Prosecution Insights
Last updated: August 06, 2026
Application No. 17/765,368

COMPOSITIONS AND METHODS FOR OCULAR THERAPY

Non-Final OA §102§103§112
Filed
Mar 30, 2022
Priority
Oct 08, 2019 — provisional 62/912,427 +1 more
Examiner
MARVICH, MARIA
Art Unit
1634
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The College of the Holy Cross
OA Round
2 (Non-Final)
55%
Grant Probability
Moderate
2-3
OA Rounds
0m
Est. Remaining
83%
With Interview

Examiner Intelligence

Grants 55% of resolved cases
55%
Career Allowance Rate
538 granted / 983 resolved
-5.3% vs TC avg
Strong +28% interview lift
Without
With
+27.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
39 currently pending
Career history
1031
Total Applications
across all art units

Statute-Specific Performance

§101
3.8%
-36.2% vs TC avg
§103
27.6%
-12.4% vs TC avg
§102
19.0%
-21.0% vs TC avg
§112
35.9%
-4.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 983 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This office action is in response to an amendment filed 4/27/2026. Claims 62-65, 71, 72, 75-81, and 87-95 are pending. Claims 76 and 91-93 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected subject matter, there being no allowable generic or linking claim. Claims 62-64, 65, 71, 72, 75-81, 87-90, 94 and 95, drawn to a vector comprising an expression cassette comprising an hMMP-3 or variant thereof coding sequence that is optimized in the reply filed on 8/29/2025 are under examination. This application is a 371 filing of PCT/US2020/054620 filed 10/7/2020 which claims priority to U.S. provisional 62/912,427 filed 10/8/2019. Response to Amendments The correction to remove the abbreviations is sufficient to overcome the objections previously noted thereto. As well, the amendments to the claims have overcome the rejection of duplicate claims. Applicants have argued that the CRF was indicated as accepted. A message has been sent to SLIC to make sure the status of the CRF is updated to accepted as it is currently listed as a CRFE. Claim Objections Claims 64 is objected to because of the following informalities: The phrasing in claim 64 and 65, has not been properly corrected as a SEQ ID NO: is only a place holder and should recite –to (from) one of the nucleotide sequences of SEQ ID--. This is true of claims 80 and 81. This objection has not been overcome. Appropriate correction is required. Claim Rejections - 35 USC § 112, first paragraph The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 62-64, 71, 72, 75-80, 87-90, 94 and 95 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. This rejection is maintained. Claim 62 requires that the vector encode a hMMP-3 or a functional variant thereof. The recitation of a “functional variant” is a non-limiting term wherein the actual structural or functional requirements are not known. Applicants simply use this terminology but do not provide a description of what is necessary for the encoding product to be a functional variant. It is not clear if the protein that is a functional variant exists in fact. This is true of claim 77. To this end, claim 64 and 80 recite sequence that are variants of SEQ ID NO:23-27. Claim 63 requires that the transgene be codon optimized not just for human cells but specifically for HCEC (human corneal endothelial cells). However, there is no teaching of the distinction between human codon optimized and HCEC codon optimized. Applicants have not described the conversions that are necessary to meet these requirements. A search of the art did not demonstrate that this was a known descriptive in the art. This is true of claim 79. The transgene then encodes hMMP3 or a functional variant defining the function. To this end, it is not clear what functional properties this variant must have. As a first issue, this encompasses a genus of proteins. Structurally, the transgene is simply defined in claim 62 as the coding sequence for this set of proteins. As well, the transgene is optimized for human expression which is taught in example 6 as codon optimization and/or CpG depletion. This lead to SEQ ID NO:23-27. Claim 63 provides for an even larger genus of sequences in that the transgene is at least 80% identical to any of these sequences. Hence, this large genus sequence must encode hMMP3 or a functional variant, be optimized for expression in humans. Hence, functional variants as well as hMMP3 proteins that are human matrix metalloproteinases that are optimized for expression in a human host cell are limited in description to codon optimization and/or CpG deletion (SEQ ID NO:23-27). Hence, if a sequence shares less than 100% identity to SEQ ID NO:26 (see art) it must also encode hMMP3 or a functional variant and be optimized for human expression and yet the guidance for the functional parameters or structural parameters for the required structure/function nexus is not provided for in the disclosure. To this end, the MPEP provides such guidance (emphasis added). If the application as filed does not disclose the complete structure (or acts of a process) of the claimed invention as a whole, determine whether the specification discloses other relevant identifying characteristics sufficient to describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize applicant was in possession of the claimed invention. For example, if the art has established a strong correlation between structure and function, one skilled in the art would be able to predict with a reasonable degree of confidence the structure of the claimed invention from a recitation of its function. Thus, the written description requirement may be satisfied through disclosure of function and minimal structure when there is a well-established correlation between structure and function. In contrast, without such a correlation, the capability to recognize or understand the structure from the mere recitation of function and minimal structure is highly unlikely. In this latter case, disclosure of function alone is little more than a wish for possession; it does not satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (written description requirement not satisfied by merely providing "a result that one might achieve if one made that invention"); In re Wilder, 736 F.2d 1516, 1521, 222 USPQ 369, 372-73 (Fed. Cir. 1984) (affirming a rejection for lack of written description because the specification does "little more than outline goals appellants hope the claimed invention achieves and the problems the invention will hopefully ameliorate"). Compare Fonar, 107 F.3d at 1549, 41 USPQ2d at 1805 (disclosure of software function adequate in that art). As recited, the disclosure lacks critical elements that provide necessary function. Response to Arguments Applicants argue simply argue that one could with the disclosure of SEQ ID NO:23-27 with available assays to identify protease activity one could determine what is considered a functional variant. The arguments are not persuasive for the following reasons. First, the seqeucne applicants argue are representative of functional variatns SEQ ID NO:23-27 are actually wild type and optimized sequences. PNG media_image1.png 314 294 media_image1.png Greyscale As applicants already claim optimized sequences that are represented by SEQ ID NO:23-27, there are no additional variants. To this end, methods of making a protein are well known in the art. However, applicants desire a specific function of this protein. While applicants profess to know which variants would mediate such function, there is no demonstration of the structure-fucntion relationship or the variants that would be models for identiftying said variants. In the end, applicants have not completed any reasonable experiments and hence do not provide description of the invention. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116). Structural features that could distinguish the compounds of the claimed genus from others not encompassed by the genus are missing from the disclosure. No common structural attributes identify the members of the genus. The general knowledge and level of skill in the art do not supplement the omitted description because specific, not general, guidance is needed. Since the disclosure fails to describe common attributes or characteristics that identify members of the genera, and because the genera are highly variant. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 62, 75, 78, 88-90 and 94 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ciliberto et al (CN 101365715, see translation). Ciliberto et al teaches a fusion peptide comprising human MMP-3 (see page 3¶7 combined with page 2, ¶2). The structure is optimized for expression in human cells(see abstract). The vector is in a pharmaceutical carrier or cell (page 22, ¶ 5, page 30, claim 17 and on). The sequence is operably linked to a promoter (page 11). Response to Arguments As to the prior art, amendments to limit the type of optimization to require one or more codon optimization and CpG deletions has not overcome the rejection based upon Ciliberto et al. It is noted that while Ciliberto taught MMP-11, the claims required a functional variant with no specific definition of structure and function and the two are functionally and structurally related. As set forth above, Ciliberto et al on page 3, codons are optimized. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 62-64, 71, 72, 75, 77-80, 87-90, 94 and 95 are rejected under 35 U.S.C. 103 as being unpatentable over Borras et al (U.S. 20110301228) in view of Gong et al (US 20190032155). This is a new rejection necessitated by applicants’ amendment. Borras et al teaches a human MMP3 (see ¶0179) for disorders such as glaucoma (see e.g. abstract). For ocular disorders, the art teaches design of vectors includes use of endothelial cell specific promoters (as recited in claims 63, 79 and 94) in AAV wherein sequences are codon optimized (as recited in claims 62 and 77) (see Gong et al, ¶0059 and 0063). Based on such teachings, it would have prima facie been obvious to one of ordinary skill in the art at the time the invention was made to incorporate the codon optimizations and endothelial cell specific promoter as these are well known and standardly used modifications of vectors. Such a modification would have resulted in a vector encompassed by claim 62 and 63. As noted above: 1) Borras et al teach use of MMP3 in ocular therapy; 2) Gong et al teach use of modifications to codons as well as promoters in order to prepare AAV vectors for ocular therapy. Thus, a person of ordinary skill in the art, absent evidence to the contrary, would have reasonably expected that the expanded vector would allow improved treatment. Borras teaches a vector that is an AAV with ITR (see e.g. ¶0222 and 0225) and is in a pharmaceutical carrier or cell (¶ 0160) as recited in claims 71 and 87. Gong teaches that the vector can be AAV9 or a ssAAV as recited in claim 72 and 95 (see e.g. ¶0006 and 0232). The sequence is 97.4% related to SEQ ID NO:26 (see below as recited in claims 64 and 80). US-13-147-013-5 Filing date in PALM: 2011-08-25 Sequence 5, US/13147013 GENERAL INFORMATION APPLICANT: University of North Carolina, Chapel Hill APPLICANT: Borras, Teresa APPLICANT: Spiga, Maria-Grazia TITLE OF INVENTION: GENE THERAPY VECTOR FOR TREATMENT OF STEROID GLAUCOMA FILE REFERENCE: 421-247 PCT CURRENT APPLICATION NUMBER: US/13/147,013 CURRENT FILING DATE: 2011-07-29 PRIOR APPLICATION NUMBER: 61/151,654 PRIOR FILING DATE: 2009-02-11 NUMBER OF SEQ ID NOS: 98 SEQ ID NO 5 LENGTH: 1828 TYPE: DNA ORGANISM: Homo sapiens\ ALIGNMENT: Query Match 97.4%; Score 1397.2; Length 1828; Best Local Similarity 98.4%; Matches 1411; Conservative 0; Mismatches 23; Indels 0; Gaps 0; Qy 1 ATGAAGAGTCTTCCAATCCTACTGTTGCTGTGTGTGGCAGTTTGCTCAGCCTATCCATTG 60 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 66 ATGAAGAGTCTTCCAATCCTACTGTTGCTGTGCGTGGCAGTTTGCTCAGCCTATCCATTG 125 Qy 61 GATGGAGCTGCAAGGGGTGAGGACACCAGCATGAACCTTGTTCAGAAATATCTAGAAAAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 126 GATGGAGCTGCAAGGGGTGAGGACACCAGCATGAACCTTGTTCAGAAATATCTAGAAAAC 185 Qy 121 TACTATGACCTCAAAAAAGATGTGAAACAGTTTGTTAGGAGAAAGGACAGTGGTCCTGTT 180 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 186 TACTACGACCTCAAAAAAGATGTGAAACAGTTTGTTAGGAGAAAGGACAGTGGTCCTGTT 245 Qy 181 GTTAAAAAAATCAGAGAAATGCAGAAGTTCCTTGGATTGGAGGTGACAGGGAAGCTGGAC 240 |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| Db 246 GTTAAAAAAATCCGAGAAATGCAGAAGTTCCTTGGATTGGAGGTGACGGGGAAGCTGGAC 305 Qy 241 TCTGACACTCTGGAGGTGATGAGAAAGCCCAGGTGTGGAGTTCCTGATGTTGGTCACTTC 300 || |||||||||||||||||| | |||||||||||||||||||||||||||||||||||| Db 306 TCCGACACTCTGGAGGTGATGCGCAAGCCCAGGTGTGGAGTTCCTGATGTTGGTCACTTC 365 Qy 301 AGAACCTTTCCTGGCATCCCCAAGTGGAGGAAAACCCACCTTACATACAGGATTGTGAAT 360 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Db 366 AGAACCTTTCCTGGCATCCCGAAGTGGAGGAAAACCCACCTTACATACAGGATTGTGAAT 425 Qy 361 TATACACCAGATTTGCCAAAAGATGCTGTTGATTCTGCTGTTGAGAAAGCTCTGAAAGTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 426 TATACACCAGATTTGCCAAAAGATGCTGTTGATTCTGCTGTTGAGAAAGCTCTGAAAGTC 485 Qy 421 TGGGAAGAGGTGACTCCACTCACATTCTCCAGGCTGTATGAAGGAGAGGCTGATATAATG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 486 TGGGAAGAGGTGACTCCACTCACATTCTCCAGGCTGTATGAAGGAGAGGCTGATATAATG 545 Qy 481 ATCTCTTTTGCAGTTAGAGAACATGGAGACTTTTACCCTTTTGATGGACCTGGAAATGTT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 546 ATCTCTTTTGCAGTTAGAGAACATGGAGACTTTTACCCTTTTGATGGACCTGGAAATGTT 605 Qy 541 TTGGCCCATGCCTATGCCCCTGGGCCAGGGATTAATGGAGATGCCCACTTTGATGATGAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 606 TTGGCCCATGCCTATGCCCCTGGGCCAGGGATTAATGGAGATGCCCACTTTGATGATGAT 665 Qy 601 GAACAATGGACAAAGGATACAACAGGGACCAATTTATTTCTGGTTGCTGCTCATGAAATT 660 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 666 GAACAATGGACAAAGGATACAACAGGGACCAATTTATTTCTCGTTGCTGCTCATGAAATT 725 Qy 661 GGCCACTCCCTGGGTCTCTTTCACTCAGCCAACACTGAAGCTTTGATGTACCCACTCTAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 726 GGCCACTCCCTGGGTCTCTTTCACTCAGCCAACACTGAAGCTTTGATGTACCCACTCTAT 785 Qy 721 CACTCACTCACAGACCTGACTAGATTCAGACTGTCTCAAGATGATATAAATGGCATTCAG 780 ||||||||||||||||||||| | ||| | |||||||||||||||||||||||||||||| Db 786 CACTCACTCACAGACCTGACTCGGTTCCGCCTGTCTCAAGATGATATAAATGGCATTCAG 845 Qy 781 TCCCTCTATGGACCTCCCCCTGACTCCCCTGAGACCCCCCTGGTACCCACAGAACCTGTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Db 846 TCCCTCTATGGACCTCCCCCTGACTCCCCTGAGACCCCCCTGGTACCCACGGAACCTGTC 905 Qy 841 CCTCCAGAACCTGGGACCCCAGCCAACTGTGATCCTGCTTTGTCCTTTGATGCTGTCAGC 900 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 906 CCTCCAGAACCTGGGACGCCAGCCAACTGTGATCCTGCTTTGTCCTTTGATGCTGTCAGC 965 Qy 901 ACTCTGAGGGGAGAAATCCTGATCTTTAAAGACAGGCACTTTTGGAGAAAATCCCTCAGG 960 ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| Db 966 ACTCTGAGGGGAGAAATCCTGATCTTTAAAGACAGGCACTTTTGGCGCAAATCCCTCAGG 1025 Qy 961 AAGCTTGAACCTGAATTGCATTTGATCTCTTCATTTTGGCCATCTCTTCCTTCAGGGGTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 1026 AAGCTTGAACCTGAATTGCATTTGATCTCTTCATTTTGGCCATCTCTTCCTTCAGGCGTG 1085 Qy 1021 GATGCTGCATATGAAGTTACTAGCAAGGACCTGGTTTTCATTTTTAAAGGAAATCAATTC 1080 ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 1086 GATGCCGCATATGAAGTTACTAGCAAGGACCTCGTTTTCATTTTTAAAGGAAATCAATTC 1145 Qy 1081 TGGGCTATCAGAGGAAATGAGGTAAGAGCTGGATACCCAAGAGGCATCCACACCCTAGGT 1140 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Db 1146 TGGGCTATCAGAGGAAATGAGGTACGAGCTGGATACCCAAGAGGCATCCACACCCTAGGT 1205 Qy 1141 TTCCCTCCAACAGTGAGGAAAATTGATGCAGCCATTTCTGATAAGGAAAAGAACAAAACA 1200 ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| Db 1206 TTCCCTCCAACCGTGAGGAAAATCGATGCAGCCATTTCTGATAAGGAAAAGAACAAAACA 1265 Qy 1201 TATTTCTTTGTAGAGGACAAATACTGGAGATTTGATGAGAAGAGAAATTCCATGGAGCCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1266 TATTTCTTTGTAGAGGACAAATACTGGAGATTTGATGAGAAGAGAAATTCCATGGAGCCA 1325 Qy 1261 GGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1326 GGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTT 1385 Qy 1321 TTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1386 TTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCA 1445 Qy 1381 AATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGTTGA 1434 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1446 AATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGTTGA 1499 Borras teaches pharmaceutical compositions comprising (see abstract). The polynucleotide can be isolated or in a cell (see ¶0146). Conclusion Claims 65 and 81 are described and free of the art. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARIA MARVICH whose telephone number is (571)272-0774. The examiner can normally be reached 8 am - 5 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria Leavitt can be reached at 571-272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MARIA MARVICH/Primary Examiner, Art Unit 1634
Read full office action

Prosecution Timeline

Mar 30, 2022
Application Filed
Nov 03, 2025
Non-Final Rejection mailed — §102, §103, §112
Mar 31, 2026
Response Filed
Jun 25, 2026
Final Rejection mailed — §102, §103, §112
Jul 22, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680108
MINIATURIZED DYSTROPHINS AND USES THEREOF
5y 2m to grant Granted Jul 14, 2026
Patent 12668814
ENGINEERED MUSCLE TARGETING COMPOSITIONS
4y 7m to grant Granted Jun 30, 2026
Patent 12661381
Methods for the Delivery of Therapeutic Agents to Donor Organs
6y 8m to grant Granted Jun 23, 2026
Patent 12655448
HELPER-DEPENDENT ADENOVIRAL GENE THERAPY DELIVERY AND EXPRESSION SYSTEM
4y 11m to grant Granted Jun 16, 2026
Patent 12644137
MATERIALS AND METHODS FOR TREATMENT OF HEMOGLOBINOPATHIES
6y 1m to grant Granted Jun 02, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

2-3
Expected OA Rounds
55%
Grant Probability
83%
With Interview (+27.9%)
4y 0m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 983 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month