DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
2. Applicant’s election without traverse of Group I and the species of the IDH1 gene R132H mutation and the primer pair of SEQ ID NO: 1 and 2 in the reply filed on 22 July 2025 is acknowledged.
Claim Status
3. Claims 1-8 are pending.
Claims 7 and 8 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Claims 3-6 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim.
Claims 1 and 2 read on the elected invention and have been examined herein. It is noted that claim 1 encompass non-elected subject matter of the primer pairs of SEQ ID NO: 3 and 4; 5 and 6; and 7 and 8. Prior to the allowance of claims, any non-elected subject matter which has not been rejoined with the elected subject matter will be required to be removed from the claims.
Claim Objections
4. Claim 2 is objected to because this dependent claims improperly utilizes the article “A” in referring to the prior claim (e.g., “A primer pair according to Claim 1”). The preamble of claim 2 should be amended to recite the article “The” (i.e., “The primer pair according to claim 1...”).
Claim Rejections - 35 USC § 112(b)
5. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1 and 2 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1 and 2 are indefinite over the recitation of “one of the forward-reverse primer pairs having SEQ. ID 1-2...” First, the recitation of “the forward-reverse primer pairs” lacks proper antecedent basis because while claim 1 previously refers to a primer pair in general, it does not previously refer to a “forward-reverse primer pair.” Secondly, claim 1 is unclear because it does not specifically limit the primer pair to one of the subsequently recited nucleotide sequences. This rejection may be obviated by amendment of claim 1 to recite “…mutations in glioma tumors, wherein the primer pair comprises a forward primer and a reverse primer, and the forward primer and reverse primer comprise the nucleotide sequence of SEQ ID NO: 1 and 2, the nucleotide sequence of SEQ ID NO: 3 and 4…, or the nucleotide sequence of SEQ ID NO: 9 and 10”. Note also that the claims should recite “SEQ ID NO:” rather than “SEQ. ID”.
Claims 1 and 2 are also indefinite over the recitation of “nucleotide sequences comprises three overlapped mismatched nucleotides at the 3' terminal end thereof for the wild type DNA (WT-DNA) and the last one of these nucleotides are the matching nucleotide for the mutant DNA and two nucleotides from the last one are the mismatching nucleotides for the mutant DNA” because it is not clear as to what is encompassed by this phrase. For example it is not clear as to what constitutes “three overlapped mismatched nucleotides” or what constitutes a “matching nucleotide.” This rejection may be obviated by amendment of claim 1 to recite, for example, “wherein either the forward primer or the reverse primer has a 3’-end in which each of the three terminal nucleotides are mismatched with IDH1 or IDH2 wild type DNA (WT-DNA), and the 3’ terminal nucleotide is matched to IDH1 or IDH2 mutant DNA and the 3’ penultimate nucleotide and adjacent nucleotide have a mismatch with the mutant IDH1 or mutant IDH2 DNA.” See p. 7 final para to p. 8 first para of the specification which provides support for this limitation.
Claim 2 is indefinite over the recitation of “the primer pair used for detecting IDH1 gene R132H mutation” because this phrase lacks proper antecedent basis since the claim previously refers generally to a primer pair and not to a primer pair used for detecting an IDH1 gene R132H mutation. This rejection may be obviated by amendment of claim 2 to recite “The primer pair according to claim 1, wherein the primer pair detects an IDH1 gene R132H mutation, and the primer pair comprises a forward primer having the nucleotide sequence of SEQ ID NO: 1 and a reverse primer having the nucleotide sequence of SEQ ID NO: 2.”
Claim Rejections - 35 USC § 102
6. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1 and 2 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Avsar et al (Molecular Diagnosis & Therapy. 09 April 2020. 24: 327-338 and Supplementary Table 1; cited in the Office action of 23 May 2023).
Avsar teaches methods for detecting mutations in the IDH1 and IDH2 mutations in gliomas, intraoperatively or postoperatively, by performing PCR using pairs of primers (e.g., abstract and sections 2.1, 2.2 and 2.3). Avsar states (p. 329, col. 2) “The presence of R132H (G395A), R132C (C394T) and R132G (C394G) mutations in the IDH1 gene and R172K (G515A), R172M (G515T) and R172W (A514T) were checked in tumor samples.” In Supplementary Table 1, Avsar discloses a primer pair for amplifying and detecting the R132H mutation in the IDH1 gene, wherein the primer pair comprises a forward primer that is identical to present SEQ ID NO: 1 and a reverse primer that is identical to present SEQ ID NO: 2. Avsar (see the legend for Figure 1) describes the primer pair for amplifying and detecting the IDH1 R132H mutation as follows:
“IDH1 R132 WT DNA (black) has three mismatched nucleotides (red crosses) with the designed primer (blue) resulting in inhibition of primer extension and DNA amplifcation. IDH1 R132H MT DNA (purple) has one terminal match (green check) and one penultimate and one antepenultimate mismatch (red crosses) with the designed primer (blue) resulting in proper primer extension and DNA amplifcation (orange arrow).”
Accordingly, Avsar anticipates the primer pair of claims 1 and 2.
Note that the Avsar reference was published online 09 April 2020, which is prior to the filing date of priority document TR2020/05788, filed 10 April 2020. Note also that the Avsar reference includes authors that are not listed as inventors in the present application. Further, Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216.
7. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Dong et al (CN103436613A; published 11 December 2013; translation included) discloses methods for detecting IDH1 and IDH2 gene mutations comprising performing ARMS using primers that include 2 or 3 mismatches at the 3’ end of one of the primers, and kits comprising the reagents for performing the disclosed methods and particularly kits comprising the ARMS primers (e.g., abstract and p. 4 and 6 of the translation). The reference states (p. 4 of translation):
“In order to increase the specificity of primer, the mispairing while reducing primer with target DNA generation mispairing is extended, and can introduce another one or two base mismatch by 2-3 the base at primer 3 ' end, make it and template between the multiple mispairing of formation to stop the mistake extension.”
A refractory primer for IDH1 is disclosed therein as SEQ ID NO: 1 and a primer for detecting the R132H mutation in IDH1 is disclosed in SEQ ID NO: 6 therein (i.e., “For the specificity ARMS primer sequence of No. 132 codon CGT-CAT of IDH1 gene as shown in SEQ ID NO.6: 5 '-CTTACTTGATCCCCATAAGCATGCT-3 '”; see p. 8). Alignment of SEQ ID NO: 1 and SEQ ID NO: 6 of CN103436613A with present SEQ ID NO: 2 below, wherein SEQ ID NO: 1 and 6 of CN103436613A include nucleotides 11-32 and 12-32, respectively, of present SEQ ID NO: 2 but differ from SEQ ID NO: 2 at nucleotides 33-35 of SEQ ID NO: 2.
Present SEQ ID NO: 2 GCCAACATGACTTACTTGATCCCCATAAGCATTTA
SEQ ID NO.1: TTACTTGATCCCCATAAGCATAACGSEQ ID NO: 6: CTTACTTGATCCCCATAAGCATGCT
B. Newton et al (Nucleic Acids Research. 1989. 17(7): 2503-2516) teaches methods of analyzing nucleic acids for the presence of mutations using the amplification refractory mutation system (ARMS). Newton teaches that ARMS uses primers that have a mismatched residue at their 3’ end with respect to a target DNA and that such primers are not able to amplify that target DNA. Newton further teaches “the primer is synthesised in two forms. The 'normal' form is refractory to PCR on 'mutant' template DNA and the 'mutant' form is refractory to PCR on 'normal' DNA. In some instances a single 3' -mismatched base does allow amplification to proceed. We have shown that introducing additional deliberate mismatches near the 3' end of appropriate primers ameliorates this problem (p. 2504). See also Figure 2 which exemplifies primers having an extra mismatch, in addition to the 3’ nucleotide mismatch / variable position. Newton teaches that the introduction of a second mismatch in the 3’ end of the primer often increases the specificity of the primer (e.g., p. 2511 to p. 2512, first para)).
This Office action has an attached requirement for information under 37 CFR 1.105. A complete reply to this Office action must include a complete reply to the attached requirement for information. The time period for reply to the attached requirement coincides with the time period for reply to this Office action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CARLA J MYERS whose telephone number is (571)272-0747. The examiner can normally be reached M-Th 6:30-5:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached on 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CARLA J MYERS/Primary Examiner, Art Unit 1682
Requirement for Information under 37 CFR 1.105
Applicant and the assignee of this application are required under 37 CFR 1.105 to provide the following information that the examiner has determined is reasonably necessary to the examination of this application.
The information requested is the content of Figure 1 in the reference Avsar et al. “Rapid and Ultra-sensitive intraoperative IDH mutation detection system in glial tumors.” Congress of Neurological Surgeons (CNS), 2018 Annual Meeting, held October 6-10, 2018, Houston, Texas, USA.
The online version of Figure 1 of this reference, which was co-authored by the present inventors, does not include the image or any accompanying text for Figure 1 - i.e., “Figure 1” is blank. This poster / reference appears to have been made available to the public online or at the annual CNS meeting held October 6-10, 2018. The reference discloses performing “3-mismatch ARMS” to detect the IDH1 R132H mutation (see, e.g., “Methods” and “Conclusions”). Figure 2 of the reference teaches that the IDH1 R132H mutation occurs as a result of a substitution of a G to A nucleotide in codon 132 - i.e., CGT > CAT. It is stated “By addition of the third mismatch to conventional ARMS we successfully detect IDH1 and IDH2 mutations by 100% coherency with Sanger sequencing” (see “Results”). It is also stated that the 3-mismatch ARMS assay can be “adapted for detection of various mutations through easy primer design” (see “Conclusions”). The currently available text and figures in this reference do not specifically disclose the location of the third mismatch relative to the wild type IDH1 gene in the primer used to perform the 3-mismatch ARMS assay.
In response to this requirement, please also provide copies of each publication which any of the inventors authored or co-authored and which describe the 3-mismatch ARMS assay or the claimed primers.
In responding to those requirements that require copies of documents, where the document is a bound text or a single article over 50 pages, the requirement may be met by providing copies of those pages that provide the particular subject matter indicated in the requirement, or where such subject matter is not indicated, the subject matter found in applicant’s disclosure.
The fee and certification requirements of 37 CFR 1.97 are waived for those documents submitted in reply to this requirement. This waiver extends only to those documents within the scope of this requirement under 37 CFR 1.105 that are included in the applicant’s first complete communication responding to this requirement. Any supplemental replies subsequent to the first communication responding to this requirement and any information disclosures beyond the scope of this requirement under 37 CFR 1.105 are subject to the fee and certification requirements of 37 CFR 1.97.
The applicant is reminded that the reply to this requirement must be made with candor and good faith under 37 CFR 1.56. Where the applicant does not have or cannot readily obtain an item of required information, a statement that the item is unknown or cannot be readily obtained may be accepted as a complete reply to the requirement for that item.
This requirement is an attachment of the enclosed Office action. A complete reply to the enclosed Office action must include a complete reply to this requirement. The time period for reply to this requirement coincides with the time period for reply to the enclosed Office action.