 (CCPA 1960) (Claims directed to a method and material for treating cast iron using a mixture comprising calcium carbide and magnesium oxide were held unpatentable over prior art disclosures that the aforementioned components individually promote the formation of a nodular structure in cast iron.); Ex parte Quadranti, 25 USPQ2d 1071 (Bd. Pat. App. & Inter. 1992) (mixture of two known herbicides held prima facie obvious); and In re Couvaras, 70 F.4th 1374, 1378-79, 2023 USPQ2d 697 (Fed. Cir. 2023) (That the two claimed types of active agents, GABA-a agonists and ARBs, were known to be useful for the same purpose - alleviating hypertension - alone can serve as a motivation to combine). One of the ordinary skills in the art would have a reasonable expectation of success to arrive at the invention of claims 31 and 34 given the applied prior art teachings as recited supra. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), examples of rationales, A-G. 15. Claims 39 and 45 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Yang 2019 (WO2019025984A1, 02/07/2019), Levelard et al 2004 (CN1529753A, 09/15/2004) and Byrne et al 2015 (J Clin Invest. 2015 Jan;125(1):105-16), Germaschewski et al 2015 (US20150133641A1, 05/14/2015), Hamel 2006 (Orphanet Journal of Rare Diseases 2006, 1:40) as applied to claims 29-30, 37, 50, 71, 73-75, and 78-80 and further in view of Smith et al 2018 (US20180021458A1, 01/25/2018) and Constable et al 2018 (US20180125948A1, 05/10/2018). Claims 39 and 45: The combined teachings of Yang 2019, Levelard et al 2004 and Byrne et al 2015, and Germaschewski et al 2015 taught claim 29 as recited supra. Yang 2019 teaches a promoter (see, claims 20-23) but do not disclose the instant claim 39 limitation a promoter, the promoter is an RPE cell-specific promoter, a retinal cell-specific promoter, a corneal cell-specific promoter, an ocular cell-specific promoter or a constitutive promote as claimed in instant SEQ ID NO: 1. The combined applied teachings Yang 2019 teaches a intron for the taught CYP4V2 gene (see page 112) but do not teach the elected sequence claimed in SEQ ID NOs: 13-16. Claim 39: Smith et al 2018 (US20180021458A1) is in the art and is directed to vector, rAAV composition comprising a retinal pigment epithelium (RPE)-specific promoter which comprises a sequence of contiguous nucleotides from SEQ ID NO:1 that confers RPE-specific expression on an operably linked polynucleotide sequence teaches SEQ ID NO: 1 (see, claims 1, 11) has 100% identity match with instant SEQ ID NO: 5. Query Match 100.0%; Score 1614; Length 1614; Best Local Similarity 100.0%; Matches 1614; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TATTGTGCAAATAAGTGCTCACTCCAAATTAGTGGTATATTTATTGAAGTTTAATATTGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 TATTGTGCAAATAAGTGCTCACTCCAAATTAGTGGTATATTTATTGAAGTTTAATATTGT 60 Qy 61 GTTTGTGATACAGAAGTATTTGCTTTAATTCTAAATAAAAATTTTATGCTTTTATTGCTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GTTTGTGATACAGAAGTATTTGCTTTAATTCTAAATAAAAATTTTATGCTTTTATTGCTG 120 Qy 121 GTTTAAGAAGATTTGGATTATCCTTGTACTTTGAGGAGAAGTTTCTTATTTGAAATATTT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTTTAAGAAGATTTGGATTATCCTTGTACTTTGAGGAGAAGTTTCTTATTTGAAATATTT 180 Qy 181 TGGAAACAGGTCTTTTAATGTGGAAAGATAGATATTAATCTCCTCTTCTATTACTCTCCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TGGAAACAGGTCTTTTAATGTGGAAAGATAGATATTAATCTCCTCTTCTATTACTCTCCA 240 Qy 241 AGATCCAACAAAAGTGATTATACCCCCCAAAATATGATGGTAGTATCTTATACTACCATC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AGATCCAACAAAAGTGATTATACCCCCCAAAATATGATGGTAGTATCTTATACTACCATC 300 Qy 301 ATTTTATAGGCATAGGGCTCTTAGCTGCAAATAATGGAACTAACTCTAATAAAGCAGAAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ATTTTATAGGCATAGGGCTCTTAGCTGCAAATAATGGAACTAACTCTAATAAAGCAGAAC 360 Qy 361 GCAAATATTGTAAATATTAGAGAGCTAACAATCTCTGGGATGGCTAAAGGATGGAGCTTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GCAAATATTGTAAATATTAGAGAGCTAACAATCTCTGGGATGGCTAAAGGATGGAGCTTG 420 Qy 421 GAGGCTACCCAGCCAGTAACAATATTCCGGGCTCCACTGTTGAATGGAGACACTACAACT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GAGGCTACCCAGCCAGTAACAATATTCCGGGCTCCACTGTTGAATGGAGACACTACAACT 480 Qy 481 GCCTTGGATGGGCAGAGATATTATGGATGCTAAGCCCCAGGTGCTACCATTAGGACTTCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GCCTTGGATGGGCAGAGATATTATGGATGCTAAGCCCCAGGTGCTACCATTAGGACTTCT 540 Qy 541 ACCACTGTCCCTAACGGGTGGAGCCCATCACATGCCTATGCCCTCACTGTAAGGAAATGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ACCACTGTCCCTAACGGGTGGAGCCCATCACATGCCTATGCCCTCACTGTAAGGAAATGA 600 Qy 601 AGCTACTGTTGTATATCTTGGGAAGCACTTGGATTAATTGTTATACAGTTTTGTTGAAGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AGCTACTGTTGTATATCTTGGGAAGCACTTGGATTAATTGTTATACAGTTTTGTTGAAGA 660 Qy 661 AGACCCCTAGGGTAAGTAGCCATAACTGCACACTAAATTTAAAATTGTTAATGAGTTTCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 AGACCCCTAGGGTAAGTAGCCATAACTGCACACTAAATTTAAAATTGTTAATGAGTTTCT 720 Qy 721 CAAAAAAAATGTTAAGGTTGTTAGCTGGTATAGTATATATCTTGCCTGTTTTCCAAGGAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CAAAAAAAATGTTAAGGTTGTTAGCTGGTATAGTATATATCTTGCCTGTTTTCCAAGGAC 780 Qy 781 TTCTTTGGGCAGTACCTTGTCTGTGCTGGCAAGCAACTGAGACTTAATGAAAGAGTATTG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTCTTTGGGCAGTACCTTGTCTGTGCTGGCAAGCAACTGAGACTTAATGAAAGAGTATTG 840 Qy 841 GAGATATGAATGAATTGATGCTGTATACTCTCAGAGTGCCAAACATATACCAATGGACAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GAGATATGAATGAATTGATGCTGTATACTCTCAGAGTGCCAAACATATACCAATGGACAA 900 Qy 901 GAAGGTGAGGCAGAGAGCAGACAGGCATTAGTGACAAGCAAAGATATGCAGAATTTCATT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GAAGGTGAGGCAGAGAGCAGACAGGCATTAGTGACAAGCAAAGATATGCAGAATTTCATT 960 Qy 961 CTCAGCAAATCAAAAGTCCTCAACCTGGTTGGAAGAATATTGGCACTGAATGGTATCAAT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CTCAGCAAATCAAAAGTCCTCAACCTGGTTGGAAGAATATTGGCACTGAATGGTATCAAT 1020 Qy 1021 AAGGTTGCTAGAGAGGGTTAGAGGTGCACAATGTGCTTCCATAACATTTTATACTTCTCC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 AAGGTTGCTAGAGAGGGTTAGAGGTGCACAATGTGCTTCCATAACATTTTATACTTCTCC 1080 Qy 1081 AATCTTAGCACTAATCAAACATGGTTGAATACTTTGTTTACTATAACTCTTACAGAGTTA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 AATCTTAGCACTAATCAAACATGGTTGAATACTTTGTTTACTATAACTCTTACAGAGTTA 1140 Qy 1141 TAAGATCTGTGAAGACAGGGACAGGGACAATACCCATCTCTGTCTGGTTCATAGGTGGTA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TAAGATCTGTGAAGACAGGGACAGGGACAATACCCATCTCTGTCTGGTTCATAGGTGGTA 1200 Qy 1201 TGTAATAGATATTTTTAAAAATAAGTGAGTTAATGAATGAGGGTGAGAATGAAGGCACAG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TGTAATAGATATTTTTAAAAATAAGTGAGTTAATGAATGAGGGTGAGAATGAAGGCACAG 1260 Qy 1261 AGGTATTAGGGGGAGGTGGGCCCCAGAGAATGGTGCCAAGGTCCAGTGGGGTGACTGGGA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 AGGTATTAGGGGGAGGTGGGCCCCAGAGAATGGTGCCAAGGTCCAGTGGGGTGACTGGGA 1320 Qy 1321 TCAGCTCAGGCCTGACGCTGGCCACTCCCACCTAGCTCCTTTCTTTCTAATCTGTTCTCA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 TCAGCTCAGGCCTGACGCTGGCCACTCCCACCTAGCTCCTTTCTTTCTAATCTGTTCTCA 1380 Qy 1381 TTCTCCTTGGGAAGGATTGAGGTCTCTGGAAAACAGCCAAACAACTGTTATGGGAACAGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TTCTCCTTGGGAAGGATTGAGGTCTCTGGAAAACAGCCAAACAACTGTTATGGGAACAGC 1440 Qy 1441 AAGCCCAAATAAAGCCAAGCATCAGGGGGATCTGAGAGCTGAAAGCAACTTCTGTTCCCC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 AAGCCCAAATAAAGCCAAGCATCAGGGGGATCTGAGAGCTGAAAGCAACTTCTGTTCCCC 1500 Qy 1501 CTCCCTCAGCTGAAGGGGTGGGGAAGGGCTCCCAAAGCCATAACTCCTTTTAAGGGATTT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 CTCCCTCAGCTGAAGGGGTGGGGAAGGGCTCCCAAAGCCATAACTCCTTTTAAGGGATTT 1560 Qy 1561 AGAAGGCATAAAAAGGCCCCTGGCTGAGAACTTCCTTCTTCATTCTGCAGTTGG 1614 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 AGAAGGCATAAAAAGGCCCCTGGCTGAGAACTTCCTTCTTCATTCTGCAGTTGG 1614 Claim 45: Constable et al 2018 (US20180125948A1, 05/10/2018) is directed to the compositions and methods comprising rAAV for the prevention or treatment of ocular neovascularization, such as AMD, in a human subject (see, abstract, claims 1-5) and disclosed an intron sequence consisting of SEQ ID NO. 48 (see, para [0101]) that has 100% identity match with instant SEQ ID NO: 13 (as shown below). Query Match 100.0%; Score 133; DB 1; Length 133; Best Local Similarity 100.0%; Matches 133; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGA 60 Qy 61 CAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCC 120 Qy 121 TTTCTCTCCACAG 133 ||||||||||||| Db 121 TTTCTCTCCACAG 133 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Yang 2019 on CYP4V2 and promoter and intron required for expression of CYP4V2 in a vector (rAAV viral vector) in treatment of RPE with additional teachings of Levelard et al 2004 on RdCVF in treatment of RPE, Germaschewski et al 2015 for P2A encoding nucleotide sequence, specific nucleotide sequences of a promoter by Smith et al 2018 and specific nucleotide sequences of a intron by Constable et al 2018 and suggestion or motivation by Byrne et al 2015 on combination treatment CYP4V2 and RdCVF that protects cone and rod photoreceptors in retinal degeneration (RPE) as recited supra to arrive at the invention of claims 39 and 45 to develop a composition comprising Vectors, rAAV vectors for treatment of RPE in a subject. The motivation would be both CYP4V2 and RdCVF are known individually for the treatment of RPE and therefore it would have been obvious to combine the two compositions for the same treatment of RPE and arrive at a third composition to be used for the same purpose with a reasonable expectation for improved therapeutic effect. See MPEP 2144.06 Art Recognized Equivalence for the Same Purpose [R-01.2024]. "It is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose.... [T]he idea of combining them flows logically from their having been individually taught in the prior art." In re Kerkhoven, 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980) (citations omitted) (Claims to a process of preparing a spray-dried detergent by mixing together two conventional spray-dried detergents were held to be prima facie obvious.). See also In re Crockett, 279 F.2d 274, 126 USPQ 186 (CCPA 1960) (Claims directed to a method and material for treating cast iron using a mixture comprising calcium carbide and magnesium oxide were held unpatentable over prior art disclosures that the aforementioned components individually promote the formation of a nodular structure in cast iron.); Ex parte Quadranti, 25 USPQ2d 1071 (Bd. Pat. App. & Inter. 1992) (mixture of two known herbicides held prima facie obvious); and In re Couvaras, 70 F.4th 1374, 1378-79, 2023 USPQ2d 697 (Fed. Cir. 2023) (That the two claimed types of active agents, GABA-a agonists and ARBs, were known to be useful for the same purpose—alleviating hypertension—alone can serve as a motivation to combine). One of the ordinary skills in the art would have a reasonable expectation of success to arrive at the invention of claims 39 and 45 given the applied prior art teachings as recited supra. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), examples of rationales, A-G. 16. Claim 49 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Yang 2019 (WO2019025984A1, 02/07/2019), Levelard et al 2004 (CN1529753A, 09/15/2004), Byrne et al 2015 (J Clin Invest. 2015 Jan;125(1):105-16), Germaschewski et al 2015 (US20150133641A1, 05/14/2015), Hamel 2006 (Orphanet Journal of Rare Diseases 2006, 1:40) as applied to claims 29-30, 37, 50, 71, 73-75, and 78-80 and further in view of Bennicelli et al 2018 (US20180369415A1, 12/27/2018). Claim 49: The combined teachings of Yang 2019, Levelard et al 2004 and Byrne et al 2015, and Germaschewski et al 2015 taught claim 29 as recited supra, however, do not teach the claimed vector SEQ ID NO: 90 and 96. At 100% identity and full length of the sequence of the claimed two vectors. SEQ ID NO: 90. Additional teachings of Yang 2019 (WO2019025984A1) disclosed a vector, rAAV, comprising a nucleic acid molecule, inter alia, encoding a CYP4V2 protein (see, para [0197], [0564]) has 67% query match to instant SEQ ID NO: 90 with 99.9% local identity. Query Match 67.4%; Score 1574.8; Length 1578; Best Local Similarity 99.9%; Matches 1576; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 359 ATGGCGGGGCTCTGGCTGGGGCTCGTGTGGCAGAAGCTGCTGCTGTGGGGCGCGGCGAGT 418 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCGGGGCTCTGGCTGGGGCTCGTGTGGCAGAAGCTGCTGCTGTGGGGCGCGGCGAGT 60 Qy 419 GCCCTTTCCCTGGCCGGCGCCAGTCTGGTCCTGAGTCTGCTGCAGAGGGTGGCGAGCTAC 478 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Db 61 GCCCTTTCCCTGGCCGGCGCCAGTCTGGTCCTGAGCCTGCTGCAGAGGGTGGCGAGCTAC 120 Qy 479 GCGCGGAAATGGCAGCAGATGCGGCCCATCCCCACGGTGGCCCGCGCCTACCCACTGGTG 538 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCGCGGAAATGGCAGCAGATGCGGCCCATCCCCACGGTGGCCCGCGCCTACCCACTGGTG 180 Qy 539 GGCCACGCGCTGCTGATGAAGCCGGACGGGCGAGAATTTTTTCAGCAGATCATTGAGTAC 598 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GGCCACGCGCTGCTGATGAAGCCGGACGGGCGAGAATTTTTTCAGCAGATCATTGAGTAC 240 Qy 599 ACAGAGGAATACCGCCACATGCCGCTGCTGAAGCTCTGGGTCGGGCCAGTGCCCATGGTG 658 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACAGAGGAATACCGCCACATGCCGCTGCTGAAGCTCTGGGTCGGGCCAGTGCCCATGGTG 300 Qy 659 GCCCTTTATAATGCAGAAAATGTGGAGGTAATTTTAACTAGTTCAAAGCAAATTGACAAA 718 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GCCCTTTATAATGCAGAAAATGTGGAGGTAATTTTAACTAGTTCAAAGCAAATTGACAAA 360 Qy 719 TCCTCTATGTACAAGTTTTTAGAACCATGGCTTGGCCTAGGACTTCTTACAAGTACTGGA 778 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TCCTCTATGTACAAGTTTTTAGAACCATGGCTTGGCCTAGGACTTCTTACAAGTACTGGA 420 Qy 779 AACAAATGGCGCTCCAGGAGAAAGATGTTAACACCCACTTTCCATTTTACCATTCTGGAA 838 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AACAAATGGCGCTCCAGGAGAAAGATGTTAACACCCACTTTCCATTTTACCATTCTGGAA 480 Qy 839 GATTTCTTAGATATCATGAATGAACAAGCAAATATATTGGTTAAGAAACTTGAAAAACAC 898 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GATTTCTTAGATATCATGAATGAACAAGCAAATATATTGGTTAAGAAACTTGAAAAACAC 540 Qy 899 ATTAACCAAGAAGCATTTAACTGCTTTTTTTACATCACTCTTTGTGCCTTAGATATCATC 958 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATTAACCAAGAAGCATTTAACTGCTTTTTTTACATCACTCTTTGTGCCTTAGATATCATC 600 Qy 959 TGTGAAACAGCTATGGGGAAGAATATTGGTGCTCAAAGTAATGATGATTCCGAGTATGTC 1018 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TGTGAAACAGCTATGGGGAAGAATATTGGTGCTCAAAGTAATGATGATTCCGAGTATGTC 660 Qy 1019 CGTGCAGTTTATAGAATGAGTGAGATGATATTTCGAAGAATAAAGATGCCCTGGCTTTGG 1078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CGTGCAGTTTATAGAATGAGTGAGATGATATTTCGAAGAATAAAGATGCCCTGGCTTTGG 720 Qy 1079 CTTGATCTCTGGTACCTTATGTTTAAAGAAGGATGGGAACACAAAAAGAGCCTTCAGATC 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Db 721 CTTGATCTCTGGTACCTTATGTTTAAAGAAGGATGGGAACACAAAAAGAGCCTTAAGATC 780 Qy 1139 CTACATACTTTTACCAACAGTGTCATCGCGGAACGGGCCAATGAAATGAACGCCAATGAA 1198 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CTACATACTTTTACCAACAGTGTCATCGCGGAACGGGCCAATGAAATGAACGCCAATGAA 840 Qy 1199 GACTGTAGAGGTGATGGCAGGGGCTCTGCCCCCTCCAAAAATAAACGCAGGGCCTTTCTT 1258 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GACTGTAGAGGTGATGGCAGGGGCTCTGCCCCCTCCAAAAATAAACGCAGGGCCTTTCTT 900 Qy 1259 GACTTGCTTTTAAGTGTGACTGATGACGAAGGGAACAGGCTAAGTCATGAAGATATTCGA 1318 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GACTTGCTTTTAAGTGTGACTGATGACGAAGGGAACAGGCTAAGTCATGAAGATATTCGA 960 Qy 1319 GAAGAAGTTGACACCTTCATGTTTGAGGGGCACGATACAACTGCAGCTGCAATAAACTGG 1378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 GAAGAAGTTGACACCTTCATGTTTGAGGGGCACGATACAACTGCAGCTGCAATAAACTGG 1020 Qy 1379 TCCTTATACCTGTTGGGTTCTAACCCAGAAGTCCAGAAAAAAGTGGATCATGAATTGGAT 1438 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TCCTTATACCTGTTGGGTTCTAACCCAGAAGTCCAGAAAAAAGTGGATCATGAATTGGAT 1080 Qy 1439 GACGTGTTTGGGAAGTCTGACCGTCCCGCTACAGTAGAAGACCTGAAGAAACTTCGGTAT 1498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GACGTGTTTGGGAAGTCTGACCGTCCCGCTACAGTAGAAGACCTGAAGAAACTTCGGTAT 1140 Qy 1499 CTGGAATGTGTTATTAAGGAGACCCTTCGCCTTTTTCCTTCTGTTCCTTTATTTGCCCGT 1558 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CTGGAATGTGTTATTAAGGAGACCCTTCGCCTTTTTCCTTCTGTTCCTTTATTTGCCCGT 1200 Qy 1559 AGTGTTAGTGAAGATTGTGAAGTGGCAGGTTACAGAGTTCTAAAAGGCACTGAAGCCGTC 1618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AGTGTTAGTGAAGATTGTGAAGTGGCAGGTTACAGAGTTCTAAAAGGCACTGAAGCCGTC 1260 Qy 1619 ATCATTCCCTATGCATTGCACAGAGATCCGAGATACTTCCCCAACCCCGAGGAGTTCCAG 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 ATCATTCCCTATGCATTGCACAGAGATCCGAGATACTTCCCCAACCCCGAGGAGTTCCAG 1320 Qy 1679 CCTGAGCGGTTCTTCCCCGAGAATGCACAAGGGCGCCATCCATATGCCTACGTGCCCTTC 1738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CCTGAGCGGTTCTTCCCCGAGAATGCACAAGGGCGCCATCCATATGCCTACGTGCCCTTC 1380 Qy 1739 TCTGCTGGCCCCAGGAACTGTATAGGTCAAAAGTTTGCTGTGATGGAAGAAAAGACCATT 1798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TCTGCTGGCCCCAGGAACTGTATAGGTCAAAAGTTTGCTGTGATGGAAGAAAAGACCATT 1440 Qy 1799 CTTTCGTGCATCCTGAGGCACTTTTGGATAGAATCCAACCAGAAAAGAGAAGAGCTTGGT 1858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CTTTCGTGCATCCTGAGGCACTTTTGGATAGAATCCAACCAGAAAAGAGAAGAGCTTGGT 1500 Qy 1859 CTAGAAGGACAGTTGATTCTTCGTCCAAGTAATGGCATCTGGATCAAGTTGAAGAGGAGA 1918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 CTAGAAGGACAGTTGATTCTTCGTCCAAGTAATGGCATCTGGATCAAGTTGAAGAGGAGA 1560 Qy 1919 AATGCAGATGAACGCTAA 1936 |||||||||||||||||| Db 1561 AATGCAGATGAACGCTAA 1578 SEQ ID NO: 96. Bennicelli et al 2018 (US20180369415A1, 12/27/2018) is directed to a recombinant viral vector, such as AAV, expression cassettes, rAAV vector comprising RdCVF sequence and the disclosed SEQ ID NO: 5 has 35.7% query match and 76.2% best local identity with instant SEQ ID NO: 96. Query Match 35.7%; Score 390.2; Length 4745; Best Local Similarity 76.2%; Matches 565; Conservative 0; Mismatches 28; Indels 148; Gaps 1; Qy 351 CCGCCACCATGGCCTCCCTGTTCTCTGGCCGCATCCTGATCCGCAACAATAGCGACCAGG 410 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1583 CCGCCACCATGGCCTCCCTGTTCTCTGGCCGCATCCTGATCCGCAACAATAGCGACCAGG 1642 Qy 411 ACGAGCTGGATACGGAGGCTGAGGTCAGTCGCAGGCTGGAGAACCGGCTGGTGCTGCTGT 470 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1643 ACGAGCTGGATACGGAGGCTGAGGTCAGTCGCAGGCTGGAGAACCGGCTGGTGCTGCTGT 1702 Qy 471 TCTTTGGTGCTGGGGCTTGTCCACAGTGCCAGGCCTTCGTGCCCATCCTCAAGGACTTCT 530 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1703 TCTTTGGTGCTGGGGCTTGTCCACAGTGCCAGGCCTTCGTGCCCATCCTCAAGGACTTCT 1762 Qy 531 TCGTGCGGCTCACAGATGAGTTCTATGTACTGCGGGCGGCTCAGCTGGCCCTGGTGTACG 590 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1763 TCGTGCGGCTCACAGATGAGTTCTATGTACTGCGGGCGGCTCAGCTGGCCCTGGTGTACG 1822 Qy 591 TGTCCCAGGACTCCACGGAGGAGCAGCAGGACCTGTTCCTCAAGGACATGCCAAAGAAAT 650 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1823 TGTCCCAGGACTCCACGGAGGAGCAGCAGGACCTGTTCCTCAAGGACATGCCAAAGAAAT 1882 Qy 651 GGCTTTTCCTGCCCTTTGAGGATGATCTGAGGAGGTGATAAACGCGTGGTTTATCCGATC 710 ||||||||||||||||||||||||||||||||||||||| | | | ||| | Db 1883 GGCTTTTCCTGCCCTTTGAGGATGATCTGAGGAGGTGATCATCTCATGGAT--------- 1933 Qy 711 CACCGGATCTAGATAAGATATCCGATCCACCGGATCTAGATAACTGATCATAATCAGCCA 770 Db 1934 ------------------------------------------------------------ 1933 Qy 771 TACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCT 830 Db 1934 ------------------------------------------------------------ 1933 Qy 831 GAAACATAAAATGAATGCAATTGGCGGCCGCCTCGAGCTGTGCCTTCTAGTTGCCAGCCA 890 | | | | ||||||||||||||||||||||| Db 1934 -------------------CCAAGAGATCTGCCTCGACTGTGCCTTCTAGTTGCCAGCCA 1974 Qy 891 TCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTC 950 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1975 TCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTC 2034 Qy 951 CTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTG 1010 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2035 CTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTG 2094 Qy 1011 GGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCT 1070 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2095 GGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCT 2154 Qy 1071 GGGGATGCGGTGGGCTCTATG 1091 ||||| || | | ||| Db 2155 GGGGACTCGATAAGGAAAATG 2175 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Yang 2019, Levelard et al 2004, Germaschewski et al 2015 as applied to claim 29 with additional teachings of Yang 2019 on a vector SEQ ID NO: 90 and Bennicelli et al 2018 on a vector SEQ ID NO: 96 and one of the ordinary skills knowledge, laboratory research expertise and the applied prior art teaching to construct a viral vector rAAV vector to arrive at the invention of claim 49. Although the teachings of Yang 2019 on a vector SEQ ID NO: 90 and Bennicelli et al 2018 on a vector SEQ ID NO: 96 do not disclose the claimed vector sequences with 100% identity, it is within the skills of one of the ordinary skills knowledge, laboratory research expertise and the applied prior art teaching (the prior art of record teaches regulatory elements of AAV, regulatory elements pf plasmid vector, promoter(s), intron(s), vectors, to construct the claimed vectors) to construct two viral vectors, rAAV vectors with the claimed SEQ ID NO: 90 and SEQ ID NO: 96 or equivalent rAAV vectors to perform the claimed function to treat RPE in a subject to arrive at the invention of claim 49 with a reasonable expectation of success. The motivation would be both CYP4V2 and RdCVF are known individually for the treatment of RPE and therefore it would have been obvious to combine the two compositions for the same treatment of RPE and arrive at a third composition to be used for the same purpose with a reasonable expectation for improved therapeutic effect. See MPEP 2144.06 Art Recognized Equivalence for the Same Purpose [R-01.2024]. "It is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose.... [T]he idea of combining them flows logically from their having been individually taught in the prior art." In re Kerkhoven, 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980) (citations omitted) (Claims to a process of preparing a spray-dried detergent by mixing together two conventional spray-dried detergents were held to be prima facie obvious.). See also In re Crockett, 279 F.2d 274, 126 USPQ 186 (CCPA 1960) (Claims directed to a method and material for treating cast iron using a mixture comprising calcium carbide and magnesium oxide were held unpatentable over prior art disclosures that the aforementioned components individually promote the formation of a nodular structure in cast iron.); Ex parte Quadranti, 25 USPQ2d 1071 (Bd. Pat. App. & Inter. 1992) (mixture of two known herbicides held prima facie obvious); and In re Couvaras, 70 F.4th 1374, 1378-79, 2023 USPQ2d 697 (Fed. Cir. 2023) (That the two claimed types of active agents, GABA-a agonists and ARBs, were known to be useful for the same purpose - alleviating hypertension - alone can serve as a motivation to combine). One of the ordinary skills in the art would have a reasonable expectation of success to arrive at the invention of claim 49 given the applied prior art teachings as recited supra. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), examples of rationales, A-G. Double Patenting 17. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. 18. Claims 29-31, 34, 37, 39, 45, 49-50, 71, 73-75, and 78-80 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 of U.S. Patent No. US12065663B2 in view of combined prior art teachings of Yang 2019 (WO2019025984A1, 02/07/2019), Levelard et al 2004 (CN1529753A, 09/15/2004), Byrne et al 2015 (J Clin Invest. 2015 Jan;125(1):105-16), Germaschewski et al 2015 (US20150133641A1, 05/14/2015) and Hamel 2006 (Orphanet Journal of Rare Diseases 2006, 1:40). Both the patented claims 1-5 and instant claims 29-31, 34, 37, 39, 45, 49-50, 71, 73-75, and 78-80 are directed to the invention comprising a vector, rAAV vector comprising CYP4V2 for treatment of RPE. The instant claims under examination differ from the patented claim in that the instant claims require two vectors comprising a first vector and a second vector, wherein the first vector comprises a polynucleotide encoding CYP4V2, and the second vector comprises a polynucleotide encoding RdCVF. In view of the combined prior art teachings of Yang 2019 (WO2019025984A1, 02/07/2019), Levelard et al 2004 (CN1529753A, 09/15/2004), Byrne et al 2015 (J Clin Invest. 2015 Jan;125(1):105-16) and Germaschewski et al 2015 (US20150133641A1, 05/14/2015) as recited supra under 35 U.S.C. 103 rejection it would have been obvious to arrive at the composition of the instant claims 29-31, 34, 37, 39, 45, 49-50, 71, 73-75, and 78-80 with a reasonable expectation of success with a motivation to develop improved gene therapy for RPE comprising the first vectors expressing polynucleotide encoding CYP4V2, and the second vector comprises a polynucleotide encoding RdCVF. In addition, the entire prior art teachings as applied to 35 USC 103 rejection as recited supra are incorporated here in entirety to render obvious the instant claims 29-31, 34, 37, 39, 45, 49-50, 71, 73-75, and 78-80 as a variant of the patented claims 1-5. 19. Claims 29-31, 34, 37, 39, 45, 49-50, 71, 73-75, and 78-80 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4 and 8-12 of copending Application No. 18/360,742 in view of combined prior art teachings of Yang 2019 (WO2019025984A1, 02/07/2019), Levelard et al 2004 (CN1529753A, 09/15/2004), Byrne et al 2015 (J Clin Invest. 2015 Jan;125(1):105-16), Germaschewski et al 2015 (US20150133641A1, 05/14/2015) and Hamel 2006 (Orphanet Journal of Rare Diseases 2006, 1:40). Although the claims at issue are not identical, they are not patentably distinct from each other because they both recite a composition comprising a vector, rAAV vector for treating retinal pigment epithelium (RPE) using a CYP4V2 vector. Both the present claimed invention and the co-pending application claim a composition comprising a vector, rAAV vector for treating a human subject with retinal pigment epithelium, including Bietti’s crystalline dystrophy, by administering an AAV vector, a cell containing the vector, or a pharmaceutical composition using the vector or the cell along with an acceptable adjuvant. Both applications also claim a vector comprising CYP4V2 comprising the polynucleotide sequences of SEQ ID NO: 76-82 and the nucleotide sequences of SEQ ID NO: 62. The instant claims require two vectors, viral vectors, first vector with polynucleotide encoding CYP4V2, and the second vector comprises a polynucleotide encoding RdCVF. Although the copending reference claims recite CYP4V2, the specification of the reference application including the title and abstract recited “use of CYP4V2 and RdCVF in the manufacture of a medicament for treating, alleviating, and/or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy. The present application also relates to an isolated nucleic acid molecule comprising a polynucleotide encoding CYP4V2 and a polynucleotide encoding RdCVF”. The co-pending claim 1 recited the vector AAV2/8. The instant application specification has preferred embodiment working example 8 that recite AAV2/8 vector (see, page 43). This is a provisional nonstatutory double patenting rejection. Conclusion 20. No claim is allowed. 21. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00. 22. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SAMADHAN JAISING JADHAO/ Examiner, Art Unit 1672 /BENNETT M CELSA/ Primary Examiner , Art Unit 1600
Read full office action

Prosecution Timeline

Jan 24, 2023
Application Filed
Mar 17, 2023
Response after Non-Final Action
Jul 14, 2026
Non-Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12748110
BOVINE PATHOGEN ARRAY
4y 8m to grant Granted Sep 29, 2026
Patent 12714744
CORONAVIRUS AND INFLUENZA COMPOSITIONS AND METHODS FOR USING THEM
4y 3m to grant Granted Aug 25, 2026
Patent 12600750
METHODS FOR INACTIVATING AND STORING RESPIRATORY SYNCYTIAL VIRUS
4y 8m to grant Granted Apr 14, 2026
Patent 12577279
INFLUENZA VIRUS VACCINES AND USES THEREOF
3y 11m to grant Granted Mar 17, 2026
Patent 12516351
NOVEL AAV CAPSIDS AND COMPOSITIONS CONTAINING SAME
4y 2m to grant Granted Jan 06, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
93%
With Interview (+46.2%)
3y 7m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 64 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month