Prosecution Insights
Last updated: October 04, 2026
Application No. 17/765,583

METHODS FOR TARGETED CELL DEPLETION

Final Rejection §102§103§112
Filed
Mar 31, 2022
Priority
Oct 04, 2019 — provisional 62/910,558 +1 more
Examiner
RYAN, DOUGLAS CHARLES
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The J David Gladstone Institutes A Testamentary Trust Established Under The Will Of J David
OA Round
2 (Final)
39%
Grant Probability
At Risk
3-4
OA Rounds
0m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants only 39% of cases
39%
Career Allowance Rate
29 granted / 74 resolved
-20.8% vs TC avg
Strong +48% interview lift
Without
With
+47.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
48 currently pending
Career history
123
Total Applications
across all art units

Statute-Specific Performance

§101
7.6%
-32.4% vs TC avg
§103
32.5%
-7.5% vs TC avg
§102
13.9%
-26.1% vs TC avg
§112
31.6%
-8.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 74 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received on 2/28/2026. Claims 1-9 and 11-38 are pending. Claims 1, 8, 9, 12, 14, and 38 have been amended. Claims 10 has been cancelled. Claims 24-36 have been withdrawn Claims 1-9, 11-23, and 37-38 are currently under examination. Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. This Office Action is Final. 101 – Withdrawn The Applicant has amended independent claim 1 to include subject matter which was not rejected previously under 101 from dependent claim 8. The subject matter of claim 1 is subject matter eligible, and the original 101 rejection is withdrawn. Claim Objections Claim 5 is objected to because of the following informalities: Claim 5 recites “SEG ID NO” which should be amended to read “SEQ ID NO.” Appropriate correction is required. Claim Rejections - 35 USC § 112 – New Rejections Necessitated by Amendment The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 8-9, 11-23, and 38 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 8, claim 8 recites “a carrier, where the carrier activates the Cas protein within.” This claim language is confusing because it is unclear what is meant by “within,” (i.e., within what?), or specifically how the carrier is activating the Cas “within.” Claim 8 should be amended to clarify within what the carrier is activating the Cas protein. Regarding claim 9, claim 9 recites “a guide RNA that binds specifically to a repetitive DNA sequence in a human cell,” (step a) but also recites “the undesired cell type is a human cell, an animal cell, a plant cell, or a fungal cell,” (final line of the claim). Claim 9 is unclear because claim 9 initially establishes that the guide RNA is binding to a sequence specifically in a human cell. It is therefore unclear how such a system would also be applied to broader categories of cells such as animal, plant, or fungal cells that are later recited in the claim. It is furthermore unclear what the recited instructions would comprise as presently recited because the kit is recited to comprise human-specific targeting Cas and gRNAs, where the targeting agent directs the human-specific Cas/gRNA to a specific cell type. It is unclear how such a system would function with other, non-human cells such as those recited in the claims, or what the contents of such instructions for delivering the Cas/gRNA may be with respect to these non-human cell types. Claims 11-23 depend from claim 9 and do not resolve this 112(b) issue and are therefore also rejected. Regarding claim 38, claim 38 recites “is suitable for treating a cell proliferative disease or disorder.” This claim language is unclear, as it is unclear how the recitation of “suitable for treating a cell proliferative disease or disorder” is meant to limit the composition of claim 38. The structural significance imparted on the composition claimed in claim 38 by the phrase “suitable for” is unclear. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 23 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 23 depends from claim 9, Claim 23 recites that the undesired cell type is human, animal, or a fungal cell. However, claim 9 already recites these limitations. Claim 23 therefore does not further limit the claim from which it depends (claim 9). Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112 – New Rejection Necessitated by Amendment The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 38 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a New Matter rejection. Regarding claim 38, claim 38 is presently amended to recite “the composition comprises a pharmaceutically acceptable carrier and is suitable for treating a cell proliferative disease or disorder.” This amendment constitutes new matter because the phrase “suitable for treating” is not recited in the specification, where the phrase “suitable for treating” is not defined nor is a structure-function relationship established for the recited composition that would define the components of the composition to be “suitable for treating” a disease. Thus, the Applicant has introduced new matter by the present claim amendments. Claim Rejections - 35 USC § 102 – Maintained/Updated in Response to Amendments In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-9, 11-23 and 37 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Oakes (Oakes BL et al. Cell. 2019 Jan 10;176(1-2):254-267.e16). The rejection of claims 5 and 18 are further evidenced by WP_129284051 (NCBI BLAST Accession Number WP_129284051, published 2/7/2019). Regarding claim 1, Oakes teaches a composition comprising at least one Cas protein and at least one guide RNA, where the sgRNA binds to a repetitive DNA sequence in a cell (e.g., see page 9, final paragraph to page 10, first paragraph, and Figure 5A). Regarding targeting agents which deliver components to a specific cell type, the specification recites that viral vectors/viral particles are examples of such targeting agents (see final paragraph of page 32 of specification). Oakes teaches that viral vectors were used to deliver their compositions to cells, where HEK293T cells were target cell populations (page 16, final two paragraphs). Thus, Oakes teaches that the targeting agent (viral particles/vectors) were targeted to a specific cell type (page 16, final paragraph, Figure 4 caption). Furthermore, given that both the instant specification and claim set recite that target cells encompass a large genus of cells types including human, animal, and fungal cells (e.g., instant claim 9, page 83 final paragraph of instant specification), the fact that the lentiviral vectors taught by Oakes are directed to human cells and not fungal cells qualifies as a “specific cell type,” within the broadest reasonable interpretation of the claim, as such vectors would not target fungal cells, but would at the very least be specific for mammalian cells (Figure 4 and caption). Furthermore, Oakes teaches that the compositions can be delivered to a target tissue or organ, which would encompass specific cell types to a given tissue or organ. Regarding claim 2, Oakes teaches the Cas protein is an active or deactivated nuclease, wherein the deactivated Cas nuclease is deactivated in the composition but activated in the cell (e.g., page 9, second paragraph). Regarding claim 3, Oakes teaches the Cas protein is a circularly permuted Cas9 protein that is inactive until cleaved by a protease that specifically recognizes and cleaves a cleavage site in the circularly permuted Cas9 protein (page 3 final paragraph to page 4, first paragraph). Regarding claim 4, Oakes teaches the Cas protein is a circularly permuted Cas protein, and where the circular permutation is in a helical domain, in a RuvC-III domain, or in a C- terminal domain (CTD) (page 3, final paragraph). Regarding claim 5, as evidenced by WP_129284051, SEQ ID NO: 38 is a protein with 98% identity to S. pyogenes Cas9 enzyme (see page 1 of WP_129284051 for alignment). Oakes teaches that they used S. pyogenes Cas9 (e.g., page 4, second paragraph). Oakes therefore inherently teaches a sequence with at least 90% sequence identity to SEQ ID NO: 38. Regarding claim 6, Oakes teaches the Cas protein's activity or expression is inducible (page 14, final paragraph). Regarding claim 7, Oakes teaches that sgRNA were introduced and expressed on a plasmid (page 13, third paragraph). Oakes therefore teaches a plasmid expressing the sgRNA, the expression of which is induced via a promoter (i.e., the gRNA’s expression must be inducible by elements within the cell which drive expression of the promoter controlling sgRNA expression). Regarding claim 8, the specification does not clearly define “carrier,” and uses the term multiple times in different contexts. For instance, the term “carrier” is used to describe “lipid carriers” for delivery of the composition (page 33 first paragraph) or as pharmaceutical carriers suitable for delivery such as aqueous solutions that are known in the art, or as diluents for the vectors and/or cells (page 38, final paragraph). Oakes teaches various experiments using their vectors and cells, which were reasonably performed in aqueous solution/diluents, and therefore teaches the broadest reasonable interpretation of claim 8 in light of how the term carrier is used (e.g., Figure 4, and throughout article/methods). Furthermore, as discussed in the 112(b) rejection above, the scope of claim 8 is undefined and unclear, as it is unclear what is meant by the carrier activating the Cas “within.” As such, the claim is being interpreted to mean simply that the composition comprises a carrier. Regarding claim 9, Oakes teaches a composition comprising at least one Cas protein and at least one guide RNA, where the sgRNA binds to a repetitive DNA sequence in the human genome (i.e., a human cell, e.g., see page 9, final paragraph to page 10, first paragraph, and Figure 5A). Furthermore, Oakes teaches targeting agents which target the components to a specific cell type (see rejection of claim 1, which addresses these limitations). Regarding the limitation of “kit,” this does not add structural limitation to the claim; therefore, by teaching the components of claim 9, the teachings of Oakes encompass the limitation “kit.” Furthermore, Oakes teaches using the system to deplete an undesired cell type (e.g., a viral-infected cell, page 9, third paragraph). Oaks also teaches methods of using the system components (e.g., page 16, paragraphs 1-2). By teaching methods of use of the composition, the manuscript Oakes is itself instructions of use for targeting a population of undesired cells using the reagents recited in the claim. Furthermore, Oakes teaches and reduces to practice depletion of cell types, which reasonably encompasses “undesired” cell types, a such a term is subjective (page 16, second paragraph). Furthermore, an “undesired” cell can broadly be interpreted to be any cell, where Oakes teaches human cells such as HEK cells (Figure 5). Regarding the claim limitations in step “b,” these limitations are recited as optional, and are therefore not required in the claim limitations. Regarding claim 11, Oakes teaches in vitro cell culture (page 9, final paragraph, “HEK293T…stably transduced”). Regarding claim 12, as an initial matter, claim 12 does not require specific reagent components aside from the elements of step a of the claim. The “population of cell” which are in vivo does not add structural elements to the claim because the population is recited with respect to instructions of use (see claim 9, final four lines). Oakes provides a teaching (i.e., an instruction) that the components they teach can be used in vivo, to target a specific tissue or organ, which reasonably includes cells specific to the tissue or organ. Oakes therefore teaches instructions regarding the administration of their composition in vivo. Regarding claim 13, Oakes teaches “sgCIDE-1,” a sgRNA with 100% match to SEQ ID NO: 1 as shown below (page 16, second paragraph): TGTAATCCCAGCACTTTGGG (sgCIDE-1, Oakes) TGTAATCCCAGCACTTTGGG (SEQ ID NO: 1) Regarding claim 14, the specification recites that the term “heterologous” can simply mean a nucleic acid that is transformed into the cell (page 34, third paragraph). Thus, the plasmids taught by Oakes which are introduced into the cell and express “heterologous” guide RNA appear to read on the claim language (e.g., page 14, third paragraph). Furthermore, the Cas9/gRNA comprise guide RNA which target PAM as an inherent property of the gRNA. Regarding claim 15, Oakes teaches active and deactivated Cas nucleases (page 9, second paragraph). Regarding clam 16, Oakes teaches the Cas protein is an active or deactivated nuclease, wherein the deactivated Cas nuclease is deactivated in the composition but activated in the cell (e.g., page 9, second paragraph). Regarding claim 17, Oakes teaches the Cas protein is a circularly permuted Cas9 protein that is inactive until cleaved by a protease that specifically recognizes and cleaves a cleavage site in the circularly permuted Cas9 protein (Abstract, and throughout, “ProCas9”). Regarding claim 18, as evidenced by WP_129284051, SEQ ID NO: 38 is a protein with 98% identity to S. pyogenes Cas9 enzyme (see page 1 of WP_129284051 for alignment). Oakes teaches that they used S. pyogenes Cas9 (e.g., page 4, second paragraph). Oakes therefore inherently teaches a sequence with at least 90% sequence identity to SEQ ID NO: 38. Regarding claim 19, Oakes teaches the Cas protein's activity or expression is inducible (page 14, final paragraph). Regarding claim 20, Oakes teaches that sgRNA were introduced and expressed on a plasmid (page 13, third paragraph). Oakes therefore teaches a plasmid expressing the sgRNA, the expression of which is induced via a promoter (i.e., the gRNA’s expression must be inducible by elements within the cell which drive expression of the promoter controlling gRNA expression). Regarding claim 21, Oakes teaches the Cas protein's activity or expression is inducible (i.e., at least one expression cassette controlling an inducible Cas nuclease, page 14, final paragraph). Regarding claim 22, Oakes teaches a carrier or targeting agent which activates the Cas protein within a specific cell type (activating proteases in HEK cells, page 9, second paragraph). Regarding claim 23, Oakes teaches depletion of virally-infected cells, where such cells are reasonably interpreted to be undesired in a human cell and teaches human cells HEK293T cells (page 9 final two paragraphs into page 10). Furthermore, Oakes teaches cell depletion by targeting human cells, where such cells can broadly be interpreted as “undesired,” as such a term is subjective (page 16, second paragraph). Regarding claim 37, as discussed above, Oakes teaches a composition comprising at least one Cas protein and at least one guide RNA, where the sgRNA binds to a repetitive DNA sequence in a cell (e.g., see page 9, final paragraph to page 10, first paragraph, and Figure 5A). Recitation of the limitation that the composition is formulated as a medicament does not add structural limitation to the composition. Furthermore, as no strict definition of “medicament” is offered in the specification, the term can reasonably be interpreted to mean simply a pharmaceutically acceptable carrier such as water as discussed on page 39, second paragraph of the specification. Oakes teaches that cells comprising the composition were placed in water (page 14, third paragraph). Claims 1-2, 6-9, 11-12, 14-16, 19-20, 22-23, and 37-38 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ikeda (US 2019/0270980 A1, published 9/5/2019). Regarding claim 1, Ikeda is a patent document which teaches the treatment of cancer using CRISPR/Cas (Abstract). Ikeda teaches cleavage of cancer cell DNA to cause cell death using CRISPR/Cas9 systems comprising a Cas nuclease and guide RNA, where the guide RNA targets a repetitive DNA sequence in the cell (paragraphs 4-7). Furthermore, Ikeda teaches that the reagents are delivered to a specific cell type using a targeting agent: “Any appropriate method can be used to deliver a CRISPR/Cas9 system described herein or nucleic acid encoding a CRISPR/Cas9 system described herein to cancer cells… viral vectors that can be used to deliver nucleic acid encoding a CRISPR/Cas9 system described herein to cancer cells within a mammal include, without limitation, AAV vectors,” (paragraph 32). Per the instant specification, viral vectors such as those taught by Ikeda are targeting agents (see final paragraph of page 32). Thus, Ikeda teaches that the composition comprises a targeting agent (viral vector) that delivers the components to a specific cell type (i.e., a cancer cell). Regarding claim 2, claim 2 recites that the Cas nuclease is activated or deactivated; thus, the state is recited in the alternative. Ikeda teaches activated (i.e., enzymatically activated) Cas nucleases (paragraph 4, “Cas9 system can be designed to cleave”). Furthermore, a Cas nuclease is “active” by acting as a nuclease, and would therefore be activated in a cell taught by Ikeda because it would act as a nuclease to cleave target DNA in the cell, but not active when there is no DNA to target (i.e., when it is outside of the cell). Regarding claims 6-7, the Cas enzymes and guide RNA activities of Ikeda are broadly interpreted to be inducible, as such Cas enzymes and guide RNA binding activities are induced upon recognition of a target sequence (e.g., paragraph 4). Regarding claim 8, the specification does not clearly define “carrier,” and uses the term multiple times in different contexts. For instance, the term “carrier” is used to describe “lipid carriers” for delivery of the composition (page 33 first paragraph) or as pharmaceutical carriers suitable for delivery such as aqueous solutions that are known in the art (page 38, final paragraph). Ikeda teaches that their compositions are used for in vivo delivery as a cancer therapeutic; a practitioner could therefore immediately envision that the composition comprises a “carrier” as described by the instant specification, where the broadest reasonable interpretation of a “carrier” per the specification includes art-recognized aqueous solutions to deliver vectors (specification page 38 final paragraph, Example 3 of Ikeda, paragraph 45). Furthermore, as discussed in the 112(b) rejection above, the scope of claim 8 is undefined and unclear, as it is unclear what is meant by the carrier activating the Cas “within.” As such, the claim is being interpreted to mean simply that the composition comprises a carrier. Regarding claim 9, Ikeda teaches cleavage of cancer cell DNA to cause cell death using CRISPR/Cas9 systems (depletion of undesired cell population) comprising a Cas nuclease and guide RNA, where the guide RNA targets a repetitive DNA sequence in the cell (paragraphs 4-7). Furthermore, Ikeda is a document itself and its methods are “instructions.” Furthermore, Ikeda teaches that the reagents are delivered to a specific cell type using a targeting agent: “Any appropriate method can be used to deliver a CRISPR/Cas9 system described herein or nucleic acid encoding a CRISPR/Cas9 system described herein to cancer cells… viral vectors that can be used to deliver nucleic acid encoding a CRISPR/Cas9 system described herein to cancer cells within a mammal include, without limitation, AAV vectors,” (paragraph 32). Per the instant specification, viral vectors such as those taught by Ikeda are targeting agents (see final paragraph of page 32). Thus, Ikeda teaches that the composition comprises a targeting agent (viral vector) that delivers the components to a specific cell type (i.e., a cancer cell). Regarding the claim limitations in step “b,” these limitations are recited as optional, and are therefore not required in the claim limitations. Regarding claims 11-12, Ikeda teaches in vivo HeLa cells and mouse models (Figure 9, Example 4). Ikeda further teaches in vitro cell culture (Example 2). Regarding claim 14, the specification recites that the term “heterologous” can simply mean a nucleic acid that is transformed into the cell (page 34, third paragraph). Thus, the guide RNAs, and the nucleic acids which encode them, are “heterologous” to the cells in the methods of Ikeda (e.g., Example 2 and 4). Furthermore, Ikeda teaches that they used Cas9/gRNA systems, where such gRNAs are designed and inherently require the presence of a specific PAM site (e.g., paragraph 40). Regarding claims 15-16, Ikeda teaches active Cas enzymes, as evidenced by their enzymatic activity (e.g. Figure 9). Furthermore, such Cas enzymes are active in a cell (Figure 9). Regarding claims 19-20, the Cas enzymes and guide RNA activities of Ikeda are broadly interpreted to be inducible, as such Cas enzymes and guide RNA binding activities are induced upon recognition of a target sequence (e.g., paragraph 4). Regarding claim 22, Ikeda teaches NLS sequences to be used with their Cas nucleases (paragraph 40). The specification states that NLS can be targeting agents (page 31, final paragraph). Regarding claim 23, Ikeda teaches that the undesired cell type can be cancer cells in mammals (Example 4). Regarding claim 37, the term medicament is not specifically defined in the specification. The term can reasonably be interpreted as any acceptable composition for administration for medical treatment, such as the formulations taught by Ikeda (Example 4). Regarding claim 38, Ikeda teaches treatment of proliferative diseases such as cancer, where such treatment would reasonably include a pharmaceutically acceptable carrier for the in vivo administration methods they teach (Abstract, throughout, Example 4, Figure 9). Claims 1 and 5-6 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Young (US 2017/0081650 A1, published 3/23/2017). Regarding claim 1, Young teaches a composition comprising at least one Cas protein and at least one guide RNA that binds specifically to a repetitive DNA sequence in a cell (paragraph 37 and paragraph 123). Regarding targeting agents which deliver components to a specific cell type, the specification recites that viral vectors/viral particles are examples of such targeting agents (see final paragraph of page 32 of specification). Young teaches that the components of their system can be delivered with such a targeting agent as a viral vector (paragraph 98). Furthermore, Young teaches that such vectors deliver the components to an individual “host cell,” i.e., a specific cell type (paragraph 98). Regarding claim 5, Young teaches SEQ ID NO: 1, which is a 100% match of instant SEQ ID: NO 38. Regarding claim 6, Young teaches the Cas protein’s activity or expression are inducible (paragraph 90). Response to Arguments The Applicant’s arguments filed 2/28/2026 have been considered but are not persuasive. The Applicant argues that Ikeda/Oakes/Young do not teach the limitations of claims 1 and 9. This argument is not persuasive because Ikeda/Oakes/Young do teach the claim limitations presently recited and therefore anticipate the claims (see 102 rejections, above). Note that the previous claims filed 8/28/2025 did not require the claim limitations now recited in claim 1, as the claim limitations “targeting agent that delivers the Cas protein and guide RNA to a specific cell type” was previously recited in the alternative in claim 8 as filed 8/28/2025. Thus, the original and present 102 rejections are valid, where the 102 rejection is maintained/updated to address the limitations which are now required in claim 1. Claim Rejections - 35 USC § 103 – Maintained/Updated in Response to Amendment In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 38 is rejected under 35 U.S.C. 103 as being unpatentable over Oakes (Oakes BL et al. Cell. 2019 Jan 10;176(1-2):254-267.e16) as applied in the 102 rejection of claims 1-23 and 37 above, in view of Ikeda (US 2019/0270980 A1, published 9/5/2019). Regarding claim 38, Oakes teaches a composition comprising at least one Cas protein and at least one guide RNA, where the sgRNA binds to a repetitive DNA sequence in a cell (e.g., see page 9, final paragraph to page 10, first paragraph, and Figure 5A). Furthermore, Oakes teaches that their methods and systems are readily amenable to other applications, and furthermore teaches targeted cellular depletion (Discussion, first and second paragraph, and page 9, final two paragraphs, page 16, second paragraph). Oakes does not specifically teach treatment of a cell proliferative disorder. Ikeda is a patent document which teaches the treatment of cancer using CRISPR/Cas (Abstract). Ikeda teaches cleavage of cancer cell DNA to cause cell death using CRISPR/Cas9 systems comprising a Cas nuclease and guide RNA, where the guide RNA targets a repetitive DNA sequence in the cell (paragraphs 4-7). Ikeda and Oakes therefore directly overlap because they both teach the same elements of claim 1, namely, Cas nucleases and guide RNA which target repetitive DNA sequences in a cell. Furthermore, Ikeda teaches that such systems are useful for treating cancer and have been reduced to practice in such experiments (e.g., Figure 9). It would have been obvious to a person of ordinary skill in the art before the effective filing date of the invention to combine the Cas nuclease gRNA targeted to repetitive sequences of Oakes with those of Ikeda, and to target treatment of a proliferative disease such as cancer because the combination is the simple combination of known prior art elements to yield predictable results. Furthermore, a practitioner would be motivated to combine the references, as Ikeda teaches and reduces to practice such motivational teachings as positive outcomes of tumor reduction using systems such as those taught by Ikeda. Claims 3-5, 13, 17-18, and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Ikeda (US 2019/0270980 A1, published 9/5/2019), as applied in the 102 rejection of claims 1-2, 8-12, 14-16, 19-20, 22-23, and 37-38, above, in view of Oakes (Oakes BL et al. Cell. 2019 Jan 10;176(1-2):254-267.e16). The rejections of claims 5 and 18 are further evidenced by WP_129284051 (NCBI BLAST Accession Number WP_129284051, published 2/7/2019). A discussion of the teachings of Ikeda with respect to claims 1-2, 8-12, 14-16, 19-20, 22-23, and 37-38 is detailed in the 102 rejection, above. Briefly, Ikeda teaches Cas nuclease/gRNA compositions, where the gRNA specifically binds with repetitive DNA sequences, where such methods are useful for treatment of tumors and cell depletion (for instance paragraphs 4-7, Examples 2-4, Figure 9). Regarding claims 3-5 and 17-18, Ikeda does not teach an embodiment of a circularly permuted Cas9 with SEQ ID NO: 38, where the circular permutation is in a helical domain. Regarding claim 13, Ikeda does not teach the guide RNA with SEQ ID NO: 1. Regarding claim 21, Ikeda does not teach inducible promoters. In general, the teachings of Oakes overlap with those of Ikeda because Oakes also teaches Cas nuclease/gRNA compositions, where the gRNA specifically binds with repetitive DNA sequences, where such compositions can be used for cell depletion (see 102 rejection of claims 1-23 and 37, incorporated herein). Furthermore, Oakes teaches a useful embodiment of a Cas9 enzyme, where such circularly permutated Cas9 enzymes are taught to be a valuable addition to the Cas enzyme toolkit, where such enzymes are safer, more efficient, and advanced, and are widely applicable across gene editing areas of interest, including medicine (Abstract). Furthermore, such enzymes have been reduced to practice (e.g., Figure 3). Regarding claim 3, Oakes teaches the Cas protein is a circularly permuted Cas9 protein that is inactive until cleaved by a protease that specifically recognizes and cleaves a cleavage site in the circularly permuted Cas9 protein (page 3 final paragraph to page 4, first paragraph). Regarding claim 4, Oakes teaches the Cas protein is a circularly permuted Cas protein, and where the circular permutation is in a helical domain, in a RuvC-III domain, or in a C- terminal domain (CTD) (page 3, final paragraph). Regarding claim 5, as evidenced by WP_129284051, SEQ ID NO: 38 is a protein with 98% identity to S. pyogenes Cas9 enzyme (see page 1 of WP_129284051 for alignment). Oakes teaches that they used S. pyogenes Cas9 (e.g., page 4, second paragraph). Oakes therefore inherently teaches a sequence with at least 90% sequence identity to SEQ ID NO: 38. Regarding claim 13, Oakes teaches “sgCIDE-1,” a sgRNA with 100% match to SEQ ID NO: 1 as shown below (page 16, second paragraph): TGTAATCCCAGCACTTTGGG (sgCIDE-1, Oakes) TGTAATCCCAGCACTTTGGG (SEQ ID NO: 1) Regarding claim 17, Oakes teaches the Cas protein is a circularly permuted Cas9 protein that is inactive until cleaved by a protease that specifically recognizes and cleaves a cleavage site in the circularly permuted Cas9 protein (Abstract, and throughout, “ProCas9”). Regarding claim 18, as evidenced by WP_129284051, SEQ ID NO: 38 is a protein with 98% identity to S. pyogenes Cas9 enzyme (see page 1 of WP_129284051 for alignment). Oakes teaches that they used S. pyogenes Cas9 (e.g., page 4, second paragraph). Oakes therefore inherently teaches a sequence with at least 90% sequence identity to SEQ ID NO: 38. Regarding claim 21, Oakes teaches the Cas protein's activity or expression is inducible (i.e., at least one expression cassette controlling an inducible Cas nuclease, page 14, final paragraph). It would have been obvious to a person of ordinary skill in the art before the time the invention was filed to modify the Cas enzymes taught by Ikeda to use the circularly permuted Cas enzymes of Oakes because such a combination is the simple combination of known prior art elements with predictable success. Furthermore, a practitioner would be motivated to do so because Oakes teaches advantages to using their Cas enzymes such as safety, efficacy, and broad applicability to biomedicine. The results are predictable because the methods of both Ikeda and Oakes are similar and have been reduced to practice. Furthermore, the remaining claim elements of Ikeda/Oakes, namely, the use of elements such as inducible promoters are widely known in the art simply as methods to express a desired gene. Additionally, the guide RNA of SEQ ID NO: 1 is a known and effective guide RNA which can deplete cells as taught by Oakes; thus, it is obvious to use in a method such as Ikeda who targeted cancer cells for destruction. Response to Arguments The Applicant’s arguments filed 2/28/2026 have been considered but are not persuasive. The Applicant argues that the office provides no teaching in Oakes to suggest swapping Oakes’ constructs into the therapeutic setting of Ikeda. This argument is not persuasive because the office has supplied a motivational teaching in the 103 rejection. As originally stated and maintained here, Oakes teaches that their methods and systems are readily amenable to other applications, and furthermore teaches targeted cellular depletion (Discussion, first and second paragraph, and page 9, final two paragraphs, page 16, second paragraph). Oakes teaches “the system may be used to sense and report cell-intrinsic pathway activity e.g. for molecular screening and drug discovery, or serve as a means for cell-type-specific Cas activation after general delivery of an editing complex to a target tissue or organ,” (Discussion, first paragraph). and “this clearly demonstrates that ProCas9 can be stably integrated into mammalian genomes to sense, record and respond to endogenous or exogenous protease activity,” (page 9, first paragraph) and “circular permutation enabled protease-sensing Cas9s (ProCas9s), a unique class of single molecule effectors possessing programmable inputs and outputs. ProCas9s can sense a wide range of proteases, and we demonstrate that ProCas9 can orchestrate a cellular response to pathogen-associated protease activity. Together, these results provide a toolkit of safer and more efficient genome modifying enzymes and molecular recorders for the advancement of precision genome engineering in research, agriculture, and biomedicine,” (Abstract). As such, Oakes teaches that they have demonstrated that their system works in mammalian cells, teaches and suggest that it can be used in in vivo applications (cell-type specific activation in specific organs or tissues), and is modular, and is also safer and more efficient for precise genome engineering and biomedicine (Discussion, first paragraph, Abstract, and page 9, first paragraph). Given that the systems of Oakes have been reduced to practice and are taught to be both modular and safe, there are highly motivational teachings in Oakes to apply the technology to other applications, as Oakes directly states and identifies other applications including in vivo tissue targeting and biomedicine (above). As such, and as discussed in the present and previous 103 rejections, Oakes teaches predictability (i.e., they teach that their technology is modular to fit any endogenous protease and amenable to other biomedical applications) and should be used in in vivo methods. Furthermore, in the case of the rejection of claim 38 of Oakes in view of Ikeda, it is Ikeda which is modifying Oakes and not Oakes modifying Ikeda, where Oakes is being modified to be used in in vivo treatments such as the treatment of cancer. In this case, the combination is predictable because both Oakes and Ikeda teach similar Cas systems, where Oakes has furthermore taught that their system is modular and amenable to various applications, where Oakes further already taught and suggested in vivo, tissue/organ specific applications of their technology. The combination is therefore predictable, as the reagents of Oakes and Ikeda are similar (i.e., viral delivery vectors, Cas enzyems, guide RNAs). With respect to the argument that the reagents of Oakes and Ikeda are unique, this argument is not persuasive because with respect to specific guide RNA designs, there is a high degree of knowledge and skill in the art, where guide RNAs suitable for the purposes of Ikeda can be designed for the enzymes of Oakes. Furthermore, the argument is an argument of counsel which can not take place of evidence of the record. Absent evidence to the contrary, there is reasonable predictability when combining the teachings of Oakes and Ikeda. Furthermore, regarding the argument that there is no motivation to combine the teachings of Ikeda with Oakes, this argument is not persuasive because Ikeda teaches and reduces to practice such motivational teachings as the positive outcome of tumor reduction using their systems and methods. The treatment of cancer is a motivational teaching to apply to Oakes, who has in fact also already taught and suggested in vivo tissue and organ targeting using their safe and highly efficient compositions. The fact that Oakes does not explicitly teach cancer treatment and only suggests in vivo tissue/organ targeting is irrelevant because it is a piecemeal analysis of the rejection. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In the present case, Ikeda teaches a motivation to apply their teachings to Oakes for the motivational outcome of treating cancer, a known malignancy. Regarding the combination of Ikeda in view of Oakes, the Applicant argues that Ikeda does not teach gated Cas proteins, and the substitution of Oakes’ design into Ikeda requires an endogenous protease to activate the Cas which changes the basic operating principle of Ikeda. This argument is not persuasive, as Oakes teaches that “this clearly demonstrates that ProCas9 can be stably integrated into mammalian genomes to sense, record and respond to endogenous or exogenous protease activity,” (page 9, first paragraph) and therefore teaches that endogenous proteases are part of the design of Oakes, where this teaching speaks to a reasonable predictability concerning the combination. Given that Oakes also teaches the simple modularity of their system, the results are predictable (see 103 rejeciton, above). Furthermore, Oakes has reduced their methods and compositions to practice, which teaches predictability in their approach. Furthermore, as stated in the original 103 rejection and reiterated here, Oakes teaches that their gated Cas enzymes are a useful embodiment of a Cas9 enzyme, where such circularly permutated Cas9 enzymes are taught to be a valuable addition to the Cas enzyme toolkit, where such enzymes are safer, more efficient, and advanced, and are widely applicable across gene editing areas of interest, including medicine (Abstract). Contrary to the Applicant’s assertion that the office has provided no motivational teaching to combine the teachings of Oakes with Ikeda, a practitioner would be highly motivated to incorporate the teachings of Oakes into Ikeda, to thereby change/improve the operating principle of Ikeda, because Oakes teaches superior qualities of their Cas gated designs (i.e., better efficiency and safety, above, and see present and original 103 rejections). Furthermore, regarding claim 13, the fact that Oakes has taught functional, useful guide RNAs is as sufficient motivational teaching to use them in methods such as those taught by Oakes and Ikeda, as these are known guides which have been reduced to practice and therefore predictable. The KSR rationale is therefore satisfied with regards to claim 13. Regarding claim 21, Oakes teaches both the principles of inducible and constitutive promoters to express Cas proteins in context dependent ways. As such, a practitioner of ordinary skill in the art could at once envision using either a constitutive or inducible promoter, simply as a matter of design choice for a desired engineering outcome. Claim 21 is therefore obvious in view of the teachings of Oakes. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /D.C.R./Examiner, Art Unit 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Mar 31, 2022
Application Filed
Dec 01, 2025
Non-Final Rejection mailed — §102, §103, §112
Feb 27, 2026
Response Filed
Jun 18, 2026
Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12630847
Novel CRISPR-Cas sigma enzyme and system
1y 4m to grant Granted May 19, 2026
Patent 12577576
SYSTEMS AND METHODS FOR PLANT GENOME EDITING USING CAS 12a ORTHOLOGS
5y 4m to grant Granted Mar 17, 2026
Patent 12480140
DIFFERENTIAL KNOCKOUT OF AN ALLELE OF A HETEROZYGOUS ELANE GENE
5y 0m to grant Granted Nov 25, 2025
Patent 12473539
RNA-GUIDED NUCLEASES AND ACTIVE FRAGMENTS AND VARIANTS THEREOF AND METHODS OF USE
1y 3m to grant Granted Nov 18, 2025
Patent 12448422
TRANSCRIPTION FACTOR NCGL0581 MUTANT AND USE THEREOF IN L-SERINE DETECTION
11m to grant Granted Oct 21, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
39%
Grant Probability
87%
With Interview (+47.6%)
3y 2m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 74 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month