Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant's amendments and remarks filed on January 8, 2026 are acknowledged. Claims 2, 4, 7, 9, 13, 14, 17, 24-26, 28, 29, 32, 35, 37, 39, 41, 45, 46, 49, 53, 54, 57, 59, 61, 65, 66, 74, 82, 85, 89, 92, 100-104, and 106 have been canceled. Claims 1, 3, 15, 20, and 22 were amended. Claims 1, 3, 5, 6, 8, 10-12, 15, 16, 18-23, 27, 30, 31, 33, 34, 36, 38, 40, 42-44, 47, 48, 50-52, 55, 56, 58, 60, 62-64, 67-73, 75-81, 83, 84, 86-88, 90, 91, 93-99, 105, and 107 are pending.
Election/Restrictions
Applicant’s election of Group I (claims 1, 3, 5, 6, 8, 10-12, 15, 16, and 18-27) and the following species: (a) anti-PTB shRNA, (b) anti-nPTB shRNA, and (c) a disease associated with a loss of functional neurons in the brain in the reply filed on June 23, 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Newly added claim 107 is drawn to the composition of claim 1; therefore, this claim will be examined with Applicant’s election of Group I.
Claims 30, 31, 33, 34, 36, 38, 40, 42-44, 47, 48, 50-52, 55, 56, 58, 60, 62-64, 67-73, 75-81, 83, 84, 86-88, 90, 91, 93-99, and 105 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Claims 1, 3, 5, 6, 8, 10-12, 15, 16, 18-23, 27, and 107 are examined on the merits herein.
Priority
This application claims priority to PCT/US2020/054940 filed on October 9, 2020 which claims priority to U.S. provisional application 62/913,104, filed on October 9, 2019.
Withdrawn Objections
In view of Applicant’s amendments and response, the objection to the drawings is withdrawn.
In view of Applicant’s amendments and response, the objection to the specification is withdrawn.
In view of Applicant’s amendments and response, the objections to claim 3 are withdrawn.
Withdrawn Rejections
In view of Applicant’s amendments and response, the 35 U.S.C 112(b) rejection is withdrawn.
Drawings
The drawings were received on January 8, 2026. These drawings are found acceptable by the examiner.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 5, 16, 19, and 20 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 5 recites the composition of claim 3 wherein said inhibitory nucleic acid molecule is a ribonucleic acid polynucleotide. Claim 3 depends on claim 1; however, the sequences recited in claim 1 (SEQ ID NOS: 4, 5, 6, and 7) are DNA. Therefore, claim 5 does not include all of the limitations of the claim upon which it depends.
Claim 16 recites the composition of claim 1 wherein said miR-9 agent increases an amount of a nucleic acid encoding a miR-9 molecule. Claim 16 depends on claim 1; however, the specific sequences recited in claim 1 (SEQ ID NOS: 4 and 5) are DNA encoding the miR-9 molecule. Therefore, claim 16 does not further limit the claim which it depends upon.
Claim 19 recites the composition of claim 1 wherein said miR-9 agent is an anti-nPTB inhibitor. Claim 20 recites
PNG
media_image1.png
168
638
media_image1.png
Greyscale
. Dependent claims 19 and 20 substitute the sequences of independent claim 1 (SEQ ID NOS: 4 or 5) with the different types of anti-nPTB inhibitors recited in claim 20.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3, 5, 6, 8, 10-12, 15, 16, 18-21, and 107 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This rejection was made in the Office action mailed 10/8/2025 and has been rewritten to address the amendments to the claims in the reply filed 1/8/2026.
Claims 1, 3, 5, 6, 8, 10-12, 15, 16, 18-21, and 107 are drawn to the provision of a large genus of PTB inhibition agents defined solely by function to suppress PTB expression or activity.
To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of a complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, and any combination thereof.
The specification envisions for example in paragraphs [0074] and [0075] (reproduced below):
PNG
media_image2.png
250
612
media_image2.png
Greyscale
PNG
media_image3.png
552
610
media_image3.png
Greyscale
Thus the claims encompass a large genus of PTB inhibition agents and do not limit the structure of the PTB inhibition agent. The specification only describes that in some embodiments the PTB inhibitor agent comprises an shPTB agent having a sequence of SEQ ID NO: 2 or 3 [0006]. Furthermore, paragraph [0121] (reproduced below) describes SEQ ID NOS: 1 through 8:
PNG
media_image4.png
758
594
media_image4.png
Greyscale
Even if one accepts that the examples described in the specification meet the claim limitations of the rejected claims with regard to structure and function, the examples are only representative of a small group of the recited agents. The results are not necessarily predictive of other agents falling within the broadly claimed genus not limited to any particular structure. Thus, it is impossible for one to extrapolate from the limited examples described herein those agents that would necessarily meet the structural/functional characteristics of the rejected claims.
Yan et al. (FEBS Letters 2002) discloses that phosphotyrosine binding (PTB) domains are structurally conserved modules found in proteins involved in numerous biological processes including signaling through cell-surface receptors and protein trafficking. Further, recent studies show that the protein modules have much broader ligand binding specificities thus highlighting the functional diversity of the PTB domain family as generalized protein interaction domains [abstract].
Uhlik et al. (J. Mol. Biol. 2005) discloses that there are more than 200 proteins in eukaryotes and nearly 60 human proteins having PTB domains. Six PTB domain encoded proteins have been found to have mutations that contribute to inherited human diseases demonstrating the importance of PTB scaffold proteins in organizing critical signaling complexes. The signaling complexes organized by PTB domain encoded proteins are largely unknown and represents an important challenge in systems biology for the future [abstract]. Uhlik et al. also discloses that while all PTB domains function in an adapter/scaffold capacity, significant diversity exists [page 16, right column].
Li et al. (Experimental and Therapeutic Medicine 2023) discloses that additional investigation is necessary to elucidate the molecular mechanisms that govern cell fate and differentiation. Despite the inability of PTBP1 knockdown to promote neuronal maturation and differentiation under normal physiological circumstances, the combined administration of PTBP1 down- regulation alongside crucial adjuncts, such as small molecules, may hold promise for facilitating the transdifferentiation of immortalized cells into neurons in forthcoming research [page 9, right column, last paragraph bridging to page 10, left column].
The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a genus of PTB inhibition agents that could result in suppression of PTB expression or activity.
Therefore, the skilled artisan would have reasonably concluded applicants were not in possession of the claimed invention for claims 1, 3, 5, 6, 8, 10-12, 15, 16, 18-21, and 107.
Response to Arguments
Applicant's arguments filed January 8, 2026 have been fully considered but they are not persuasive.
Applicant asserts the following:
PNG
media_image5.png
192
716
media_image5.png
Greyscale
The Examiner agrees that amending claim 1 to recite that the miR-9 agent comprises SEQ ID NO: 4 or 5 and the miR-124 agent comprises SEQ ID NO: 6 or 7 overcomes the 35 U.S.C. 112(a) written description as it pertains to the miR-9 agent and miR-124 agent. However, the claim as currently written still encompasses a large genus of PTB inhibition agents without limiting the structure of the PTB inhibition agent. It is noted that an opinion as to the commercial availability of antibodies against PTB and nPTB, and PTB inhibitory nucleic acids has been made; however, no evidentiary support has been provided for the opinion. The arguments of counsel cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997) ("An assertion of what seems to follow from common experience is just attorney argument and not the kind of factual evidence that is required to rebut a prima facie case of obviousness."). See MPEP 2145(I) and 716.01(c)(II). Nonetheless, as discussed in the original 35 U.S.C. 112(a) written description rejection, the prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a genus of PTB inhibition agents that could result in a suppression of PTB expression or activity. Therefore, the skilled artisan would have reasonably concluded applicants were not in possession of the claimed invention for claims 1, 3, 5, 6, 8, 10-12, 15, 16, 18-21, and 107.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3, 5, 6, 8, 11, 12, 15, 16, 18, 19, and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Fu et al. (WO 2014/071157) in view of Brodie et al. (US 2015/0037299; reference cited by Applicant), Lu et al. (US 2017/0247767), and Croce et al. (US 2006/0105360; reference cited by Applicant). This is a new rejection, necessitated by the amendment to the claims in the reply filed 1/8/2026.
Regarding claims 1, 3, 5, 11, 12, 15, 16, 18, 19, and 20, Fu et al. teaches a composition for reducing or lowering the level of expression of or activity of or inactivating a Polypyrimidine Tract Binding protein (PTB) gene, message, or protein capable of re-programming a mammalian cell to a neuronal cell in vivo [page 2, lines 15-20]. Fu et al. teaches RNAi inhibitory nucleic acid molecules capable of decreasing or inhibiting expression of a Polypyrimidine Tract Binding protein (PTB) or nPTB gene, message or protein [page 20, second full paragraph] wherein the RNAi molecule comprises short hairpin RNA molecules [page 20, third full paragraph]. Fu et al. also illustrates in Fig. 4D that multiple PTB binding peaks overlap with validated targeting sites by miR-124 and miR-9 [page 8, 22-23]. Fu et al. teaches use of molecules that can generate a PTB and a nPTB knockdown, or abrogation or significant decrease in PTB and nPTB expression. Fu et al. also teaches use of molecules to sequentially knockout first PTB, then nPTB, thus efficiently converting a human cell (e.g., a fibroblast) to a functional neuronal cell [page 19, first full paragraph]. Further, Fu et al. teaches compositions and formulations for use in in vitro, ex vivo or in vivo methods of the invention for trans-differentiating, re- differentiating or re-programming a mammalian cell to a neuronal cell [page 23, last paragraph]. The compositions can be formulated in any way and can be applied in a variety of concentrations and forms depending on the desired in vitro, ex vivo or in vivo conditions, a desired in vitro, ex vivo or in vivo method of administration and the like [page 24, first full paragraph].
Regarding claims 6 and 8, Fu et al. teaches lentiviral shRNAs against human PTBP1 [page 55, first full paragraph].
However, Fu et al. does not teach a composition comprising a miR-9 agent wherein the miR-9 agent comprises SEQ ID NO: 4 or wherein the miR-9 agent comprises a ribonucleic acid polynucleotide encoded by a viral vector. Fu et al. also does not teach that the miR-9 agent increases an amount of a nucleic acid encoding a miR-9 molecule. Fu et al. also does not teach a vector comprising a coding sequence for miR-9 comprising SEQ ID NO: 4 and a coding sequence for miR-124 comprising SEQ ID NO: 6.
Brodie et al. teaches upregulating a level of at least one exogenous miRNA selected from the group consisting of miR-9 in the mesenchymal stem cells (MSCs) thereby predisposing the MSCs to differentiate into the neural stem cells [0010]. Brodie et al. also teaches upregulating a level of exogenous miR-124 in the MSCs and downregulating a level of miR-let-7 in the MSCs thereby predisposing the MSCs to differentiate into the neural stem cells [0012]. Further, Brodie et al. teaches that upregulating is affected by transfecting the mesenchymal stem cells with an expression vector which comprises a polynucleotide sequence which encodes the at least one miRNA [0050]. The neuronal stem cells are contacted (either ex vivo or in vivo) with at least one of the following miRNAs (e.g., miR-9 and miR-124) to induce differentiation towards the motor neuron lineage [0138].
Lu et al. teaches SEQ ID NO: 15 (designated as Db) which has a match to instant SEQ ID NO: 4 (designated as Qy) as shown in the alignment below. SEQ ID NO: 15 is a sequence of the genomic loci encoding miR-9-1 [0031].
Query Match 100.0%; Score 89; Length 1108;
Best Local Similarity 100.0%;
Matches 89; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGGGGTTATTTTTACTTTCGGTTATCTAGCTTTATGAAGACTCCACACCACTCATACAGC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 11 TGGGGTTATTTTTACTTTCGGTTATCTAGCTTTATGAAGACTCCACACCACTCATACAGC 70
Qy 61 TAGATAACCAAAGATAACAACCAACCCCG 89
|||||||||||||||||||||||||||||
Db 71 TAGATAACCAAAGATAACAACCAACCCCG 99
Croce et al. teaches SEQ ID NO: 116 (designated as Db) which has a match to instant SEQ ID NO: 6 (designated as Qy) as shown in the alignment below. SEQ ID NO: 116 is the hsa-miR-124b-precursor sequence [page 23, Table 1].
Query Match 100.0%; Score 59; Length 67;
Best Local Similarity 100.0%;
Matches 59; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CGTGTTCACAGCGGACCTTGATTTAATGTCATACAATTAAGGCACGCGGTGAATGCCAA 59
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6 CGTGTTCACAGCGGACCTTGATTTAATGTCATACAATTAAGGCACGCGGTGAATGCCAA 64
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate a miR-9 agent and/or a miR-124 agent in the composition of Fu et al. to re-program mammalian cells as taught by Brodie et al. One would have been motivated to do so because Brodie et al. taught that miR-9 and miR-124 can induce differentiation.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate a coding sequence for an miR-9 and a coding sequence for an miR-124 in the vector of Fu et al because Brodie et al. taught that upregulation of miR-9 and miR-124 can induce differentiation. One would have been motivated to do so because Brodie et al. taught that upregulation of miR-9 and miR-124 can induce differentiation, Lu et al. taught a sequence of the genomic loci encoding miR-9-1, and Croce et al. taught the hsa-miR-124b-precursor sequence.
Claim 107 is rejected under 35 U.S.C. 103 as being unpatentable over Fu et al. (WO 2014/071157) in view of Brodie et al. (US 2015/0037299; reference cited by Applicant), Lu et al. (US 2017/0247767), and Croce et al. (US 2006/0105360; reference cited by Applicant) as applied to claims 1, 3, 5, 6, 8, 11, 12, 15, 16, 18, 19, and 20 above, and further in view of Engel et al. (Cellular and Molecular Life Sciences 2016). This is a new rejection, necessitated by the amendment filed 1/8/2026.
Regarding claim 107, the teachings of Fu et al., Brodie et al., Lu et al., and Croce et al. are discussed above.
However, Fu et al., Brodie et al., Lu et al., and Croce et al. do not teach that the functional neuron is a cholinergic neuron.
Engel et al. teaches that cholinergic neurons in the mammalian brain, including basal forebrain cholinergic neurons (BFCNs) and interneurons of the striatum, are defined by the production of acetylcholine (ACh) and its use as a neurotransmitter. BFCNs play an important role in cognitive functions, such as learning, memory and attention, and are implicated in the rapid eye movement sleep phase. The loss of BFCNs in neurodegenerative disorders, including Alzheimer’s disease, thus leads to severe cognitive impairments and memory deficits [page 3694, left column, last paragraph bridging to right column].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the composition of Fu et al., Brodie et al., Lu et al., and Croce et al. for generating a functional neuron wherein the functional neuron is a cholinergic neuron because it would have amounted to combining known prior art elements to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Fu et al. taught a composition for reducing or lowering the level of expression of or activity of or inactivating a Polypyrimidine Tract Binding protein (PTB) gene, message, or protein capable of re-programming a mammalian cell to a neuronal cell in vivo, Brodie et al. taught that upregulation of miR-9 and miR-124 can induce differentiation, Lu et al. taught a sequence of the genomic loci encoding miR-9-1, Croce et al. taught the hsa-miR-124b-precursor sequence, and Engel et al. taught that cholinergic neurons, including basal forebrain cholinergic neurons (BFCNs), are defined by the production of acetylcholine (ACh) and the loss of BFCNs in neurodegenerative disorders, including Alzheimer’s disease, leads to severe cognitive impairments and memory deficits.
Response to Arguments
Applicant's arguments filed January 8, 2026 have been fully considered to the extent that they might apply to the new ground of rejection set forth above but they are not persuasive.
Applicant asserts the following:
PNG
media_image6.png
306
868
media_image6.png
Greyscale
PNG
media_image7.png
118
852
media_image7.png
Greyscale
Thus, Applicant asserts that Fu et al. have not and could not have envisioned a single composition that is sufficient to generate neuronal cell in vivo. Applicant also asserts that Brodie et al. teaches the use of miR-9 and miR-124 to generate motor neurons and does not teach or suggest generating non-motor neurons. In addition, Applicant asserts that Brodie et al. does not contemplate a composition for generating neurons in the brain that comprise the components recited in claim 1.
These arguments are not found persuasive. In response to Applicant’s arguments regarding the Fu et al. reference, the teachings of Fu et al. are reproduced below:
PNG
media_image8.png
570
648
media_image8.png
Greyscale
PNG
media_image9.png
506
640
media_image9.png
Greyscale
[pages 2-3]. Specifically, Fu et al. teaches in vitro, ex vivo, or in vivo methods for trans-differentiating, re-differentiating, or re-programming a mammalian cell to a neuronal cell comprising the sequential reducing or lowering the level of expression of or activity of or inactivating of first PTB then nTB in the mammalian cell to be trans-differentiated, re-differentiated, or re-programmed to a neuronal cell. The sequential reducing or lowering of the level of expression of or activity of or inactivating of first PTB then nPTB comprising waiting at least about 4 days after the reducing or lowering of the level of expression of or activity of or inactivating of the PTB before the reducing or lowering of the level of expression of or activity of or inactivating of the nPTB that Applicant points to on page 3, lines 10-15 is optional and thus waiting at least about 4 days is not required.
In response to Applicant’s arguments regarding the Brodie et al. reference, Brodie et al. teaches a method of generating neural stem cells or motor neurons [abstract] (emphasis added) and in some embodiments methods of ex vivo differentiating mesenchymal stem cells towards neural stem cells and motor neurons using microRNAs (miRNAs) [0002]. In addition, contrary to Applicant’s assertions that Brodie et al. does not contemplate a composition for generating neurons in the brain that comprise the components recited in claim 1, claim 1 has been amended such that “for generating a functional neuron in vivo” is no longer in the preamble and is in the body of the claim. Nonetheless, the claims stand rejected under 35 U.S.C. 103 for the reasons discussed above.
Allowable Subject Matter
Claims 22, 23, and 27 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637