Prosecution Insights
Last updated: April 19, 2026
Application No. 17/765,368

COMPOSITIONS AND METHODS FOR OCULAR THERAPY

Non-Final OA §102§112
Filed
Mar 30, 2022
Examiner
MARVICH, MARIA
Art Unit
1634
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The College of the Holy Cross
OA Round
1 (Non-Final)
55%
Grant Probability
Moderate
1-2
OA Rounds
4y 2m
To Grant
82%
With Interview

Examiner Intelligence

Grants 55% of resolved cases
55%
Career Allow Rate
529 granted / 967 resolved
-5.3% vs TC avg
Strong +27% interview lift
Without
With
+26.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
53 currently pending
Career history
1020
Total Applications
across all art units

Statute-Specific Performance

§101
2.9%
-37.1% vs TC avg
§103
26.7%
-13.3% vs TC avg
§102
19.8%
-20.2% vs TC avg
§112
34.9%
-5.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 967 resolved cases

Office Action

§102 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This office action is in response to an amendment filed 8/29/2025. Claims 62-64, 65, 71, 72, 75-81, 87-89 and 90-93 are pending. This application is a 371 filing of PCT/US2020/054620 filed 10/7/2020 which claims priority to U.S. provisional 62/912,427 filed 10/8/2019. Election/Restrictions Applicant's election without traverse of Group I, claims 62-64, 65, 71, 72, 75-81, 87-89 and 90, drawn to a vector comprising an expression cassette comprising an hMMP-3 or variant thereof coding sequence that is optimized in the reply filed on 8/29/2025 is acknowledged. Claims 76 and 91-93 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected subject matter, there being no allowable generic or linking claim. Information Disclosure Statement Information disclosure statements filed 8/9/2025 and 12/15/2025 have been identified and the documents considered. The corresponding signed and initialed PTO Form 1449 has been mailed with this action. Initials indicate that the document has been considered even if the reference is lined through. Sequence Compliance This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 through 1.825 for the reason(s) set forth below or on the attached Notice To Comply With Requirements For Patent Applications Containing Nucleotide Sequence And/Or Amino Acid Sequence Disclosures. Specifically, the CRF was found to have errors and the report issued 4/7/2022/ A new CRF and letter stating that the contents of the sequence listing and the CRF are the same and contain no new matter is required. The nature of the non-compliance did not preclude the examination on the merits of the instant application, the results of which follow. Claim Objections Claims 64 is objected to because of the following informalities: the term “shares” is better recited as “comprises” as shares is not scientifically correct. As well the phrase “a sequence selected from” is incorrect as SEQ ID NO:s are place holders. In claim 64 and 65, this should recite –to (from) one of the nucleotide sequences of SEQ ID--. This is true of claims 80 and 81. Claims 77 and 87 use abbreviations wherein the abbreviations have been previously established. Once an abbreviation has been established it is not necessary to repeat it. Appropriate correction is required. Claims 63 and 79 are objected to under 37 CFR 1.75 as being a substantial duplicate of claims 62 and 77. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).It is not clear that optimization of human cells differs from that of human corneal cells. The methods are not distinguished in the specification and no evidence in the art for distinguishing methods can be found. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. The term “optimized” in claim 62 and 77 is a relative term which renders the claim indefinite. The term “optimized” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. As the claims encompass a large set of modifications without limitation, it is not clear to what end the sequence must be optimized. At one end, linkage to a promoter active in a human can optimize the sequence. The dependent claims are included in the rejection because they fail to address or clarify the basis of the rejection as discussed in detail for the independent claims. Claim Rejections - 35 USC § 112, first paragraph The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 62-64, 71, 72, 75-80, 87-89 and 90 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 62 requires that the vector encode a hMMP-3 or a functional variant thereof. The recitation of a “functional variant” is a non-limiting term wherein the actual structural or functional requirements are not known. Applicants simply use this terminology but do not provide a description of what is necessary for the encoding product to be a functional variant. It is not clear if the protein that is a functional variant exists in fact. This is true of claim 77. To this end, claim 64 and 80 recite sequence that are variants of SEQ ID NO:23-27. Claim 63 requires that the transgene be codon optimized not just for human cells but specifically for HCEC (human corneal endothelial cells). However, there is no teaching of the distinction between human codon optimized and HCEC codon optimized. Applicants have not described the conversions that are necessary to meet these requirements. A search of the art did not demonstrate that this was a known descriptive in the art. This is true of claim 79. The transgene then encodes hMMP3 or a functional variant defining the function. To this end, it is not clear what functional properties this variant must have. As a first issue, this encompasses a genus of proteins. Structurally, the transgene is simply defined in claim 62 as the coding sequence for this set of proteins. As well, the transgene is optimized for human expression which is taught in example 6 as codon optimization and/or CpG depletion. This lead to SEQ ID NO:23-27. Claim 63 provides for an even larger genus of sequences in that the transgene is at least 80% identical to any of these sequences. Hence, this large genus sequence must encode hMMP3 or a functional variant, be optimized for expression in humans. Hence, functional variants as well as hMMP3 proteins that are human matrix metalloproteinases that are optimized for expression in a human host cell are limited in description to codon optimization and/or CpG deletion (SEQ ID NO:23-27). Hence, if a sequence shares less than 100% identity to SEQ ID NO:26 (see art) it must also encode hMMP3 or a functional variant and be optimized for human expression and yet the guidance for the functional parameters or structural parameters for the required structure/function nexus is not provided for in the disclosure. To this end, the MPEP provides such guidance (emphasis added). If the application as filed does not disclose the complete structure (or acts of a process) of the claimed invention as a whole, determine whether the specification discloses other relevant identifying characteristics sufficient to describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize applicant was in possession of the claimed invention. For example, if the art has established a strong correlation between structure and function, one skilled in the art would be able to predict with a reasonable degree of confidence the structure of the claimed invention from a recitation of its function. Thus, the written description requirement may be satisfied through disclosure of function and minimal structure when there is a well-established correlation between structure and function. In contrast, without such a correlation, the capability to recognize or understand the structure from the mere recitation of function and minimal structure is highly unlikely. In this latter case, disclosure of function alone is little more than a wish for possession; it does not satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (written description requirement not satisfied by merely providing "a result that one might achieve if one made that invention"); In re Wilder, 736 F.2d 1516, 1521, 222 USPQ 369, 372-73 (Fed. Cir. 1984) (affirming a rejection for lack of written description because the specification does "little more than outline goals appellants hope the claimed invention achieves and the problems the invention will hopefully ameliorate"). Compare Fonar, 107 F.3d at 1549, 41 USPQ2d at 1805 (disclosure of software function adequate in that art). As recited, the disclosure lacks critical elements that provide necessary function. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 62-64, 75, 77-80, and 88-90 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ciliberto et al (CN 101365715, see translation). Ciliberto et al teaches a fusion peptide comprising human MMP-3 (see page 3¶7 combined with page 2, ¶2). The structure is optimized for expression in human cells 9see abstract). Because it is not clear that there is a path to optimization of corneal cells distinct from human cells, this claim is included in the rejection. The vector is in a pharmaceutical carrier or cell (page 22, ¶ 5, page 30, claim 17 and on). Claims 62, 63, 71, 75, 77-79, and 87-90 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Borras et al (U.S. 20110301228). Borras et al teaches a human MMP-3 that is 97.4% related to SEQ ID NO:26 (see below). The structure is optimized for therapy page 8 and ¶0179). The vector is an AAV with ITR (see e.g. ¶0222 and 0225) and is in a pharmaceutical carrier or cell (¶ 0160). US-13-147-013-5 Filing date in PALM: 2011-08-25 Sequence 5, US/13147013 GENERAL INFORMATION APPLICANT: University of North Carolina, Chapel Hill APPLICANT: Borras, Teresa APPLICANT: Spiga, Maria-Grazia TITLE OF INVENTION: GENE THERAPY VECTOR FOR TREATMENT OF STEROID GLAUCOMA FILE REFERENCE: 421-247 PCT CURRENT APPLICATION NUMBER: US/13/147,013 CURRENT FILING DATE: 2011-07-29 PRIOR APPLICATION NUMBER: 61/151,654 PRIOR FILING DATE: 2009-02-11 NUMBER OF SEQ ID NOS: 98 SEQ ID NO 5 LENGTH: 1828 TYPE: DNA ORGANISM: Homo sapiens\ ALIGNMENT: Query Match 97.4%; Score 1397.2; Length 1828; Best Local Similarity 98.4%; Matches 1411; Conservative 0; Mismatches 23; Indels 0; Gaps 0; Qy 1 ATGAAGAGTCTTCCAATCCTACTGTTGCTGTGTGTGGCAGTTTGCTCAGCCTATCCATTG 60 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 66 ATGAAGAGTCTTCCAATCCTACTGTTGCTGTGCGTGGCAGTTTGCTCAGCCTATCCATTG 125 Qy 61 GATGGAGCTGCAAGGGGTGAGGACACCAGCATGAACCTTGTTCAGAAATATCTAGAAAAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 126 GATGGAGCTGCAAGGGGTGAGGACACCAGCATGAACCTTGTTCAGAAATATCTAGAAAAC 185 Qy 121 TACTATGACCTCAAAAAAGATGTGAAACAGTTTGTTAGGAGAAAGGACAGTGGTCCTGTT 180 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 186 TACTACGACCTCAAAAAAGATGTGAAACAGTTTGTTAGGAGAAAGGACAGTGGTCCTGTT 245 Qy 181 GTTAAAAAAATCAGAGAAATGCAGAAGTTCCTTGGATTGGAGGTGACAGGGAAGCTGGAC 240 |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| Db 246 GTTAAAAAAATCCGAGAAATGCAGAAGTTCCTTGGATTGGAGGTGACGGGGAAGCTGGAC 305 Qy 241 TCTGACACTCTGGAGGTGATGAGAAAGCCCAGGTGTGGAGTTCCTGATGTTGGTCACTTC 300 || |||||||||||||||||| | |||||||||||||||||||||||||||||||||||| Db 306 TCCGACACTCTGGAGGTGATGCGCAAGCCCAGGTGTGGAGTTCCTGATGTTGGTCACTTC 365 Qy 301 AGAACCTTTCCTGGCATCCCCAAGTGGAGGAAAACCCACCTTACATACAGGATTGTGAAT 360 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Db 366 AGAACCTTTCCTGGCATCCCGAAGTGGAGGAAAACCCACCTTACATACAGGATTGTGAAT 425 Qy 361 TATACACCAGATTTGCCAAAAGATGCTGTTGATTCTGCTGTTGAGAAAGCTCTGAAAGTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 426 TATACACCAGATTTGCCAAAAGATGCTGTTGATTCTGCTGTTGAGAAAGCTCTGAAAGTC 485 Qy 421 TGGGAAGAGGTGACTCCACTCACATTCTCCAGGCTGTATGAAGGAGAGGCTGATATAATG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 486 TGGGAAGAGGTGACTCCACTCACATTCTCCAGGCTGTATGAAGGAGAGGCTGATATAATG 545 Qy 481 ATCTCTTTTGCAGTTAGAGAACATGGAGACTTTTACCCTTTTGATGGACCTGGAAATGTT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 546 ATCTCTTTTGCAGTTAGAGAACATGGAGACTTTTACCCTTTTGATGGACCTGGAAATGTT 605 Qy 541 TTGGCCCATGCCTATGCCCCTGGGCCAGGGATTAATGGAGATGCCCACTTTGATGATGAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 606 TTGGCCCATGCCTATGCCCCTGGGCCAGGGATTAATGGAGATGCCCACTTTGATGATGAT 665 Qy 601 GAACAATGGACAAAGGATACAACAGGGACCAATTTATTTCTGGTTGCTGCTCATGAAATT 660 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 666 GAACAATGGACAAAGGATACAACAGGGACCAATTTATTTCTCGTTGCTGCTCATGAAATT 725 Qy 661 GGCCACTCCCTGGGTCTCTTTCACTCAGCCAACACTGAAGCTTTGATGTACCCACTCTAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 726 GGCCACTCCCTGGGTCTCTTTCACTCAGCCAACACTGAAGCTTTGATGTACCCACTCTAT 785 Qy 721 CACTCACTCACAGACCTGACTAGATTCAGACTGTCTCAAGATGATATAAATGGCATTCAG 780 ||||||||||||||||||||| | ||| | |||||||||||||||||||||||||||||| Db 786 CACTCACTCACAGACCTGACTCGGTTCCGCCTGTCTCAAGATGATATAAATGGCATTCAG 845 Qy 781 TCCCTCTATGGACCTCCCCCTGACTCCCCTGAGACCCCCCTGGTACCCACAGAACCTGTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Db 846 TCCCTCTATGGACCTCCCCCTGACTCCCCTGAGACCCCCCTGGTACCCACGGAACCTGTC 905 Qy 841 CCTCCAGAACCTGGGACCCCAGCCAACTGTGATCCTGCTTTGTCCTTTGATGCTGTCAGC 900 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 906 CCTCCAGAACCTGGGACGCCAGCCAACTGTGATCCTGCTTTGTCCTTTGATGCTGTCAGC 965 Qy 901 ACTCTGAGGGGAGAAATCCTGATCTTTAAAGACAGGCACTTTTGGAGAAAATCCCTCAGG 960 ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| Db 966 ACTCTGAGGGGAGAAATCCTGATCTTTAAAGACAGGCACTTTTGGCGCAAATCCCTCAGG 1025 Qy 961 AAGCTTGAACCTGAATTGCATTTGATCTCTTCATTTTGGCCATCTCTTCCTTCAGGGGTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 1026 AAGCTTGAACCTGAATTGCATTTGATCTCTTCATTTTGGCCATCTCTTCCTTCAGGCGTG 1085 Qy 1021 GATGCTGCATATGAAGTTACTAGCAAGGACCTGGTTTTCATTTTTAAAGGAAATCAATTC 1080 ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 1086 GATGCCGCATATGAAGTTACTAGCAAGGACCTCGTTTTCATTTTTAAAGGAAATCAATTC 1145 Qy 1081 TGGGCTATCAGAGGAAATGAGGTAAGAGCTGGATACCCAAGAGGCATCCACACCCTAGGT 1140 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Db 1146 TGGGCTATCAGAGGAAATGAGGTACGAGCTGGATACCCAAGAGGCATCCACACCCTAGGT 1205 Qy 1141 TTCCCTCCAACAGTGAGGAAAATTGATGCAGCCATTTCTGATAAGGAAAAGAACAAAACA 1200 ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| Db 1206 TTCCCTCCAACCGTGAGGAAAATCGATGCAGCCATTTCTGATAAGGAAAAGAACAAAACA 1265 Qy 1201 TATTTCTTTGTAGAGGACAAATACTGGAGATTTGATGAGAAGAGAAATTCCATGGAGCCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1266 TATTTCTTTGTAGAGGACAAATACTGGAGATTTGATGAGAAGAGAAATTCCATGGAGCCA 1325 Qy 1261 GGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1326 GGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTT 1385 Qy 1321 TTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1386 TTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCA 1445 Qy 1381 AATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGTTGA 1434 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1446 AATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGTTGA 1499 Claims 62-64, 71, 72, 75-80, 87-89 and 90 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Campbell et al (US 20190358305). Campbell et al teach sequences that are 97.2% related to SEQ ID NO:26. One would understand that this sequence is optimized for expression in a human corenal cell by linkage with AAV with ITRS i.e. AAV9 as well as a promoter both allowing expression in human eye cells (see e.g. Figure 4 and ¶ 0041 and 0047). RESULT 17 US-16-264-095-1 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 1, US/16264095 Publication No. US20190358305A1 GENERAL INFORMATION APPLICANT: The Provost, Fellows, Scholars, and the other Members APPLICANT: of Board of Trinity College Dublin TITLE OF INVENTION: AAV-BASED GENE THERAPY FOR GLAUCOMA FILE REFERENCE: KELF168296 CURRENT APPLICATION NUMBER: US/16/264,095 CURRENT FILING DATE: 2019-01-31 PRIOR APPLICATION NUMBER: US 62/624460 PRIOR FILING DATE: 2018-01-31 NUMBER OF SEQ ID NOS: 4 SEQ ID NO 1 LENGTH: 1431 TYPE: DNA ORGANISM: Homo sapiens Query Match 97.2%; Score 1394.2; Length 1431; Best Local Similarity 98.4%; Matches 1408; Conservative 0; Mismatches 23; Indels 0; Gaps 0; Qy 1 ATGAAGAGTCTTCCAATCCTACTGTTGCTGTGTGTGGCAGTTTGCTCAGCCTATCCATTG 60 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 1 ATGAAGAGTCTTCCAATCCTACTGTTGCTGTGCGTGGCAGTTTGCTCAGCCTATCCATTG 60 Qy 61 GATGGAGCTGCAAGGGGTGAGGACACCAGCATGAACCTTGTTCAGAAATATCTAGAAAAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GATGGAGCTGCAAGGGGTGAGGACACCAGCATGAACCTTGTTCAGAAATATCTAGAAAAC 120 Qy 121 TACTATGACCTCAAAAAAGATGTGAAACAGTTTGTTAGGAGAAAGGACAGTGGTCCTGTT 180 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TACTACGACCTCAAAAAAGATGTGAAACAGTTTGTTAGGAGAAAGGACAGTGGTCCTGTT 180 Qy 181 GTTAAAAAAATCAGAGAAATGCAGAAGTTCCTTGGATTGGAGGTGACAGGGAAGCTGGAC 240 |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| Db 181 GTTAAAAAAATCCGAGAAATGCAGAAGTTCCTTGGATTGGAGGTGACGGGGAAGCTGGAC 240 Qy 241 TCTGACACTCTGGAGGTGATGAGAAAGCCCAGGTGTGGAGTTCCTGATGTTGGTCACTTC 300 || |||||||||||||||||| | |||||||||||||||||||||||||||||||||||| Db 241 TCCGACACTCTGGAGGTGATGCGCAAGCCCAGGTGTGGAGTTCCTGATGTTGGTCACTTC 300 Qy 301 AGAACCTTTCCTGGCATCCCCAAGTGGAGGAAAACCCACCTTACATACAGGATTGTGAAT 360 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Db 301 AGAACCTTTCCTGGCATCCCGAAGTGGAGGAAAACCCACCTTACATACAGGATTGTGAAT 360 Qy 361 TATACACCAGATTTGCCAAAAGATGCTGTTGATTCTGCTGTTGAGAAAGCTCTGAAAGTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TATACACCAGATTTGCCAAAAGATGCTGTTGATTCTGCTGTTGAGAAAGCTCTGAAAGTC 420 Qy 421 TGGGAAGAGGTGACTCCACTCACATTCTCCAGGCTGTATGAAGGAGAGGCTGATATAATG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TGGGAAGAGGTGACTCCACTCACATTCTCCAGGCTGTATGAAGGAGAGGCTGATATAATG 480 Qy 481 ATCTCTTTTGCAGTTAGAGAACATGGAGACTTTTACCCTTTTGATGGACCTGGAAATGTT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 ATCTCTTTTGCAGTTAGAGAACATGGAGACTTTTACCCTTTTGATGGACCTGGAAATGTT 540 Qy 541 TTGGCCCATGCCTATGCCCCTGGGCCAGGGATTAATGGAGATGCCCACTTTGATGATGAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TTGGCCCATGCCTATGCCCCTGGGCCAGGGATTAATGGAGATGCCCACTTTGATGATGAT 600 Qy 601 GAACAATGGACAAAGGATACAACAGGGACCAATTTATTTCTGGTTGCTGCTCATGAAATT 660 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 601 GAACAATGGACAAAGGATACAACAGGGACCAATTTATTTCTCGTTGCTGCTCATGAAATT 660 Qy 661 GGCCACTCCCTGGGTCTCTTTCACTCAGCCAACACTGAAGCTTTGATGTACCCACTCTAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GGCCACTCCCTGGGTCTCTTTCACTCAGCCAACACTGAAGCTTTGATGTACCCACTCTAT 720 Qy 721 CACTCACTCACAGACCTGACTAGATTCAGACTGTCTCAAGATGATATAAATGGCATTCAG 780 ||||||||||||||||||||| | ||| | |||||||||||||||||||||||||||||| Db 721 CACTCACTCACAGACCTGACTCGGTTCCGCCTGTCTCAAGATGATATAAATGGCATTCAG 780 Qy 781 TCCCTCTATGGACCTCCCCCTGACTCCCCTGAGACCCCCCTGGTACCCACAGAACCTGTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Db 781 TCCCTCTATGGACCTCCCCCTGACTCCCCTGAGACCCCCCTGGTACCCACGGAACCTGTC 840 Qy 841 CCTCCAGAACCTGGGACCCCAGCCAACTGTGATCCTGCTTTGTCCTTTGATGCTGTCAGC 900 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 841 CCTCCAGAACCTGGGACGCCAGCCAACTGTGATCCTGCTTTGTCCTTTGATGCTGTCAGC 900 Qy 901 ACTCTGAGGGGAGAAATCCTGATCTTTAAAGACAGGCACTTTTGGAGAAAATCCCTCAGG 960 ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| Db 901 ACTCTGAGGGGAGAAATCCTGATCTTTAAAGACAGGCACTTTTGGCGCAAATCCCTCAGG 960 Qy 961 AAGCTTGAACCTGAATTGCATTTGATCTCTTCATTTTGGCCATCTCTTCCTTCAGGGGTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 961 AAGCTTGAACCTGAATTGCATTTGATCTCTTCATTTTGGCCATCTCTTCCTTCAGGCGTG 1020 Qy 1021 GATGCTGCATATGAAGTTACTAGCAAGGACCTGGTTTTCATTTTTAAAGGAAATCAATTC 1080 ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 1021 GATGCCGCATATGAAGTTACTAGCAAGGACCTCGTTTTCATTTTTAAAGGAAATCAATTC 1080 Qy 1081 TGGGCTATCAGAGGAAATGAGGTAAGAGCTGGATACCCAAGAGGCATCCACACCCTAGGT 1140 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Db 1081 TGGGCTATCAGAGGAAATGAGGTACGAGCTGGATACCCAAGAGGCATCCACACCCTAGGT 1140 Qy 1141 TTCCCTCCAACAGTGAGGAAAATTGATGCAGCCATTTCTGATAAGGAAAAGAACAAAACA 1200 ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| Db 1141 TTCCCTCCAACCGTGAGGAAAATCGATGCAGCCATTTCTGATAAGGAAAAGAACAAAACA 1200 Qy 1201 TATTTCTTTGTAGAGGACAAATACTGGAGATTTGATGAGAAGAGAAATTCCATGGAGCCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TATTTCTTTGTAGAGGACAAATACTGGAGATTTGATGAGAAGAGAAATTCCATGGAGCCA 1260 Qy 1261 GGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTT 1320 Qy 1321 TTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 TTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCA 1380 Qy 1381 AATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGT 1431 ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 AATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGT 1431 Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARIA MARVICH whose telephone number is (571)272-0774. The examiner can normally be reached 8 am - 5 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria Leavitt can be reached at 571-272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MARIA MARVICH/Primary Examiner, Art Unit 1634
Read full office action

Prosecution Timeline

Mar 30, 2022
Application Filed
Oct 30, 2025
Non-Final Rejection — §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600986
NUCLEIC ACID MOLECULES CONTAINING SPACERS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 14, 2026
Patent 12590321
METHODS AND COMPOSITIONS FOR GENETICALLY MODIFYING AND EXPANDING LYMPHOCYTES AND REGULATING THE ACTIVITY THEREOF
2y 5m to grant Granted Mar 31, 2026
Patent 12589151
T Cell Modification
2y 5m to grant Granted Mar 31, 2026
Patent 12589128
ONCOLYTIC ADENOVIRUS COMPOSITIONS
2y 5m to grant Granted Mar 31, 2026
Patent 12571002
GENE THERAPIES FOR LYSOSOMAL DISORDERS
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
55%
Grant Probability
82%
With Interview (+26.9%)
4y 2m
Median Time to Grant
Low
PTA Risk
Based on 967 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month