DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The amended claims dated 7/30/2025 are under consideration.
The amendments and arguments presented in the papers filed 7/30/2025 ("Remarks”) have been thoroughly considered. The issues raised in the Office action dated 4/10/2025 listed below have been reconsidered as indicated.
a) The replacement sheets adding SEQ ID NOs to Fig. 7 are acknowledged.
b) The rejections of claims 10-11, 24-25 and 31 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, are rendered moot by the cancellation of claims 10-11 and 24-25 and for claim 31 are withdrawn in view of the amendments to the claim.
c) The rejections of claims 10, 11, 24 and 25 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, are rendered moot by the cancellation of the claims.
d) The rejections of: claim(s) 1-4, 6-14 and 29-31 under 35 U.S.C. 103 as being unpatentable over Mitra (US 2015/0197788 A1), Brown (US 2018/0237950 A1) and Eltoukhy (US 2017/0260590 A1); claim(s) 5 under 35 U.S.C. 103 as being unpatentable over Mitra (US 2015/0197788 A1), Brown (US 2018/0237950 A1) and Eltoukhy (US 2017/0260590 A1) as applied to claim 1, and in further view of Vaisvila (WO 2017/075436 A1); and claim(s) 15-28 under 35 U.S.C. 103 as being unpatentable over Mitra (US 2015/0197788 A1), Brown (US 2018/0237950 A1), Eltoukhy (US 2017/0260590 A1) and Song (US 2020/0370114 A1), are withdrawn in view of the amendments raising the threshold for designating a target polynucleotide as methylated.
The Examiner’s responses to the Remarks regarding issues not listed above are detailed below in this Office action.
New and modified grounds of rejection necessitated by amendment are detailed below and this action is made FINAL.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or cited on a submitted IDS, they have not been considered.
Drawings
The drawings dated 7/30/2025 are objected to because a copy of colored figures were filed. It is unclear if applicant intends the application to include figures in color.
If applicant does not intend the application to include colored figures, it is suggested a black and white or grayscale copy of the figures be filed.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
If applicant does intend the application to include colored figures, the following information is provided.
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
Specification
The disclosure is objected to because of the following informalities: page 36 provides for sequences and SEQ ID NOs disclosed in the specification. SEQ ID NO: 11 on page 36 is “CGUCGQACGTCGGTG”, while in the 8/8/2025 Sequence Listing SEQ ID NO: 11 is “cgttgatgtt ggcg”. SEQ ID NO: 14 on page 36 is “CGAGGCGTTCGCCGCGTGCG”, while in the 8/8/2025 Sequence Listing SEQ ID NO: 14 is “cgcacgcggc gaacgcctcg”.
It is also noted the sequences on page 36 T and U residues are distinguished, while in the sequence listing, only T residues are provided for. For example, in the Sequence Listing dated 4/4/2022 SEQ ID NO: 10 that included U residues (which is identical to that on page 36), but not in the one filed on 8/8/2025, which is “cgttgatgtt ggtg”
Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-4, 6-9, 12-14 and 29-31 is/are rejected under 35 U.S.C. 103 as being unpatentable over Mitra (US 2015/0197788 A1), Markowitz (WO 2018/009535 A1), Brown (US 2018/0237950 A1) and Eltoukhy (US 2017/0260590 A1).
The following are new rejections necessitated by amendments.
Regarding claims 1 and 6, Mitra teaches methods of sequencing nucleic acids for methylation analysis.
Mitra teaches digesting genomic DNA of a sample with the methyl-insensitive restriction enzyme AluI (Fig. 4 and 7; para. 17, 20 and 152). The digestion of genomic DNA results in creating target polynucleotides comprising a plurality of cytosine residues, including methylated cytosine residues.
Mitra teaches ligating one end of the target polynucleotide to a polynucleotide in the form of an upstream universal primer and the other end to a protective polynucleotides in the form of a downstream universal primer that has an exonuclease resistant 3’ modification or “moiety” (Fig. 4 and 7; para. 17, 20 and 152). The universal primer sequences of the polynucleotides do not contain cytosine so that the sequence remains unchanged (para. 168) and are designed for GC pair content (para. 67). One would recognize that if the universal primer has GC content and is not to be changed, for example during, bisulfite treatment, that the GC content needs to include methylated cytosine.
Mitra teaches degrading polynucleotides without the exonuclease resistant 3’ modification using an exonuclease (Fig. 4 and 7; para. 17, 20 and 152).
Mitra teaches converting polynucleotides by chemically converting each unmethylated cytosine using bisulfite (Fig. 4 and 7; para. 17, 20 and 152).
Mitra teaches PCR amplifying the converted polynucleotides to produce amplicons using universal primers tailed with DNA barcodes (Fig. 4 and 7; para. 17, 20 and 152), that have a five base pair combination (para. 189). It is noted that the barcodes of Mitra are structurally indistinguishable from those of the claim having “a first randomly generated UMI polynucleotide sequence”.
Mitra teaches sequencing the plurality of amplicons to produce amplicon sequence reads that correspond to one of the plurality of amplicon polynucleotides and includes the barcode (Fig. 4 and 7; para. 17, 20 and 152). Because the amplicons are of converted polynucleotides, they include a thymine at each nucleotide position corresponding to a reduced unmethylated cytosine and a cytosine at each methylated cytosine. One would appreciate that the system is not perfect and as a consequence errors in sequences may be introduced from incomplete bisulfite conversion, amplification errors, sequencing errors, etc.
Mitra teaches aligning sequence reads with reference sequences (para. 169).
Mitra teaches comparing reads to reference sequences and identifying C positions (para. 103 and 190).
Mitra further teaches using information to find a threshold to classify a locus as methylated or unmethylated in each sample. Mitra teaches optimization queries many CpGs for each locus with the bisulfite sequencing data. Mitra teaches the information was used to optimize a classifier for designating a sequence as methylated or unmethylated. For example, for Mitra an optimal classifier for classifying a sample as “methylated” was if more than 20% of CpG positions per molecule were methylated in more than 35% of molecules (para. 191), which distinguishes their tumor samples from normal samples.
Markowitz teaches that in the context of other samples different thresholds can be reached. For example, using bisulfite sequencing data, Markowitz counted the number of CpGs that were methylated between the amplification primers, and the read was classified as methylated or unmethyled using cutoffs for a required number of methylated CpGs on the amplicon (p. 85, line 29 to p. 86, line 18). For Markowitz, at least 14 CpGs out of 16 CpGs must be methylated in order to call a SqBE read methylated (p. 86, lines 2-5) or for VIM at least 8 of 10 CpGs must be methylated to call the read methylated (p. 90, lines 19-25).
Thus, it is routine to optimize the thresholds based on the samples and the individual genes being analyzed as described by Mitra. Markowitz demonstrates further that selecting thresholds of at least 75% was achieved through optimization. Thus, the present threshold of the amended claim is an obvious variant of the approach of Mitra and Markowitz that is achievable through routine optimization.
Regarding claim 2, Mitra teaches calculating the fraction of methylated target polynucleotides within the total target polynucleotides of the samples (para. 191 and para. 23 and 173).
Regarding claim 3, Mitra teaches the exonuclease resistant modification is a phosphorothioate modification (para. 67).
Regarding claim 4, Mitra teaches the use of “patch” oligonucleotides that hybridize to target polynucleotides and one of either the upstream universal primer or the downstream universal primer, in order to ligate the universal primers to the target polynucleotide (Fig. 4 and 7; paras. 17 and 20).
Regarding claims 7-9, Mitra teaches the target polynucleotide is known to have a specific methylation pattern in colon tumors or breast tumors (para. 24 and 167).
Regarding claim 12, Mitra teaches the target nucleotide sequence includes multiple 5’-C-G-3’ nucleotide pairs (Fig. 11).
Regarding claim 13, Mitra teaches the methylation of cytosines in a plurality of target polynucleotide sequences or “loci” are detected for a sample (Fig. 11).
Regarding claim 14, Mitra teaches detecting the methylation of cytosines in 94 targeted promoters (para. 160).
Regarding claims 29 and 30, Mitra teaches the above elements relevant to claim 1 and using “hypermethylated loci” for diagnosis of breast or colon cancer (para. 178).
Regarding claim 31, Mitra teaches personalized treatment of cancers (para. 163), which the ordinary artisan would recognize as encompassing well-known treatments such as chemotherapy, radiation, surgery, etc.
While Mitra teaches that barcodes are added via a primer as described above in the analysis of claim 1, Mitra does not specifically teach the ligated polynucleotides contains a barcode.
However, Brown teaches it was known that barcodes can be added to polynucleotides via primers such as the tailed primer elongation approach of Mitra or by ligation such as ligation of sequences to a molecule (para. 97).
It would have been prima facie obvious to the ordinary artisan at the time of filing that an obvious variant of attaching barcodes to a polynucleotide using primer of Mitra would be to attach them through ligation as demonstrated by Brown. The modification of simply substituting primer based barcoding for the ligation based barcoding of Brown has a reasonable expectation of success as Brown demonstrates the two are functionally equivalent ways to barcode a polynucleotide.
While Mitra teaches aligning and analyzing sequences, Mitra does not teach generating a consensus sequence for the sequencing reads sharing barcodes.
However, Eltoukhy teaches how to determine a consensus sequence.
Eltoukhy teaches sequence reads are grouped into families (e.g., based on common barcode sequences), with about 10 sequence reads in each family. Families are collapsed into consensus sequences by voting (e.g., biased voting) each position in a family. A base is called for consensus sequence if 8 or 9 members agree and a base is not called for consensus sequence if no more than 60% of the members agree. See para. 232.
It would have been prima facie obvious to the ordinary artisan at the time of filing to have modified the method of Mitra to incorporate the base calling and consensus sequence determination approach of Eltoukhy. The consensus sequences may be used to more accurately determine methylation profiles in a manner analogous to that described by Eltoukhy (para. 233) as well as for being useful for evaluating a sequence over time (para. 164). Eltoukhy teaches the general parameters for consensus sequence generation, thus rendering obvious the elements of the claims.
Claim(s) 5 is/are rejected under 35 U.S.C. 103 as being unpatentable over Mitra (US 2015/0197788 A1), Markowitz (WO 2018/009535 A1), Brown (US 2018/0237950 A1) and Eltoukhy (US 2017/0260590 A1) as applied to claim 1 above, and in further view of Vaisvila (WO 2017/075436 A1).
The following are new rejections necessitated by amendments.
Mitra teaches bisulfite treatment as noted above and does not teach converting unmethylated cytosine with TET2 and APOBEC.
However, Vaisvila teaches TET/APOBEC3A treatment does not damage ssDNA (p. 6, lines 9-11; p. 19, lines 21-24; p. 24, Example 2; and Fig. 3).
It would have been prima facie obvious to the ordinary artisan at the time of filing to have substituted the bisulfite of Mitra with the TET/APOBEC method of Vaisvila. One would have been motivated to make such a modification because TET/APOBEC3A treatment does not damage ssDNA as taught by Vaisvila. The modification has a reasonable expectation of success as both bisulfite and TET/APOBEC3A treatments are known in the art for the analysis of methylation and thus are functionally equivalent and the modification results in a simple substitution.
Claim(s) 15-23 and 26-28 is/are rejected under 35 U.S.C. 103 as being unpatentable over Mitra (US 2015/0197788 A1), Markowitz (WO 2018/009535 A1), Brown (US 2018/0237950 A1), Eltoukhy (US 2017/0260590 A1) and Song (US 2020/0370114 A1)
The following are new rejections necessitated by amendments.
Regarding claims 15 and 20, Mitra teaches methods of sequencing nucleic acids for methylation analysis.
Mitra teaches digesting genomic DNA of a sample with the methyl-insensitive restriction enzyme AluI (Fig. 4; para. 17 and 152). The digestion of genomic DNA results in creating target polynucleotides comprising a plurality of cytosine residues, including methylated cytosine residues.
Mitra teaches ligating one end of the target polynucleotide to a polynucleotide in the form of an upstream universal primer and the other end to a protective polynucleotide in the form of a downstream universal primer that has an exonuclease resistant 3’ modification or “moiety” (Fig. 4; para. 17 and 152). The universal primer sequences of the polynucleotides do not contain cytosine so that the sequence remains unchanged (para. 168) and are designed for GC pair content (para. 67). One would recognize that if the universal primer has GC content and is not to be changed, for example during, bisulfite treatment, that the GC content needs to include methylated cytosine.
Mitra teaches degrading polynucleotides without the exonuclease resistant 3’ modification using an exonuclease (Fig. 7; and para. 20).
Mitra teaches converting polynucleotides by chemically converting each unmethylated cytosine using bisulfite (Fig. 7; and para. 20).
Mitra teaches PCR amplifying the converted polynucleotides to produce amplicons using universal primers tailed with DNA barcodes (Fig. 7; and para. 20), that have a five base pair combination (para. 189). It is noted that the barcodes of Mitra are structurally indistinguishable from those of the claim having “a first randomly generated UMI polynucleotide sequence”.
Mitra teaches sequencing the plurality of amplicons to produce amplicon sequence reads that correspond to one of the plurality of amplicon polynucleotides and includes the barcode (Fig. 7; and para. 20). Because the amplicons are of converted polynucleotides, they include a thymine at each nucleotide position corresponding to a reduced unmethylated cytosine and a cytosine at each methylated cytosine. One would appreciate that the system is not perfect and as a consequence errors may be introduced from incomplete bisulfite conversion, amplification errors, sequencing errors, etc.
Mitra teaches aligning sequence reads with reference sequences (para. 169).
Mitra teaches comparing reads to reference sequences and identifying C positions (para. 103 and 190).
Mitra further teaches using information to find a threshold to classify a locus as methylated or unmethylated in each sample. Mitra teaches optimization queries many CpGs for each locus with the bisulfite sequencing data. Mitra teaches the information was used to optimize a classifier for designating a sequence as methylated or unmethylated. For example, for Mitra an optimal classifier for classifying a sample as “methylated” was if more than 20% of CpG positions per molecule were methylated in more than 35% of molecules (para. 191), which distinguishes their tumor samples from normal samples.
Markowitz teaches that in the context of other samples different thresholds can be reached. For example, using bisulfite sequencing data, Markowitz counted the number of CpGs that were methylated between the amplification primers, and the read was classified as methylated or unmethyled using cutoffs for a required number of methylated CpGs on the amplicon (p. 85, line 29 to p. 86, line 18). For Markowitz, at least 14 CpGs out of 16 CpGs must be methylated in order to call a SqBE read methylated (p. 86, lines 2-5) or for VIM at least 8 of 10 CpGs must be methylated to call the read methylated (p. 90, lines 19-25).
Thus, it is routine to optimize the thresholds based on the samples and the individual genes being analyzed as described by Mitra. Markowitz demonstrates further that selecting thresholds of at least 75% was achieved through optimization. Thus, the present threshold of the amended claim is an obvious variant of the approach of Mitra and Markowitz that is achievable through routine optimization.
Regarding claim 16, Mitra teaches calculating the fraction of methylated target polynucleotides within the total target polynucleotides of the samples (para. 191 and para. 23 and 173).
Regarding claim 17, Mitra teaches the exonuclease resistant modification is a phosphorothioate modification (para. 67).
Regarding claim 18, Mitra teaches the use of “patch” oligonucleotides that hybridize to target polynucleotides and one of either the upstream universal primer or the downstream universal primer, in order to ligate the universal primers to the target polynucleotide (Fig. 4 and 7; paras. 17 and 20).
Regarding claims 21-23, Mitra teaches the target polynucleotide is known to have a specific methylation pattern in colon tumors or breast tumors (para. 24 and 167).
Regarding claim 26, Mitra teaches the target nucleotide sequence includes multiple 5’-C-G-3’ nucleotide pairs (Fig. 11).
Regarding claim 27, Mitra teaches the methylation of cytosines in a plurality of target polynucleotide sequences or “loci” are detected for a sample (Fig. 11).
Regarding claim 28, Mitra teaches detecting the methylation of cytosines in 94 targeted promoters (para. 160).
While Mitra teaches that barcodes are added via a primer, Mitra does not specifically teach the ligated polynucleotides contains a barcode.
However, Brown teaches it was known that barcodes can be added to polynucleotides via primers such as the tailed primer elongation approach of Mitra or by ligation such as ligation of sequences to a molecule (para. 97).
It would have been prima facie obvious to the ordinary artisan at the time of filing that an obvious variant of attaching barcodes to a polynucleotide using the primer of Mitra would be to attach them through ligation as demonstrated by Brown. The modification of simply substituting primer based barcoding for the ligation based barcoding of Brown has a reasonable expectation of success as Brown demonstrates the two are functionally equivalent ways to barcode a polynucleotide.
While Mitra teaches aligning and analyzing sequences, Mitra does not teach generating a consensus sequence for the sequencing reads sharing barcodes.
However, Eltoukhy teaches how to determine a consensus sequence.
Eltoukhy teaches sequence reads are grouped into families, with about 10 sequence reads in each family based on common barcodes. Families are collapsed into consensus sequences by voting (e.g., biased voting) each position in a family. A base is called for consensus sequence if 8 or 9 members agree and a base is not called for consensus sequence if no more than 60% of the members agree. See para. 232.
It would have been prima facie obvious to the ordinary artisan at the time of filing to have modified the method of Mitra to incorporate the base calling and consensus sequence determination approach of Eltoukhy. The consensus sequences may be used to more accurately determine methylation profiles in a manner analogous to that described by Eltoukhy (para. 233) as well as for being useful for observing sequences over time (para. 164). Eltoukhy teaches the general parameters for consensus sequence generation, thus rendering obvious the elements of the claims.
Mitra teaches bisulfite treatment as noted above and does not teach converting methylated cytosine to dihydrouracil (claim 15) or the use of TET (claim 19).
However, Song teaches TAPS or “TET Assisted Pyridine borane Sequencing” is a known method that detects nucleic acid modifications directly with high sensitivity and specificity, without affecting unmodified cytosines, and can be adopted to detect other cytosine modifications. Song teaches that TAPS is non-destructive, preserving RNA and DNA up to 10 kbs long. Song further teaches that compared with bisulfite sequencing, TAPS results in higher mapping rates, more even coverage and lower sequencing costs, enabling higher quality, more comprehensive and cheaper methylome analyses.
It would have been prima facie obvious at the time of filing to have modified the method of Mitra by incorporating the TAPS method of Song. One would have been motivated to make the modification because TAPS is less destructive than bisulfite treatment and TAPS results in higher mapping rates, more even coverage and lower sequencing costs, enabling higher quality, more comprehensive and cheaper methylome analyses. Furthermore, because Mitra does not want the sequences of the ligated primers to change, one would have been motivated to use cytosine in the GC content of the primers such that they are not altered during the TAPS method.
Response to the traversal of the 103 rejections
The Remarks (p. 18-22) have been fully considered but are not persuasive because they do not address the above rejections, in particular the teachings of Markowitz.
Conclusion
No claims allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOSEPH G DAUNER whose telephone number is (571)270-3574. The examiner can normally be reached 7 am EST to 4:30 EST with second Fridays Off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JOSEPH G. DAUNER/ Primary Examiner, Art Unit 1682
Prosecution Insights