Prosecution Insights
Last updated: April 19, 2026
Application No. 17/767,340

METHODS AND COMPOSITIONS FOR TREATING ATAXIA TELANGIECTASIA

Final Rejection §102§103§112§DP
Filed
Apr 07, 2022
Examiner
MCLEOD, AFRICA MHAIRIE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Children's Hospital of Philadelphia
OA Round
2 (Final)
33%
Grant Probability
At Risk
3-4
OA Rounds
4y 0m
To Grant
99%
With Interview

Examiner Intelligence

Grants only 33% of cases
33%
Career Allow Rate
9 granted / 27 resolved
-26.7% vs TC avg
Strong +82% interview lift
Without
With
+81.8%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
55 currently pending
Career history
82
Total Applications
across all art units

Statute-Specific Performance

§101
4.9%
-35.1% vs TC avg
§103
25.9%
-14.1% vs TC avg
§102
17.5%
-22.5% vs TC avg
§112
29.1%
-10.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 27 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s response filed 08/25/2025 has been received and considered/ entered. This is a response to amendments and arguments filed 08/25/2025. Claims Status Claims 12-14, 16, 18, 22, 24, 26, 29-31, 33-36 is/are cancelled. Claims 1-11, 15, 17, 19-21, 23, 25, 27-28, 32 is/are currently pending. Claims 1-11, 15, 17, 19-21, 23, 25, 27-28, 32 is/are under examination. Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 27-28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for methods of treating ataxia telangiectasia using an antisense oligonucleotide of at least 14 nucleotides and at least 90% complementary to an ATM allele over the entire length of the antisense oligonucleotide, does not reasonably provide enablement for methods of treating ataxia telangiectasia using an antisense oligonucleotide comprising fewer than 14 consecutive nucleotides complementary to an ATM allele. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. This is a maintained rejection: claims 27-28 were previously rejected for a total lack of enablement; however, Applicants’ arguments provided sufficient evidence of partial enablement of the claims. In view of the arguments, the rejection of claims 27-28 under 35 USC 112(a) for a total lack of enablement has been changed to a scope of enablement. The factors to be considered in determining whether a disclosure would require undue experimentation include: A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 8 USPQ2d, 1400 (CAFC 1988) and MPEP 2164.01. The breadth of the claims: With respect to claim breadth, the standard under 35 U.S.C. §112, first paragraph, entails the determination of what the claims recite and what the claims mean as a whole. As such, the broadest reasonable interpretation of the claimed method is that it is a method of reducing or ameliorating ataxia telangiectasia and/or symptoms associated with ataxia telangiectasia in a subject (see specification page 13 lines 3-6 for definition of “treating”) using an antisense oligonucleotide comprising fewer than 14 consecutive nucleotides complementary to an ATM allele. A skilled artisan would not know how to use the method with a reasonable expectation of success based solely on what is disclosed in the specification. The amount of direction provided by the inventor and the level of predictability in the art: The specification teaches some cases of ataxia telangiectasia are associated with aberrant splicing of transcripts of the ATM gene, and antisense oligonucleotides comprising as few as 14 consecutive nucleotides complementary to an ATM allele are capable of modulating splicing of ATM (see Tables 1, 2). The art at the time of filing provided enabling guidance for methods of treating other diseases caused by aberrant gene transcript splicing using antisense oligonucleotides having sufficient consecutive nucleotides complementary to the target gene transcript such that the antisense oligonucleotide targets the target gene with no off-target binding (see Scoles, 2019, page 5) However, Scoles also teaches that “therapeutic ASOs range from 18 to 30 base pairs (bp) in length” (page 2). An artisan would not reasonably assume that an ASO shorter than 14 base pairs could function as a therapeutic ASO, and thus could not assume that a method of treating ataxia telangiectasia with an ASO comprising less than 14 consecutive nucleotides targeting the ATM gene could be performed. The specification as filed does not provide guidance that overcomes this unpredictability within the art. The existence of working examples: What is enabled by the working examples is narrow in comparison to the breadth of the claims: The specification discloses methods of correcting splicing of ATM transcripts in human subject-derived fibroblasts ex vivo (see pages 33-36 of the specification) using ASOs comprising at least 14 consecutive nucleotides complementary to an ATM allele and targeting an ATM allele (Tables 1, 2). The quantity of experimentation needed to make or use the invention: The standard of an enabling disclosure is not the ability to make and test if the invention works but one of the ability to make and use with a reasonable expectation of success. A patent is granted for a completed invention, not the general suggestion of an idea (MPEP 2164.03 and Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1325-26 (Fed. Cir. 2004). The instant specification is not enabling because one cannot follow the guidance presented therein, or within the art at the time of filing, and practice the claimed method without first making a substantial inventive contribution. Given that the nature of the invention is in vivo treatment of a subject, including a human subject, using an ASO comprising less than 14 consecutive nucleotides complementary to an ATM allele, a person having ordinary skill in the art would have to perform multiple further experiments, in human clinical trials, or in animal models that are predictive of treatment ataxia telangiectasia, in order to demonstrate the invention could be used with a reasonable expectation of success. The amount of experimentation required for enabling guidance, commensurate in scope with what is claimed, goes beyond what is considered ‘routine' within the art, and constitutes undue further experimentation in order to use the method with a reasonable expectation of successfully treating any CNS disorder or neurodegenerative disease. Therefore, Claims 27-28 are rejected under 35 U.S.C. 112, first paragraph, for failing to meet the enablement requirement. Response to Arguments Applicant's arguments filed 08/25/2025 have been fully considered but they are not persuasive. The broadest reasonable interpretation of claim 1 is that it encompasses any antisense oligonucleotide comprising at minimum 8 nucleotides in length and at least 8 consecutive nucleotides complementary to any sequence within an ATM allele, wherein the ATM allele comprises a mutation associated with aberrant splicing. The broadest reasonable interpretation does not require that the antisense oligonucleotide be capable of hybridizing to or targeting an ATM allele, that the antisense oligonucleotide not be capable of hybridizing to or targeting a gene that is not an ATM gene, or that the antisense oligonucleotide comprise a sequence complementary to the mutation associated with aberrant splicing. Claims 27-28 require the use of the antisense oligonucleotides as claimed in claim 1. Applicant argued that because other antisense oligonucleotides have successfully been used to treat other diseases by correcting aberrant splicing of other genes (e.g., nusinersen for SMA and eteplirsen for DMD), an artisan would reasonably assume that the recited ASOs could be used in a method of treating ataxia telangiectasia. However, this argument is not fully persuasive. While the argument does support the use of ASOs shown to effectively correct splicing of ATM in a method of treating ataxia telangiectasia (such as the ASOs shown in Tables 1, 2 in the specification), this argument does not support enablement for methods of treating ataxia telangiectasia using any ASO comprising as few as 8 consecutive nucleotides complementary to the target gene, ATM. Regarding the breadth of the claims, Applicant argues that claims 27-28 are directed to methods of treating ataxia telangiectasia (“A-T”) in a subject and therefore the claims are commensurate in scope with the disclosure, as the disclosure provides specific sequences, chemical modifications, and administration routes. The examiner considers this partially persuasive. The broadest reasonable interpretation of claim 1 is that it encompasses antisense oligonucleotides having partial complementarity to an ATM allele (comprising at minimum 8 consecutive nucleotides which are complementary to an ATM allele) but not necessarily sufficient to ensure targeting of the ATM allele. The disclosure only describes specific species of antisense oligonucleotides having a much narrower scope of structural features (length, percent complementarity) than those claimed, which enable targeting of an ATM allele and thereby enabling treating A-T using the described antisense oligonucleotides. Regarding the nature of the invention, Applicant argues that the use of ASOs to modulate splicing and treat genetic diseases is well-established. This is not fully persuasive. This argument supports enablement for antisense oligonucleotides with sufficient sequence complementarity to an ATM allele such that the antisense oligonucleotide can target the ATM allele. The antisense oligonucleotide of claim 1, which claims 27-28 require, is not limited to antisense oligonucleotides which target an ATM allele. As such, this argument does not support enablement of the full scope of claims 27-28. Regarding the state of the prior art, Applicant argues that “the use of ASOs for therapeutic modulation of splicing was well known”, and provides multiple references as examples of ASOs used for therapeutic modulation of splicing. This argument supports enablement for antisense oligonucleotides with sufficient complementarity to a gene whose aberrant splicing is desired to be fixed—in the instant case, ATM. However, this argument does not support enablement for antisense oligonucleotides comprising at minimum 8 consecutive nucleotides complementary to a sequence in an ATM allele, as this is insufficient sequence length and complementarity to enable targeting of an ATM allele by the antisense oligonucleotide. Regarding the level of predictability in the art, Applicant argues that “the field of antisense therapeutics is highly developed, and the translation if in vitro/ex vivo findings to in vivo efficacy is well established”. This argument supports enablement for antisense oligonucleotides with sufficient complementarity to a gene whose aberrant splicing is desired to be fixed—in the instant case, ATM. However, this argument does not support enablement for antisense oligonucleotides comprising at minimum 8 consecutive nucleotides complementary to a sequence in an ATM allele, as this is insufficient sequence length and complementarity to enable targeting of an ATM allele by the antisense oligonucleotide. The applicants have not shown in vitro or ex vivo findings regarding the administration and use of antisense oligonucleotides comprising less than 14 nucleotides in length and less than 14 consecutive nucleotides complementary to an ATM allele, and thus an artisan would not be able to predict in vivo efficacy of the full scope of antisense oligonucleotides claimed in claim 1 and relied on by claims 27-28. Regarding the amount of direction provided by the inventor, Applicant argues that “the specification provides guidance for a POSA to make and use the claimed invention, including specific antisense sequences targeting ATM mutations, chemical modifications to enhance stability, affinity, and pharmacokinetics, methods for synthesizing, formulating, and administering ASOs, dosage ranges and administration regimens, and functional assays to confirm restoration of ATM activity. This argument supports enablement for antisense oligonucleotides with sufficient complementarity to an ATM allele whose aberrant splicing is desired to be fixed. However, this argument does not support enablement for antisense oligonucleotides comprising at minimum 8 consecutive nucleotides complementary to a sequence in an ATM allele, as this is insufficient sequence length and complementarity to enable targeting of an ATM allele by the antisense oligonucleotide. The applicants have not provided guidance for the design, administration, and use of antisense oligonucleotides comprising less than 14 nucleotides in length and less than 14 consecutive nucleotides complementary to an ATM allele. Regarding the existence of working examples, Applicant argues that provided are “multiple working examples demonstrating the design, synthesis, and use of ASOs to restore wild-type splicing and ATM function in patient-derived cells”. This argument supports enablement for antisense oligonucleotides with sufficient complementarity to a gene whose aberrant splicing is desired to be fixed—in the instant case, ATM. However, this argument does not support enablement for antisense oligonucleotides comprising at minimum 8 consecutive nucleotides complementary to a sequence in an ATM allele, as this is insufficient sequence length and complementarity to enable targeting of an ATM allele by the antisense oligonucleotide. The applicants have not provided working examples of the design, administration, or use of antisense oligonucleotides comprising less than 14 nucleotides in length and less than 14 consecutive nucleotides complementary to an ATM allele. Regarding the quantity of experimentation needed, Applicant argues that the “specification provides sufficient detail to enable the design, synthesis, and administration of ASOs for the treatment of A-T”. However, as described above, the specification only provides sufficient detail to enable the design, synthesis, and administration of ASOs comprising at least 14 consecutive nucleotides complementary to an ATM allele comprising a mutation associated with aberrant splicing. Given that a plurality of ASOs are described in the art which fulfill the structural requirements of an ASO required by instant claim 1, but do not target an ATM allele (see, for example, WO 2019200172 A1 SEQ ID NO:391), an artisan would have to perform multiple further experiments to design an ASO comprising fewer than 14 consecutive nucleotides complementary to an ATM allele and capable of targeting an ATM allele, further experimentation which would not be routine optimization. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-11, 15, 19-20 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Jo (WO 2019200172 A1: filed 10/17/2019). This is a maintained rejection. Regarding claim 1, Jo teaches an antisense oligonucleotide comprising 16 (8-40) nucleobases, wherein at least 90% of said nucleobases and more than 8 consecutive nucleobases of the oligonucleotide are complementary to a nucleic acid sequence in an Ataxia-Telangiectasia Mutated (ATM) allele comprising a mutation associated with aberrant splicing (required for instant claim 1) (see Jo claim 1, SEQ ID NO:391 comprises 12 consecutive nucleobases complementary to an ATM allele; see alignment below between SEQ ID NO:391 and NM_000051.3 ATM sequence). PNG media_image1.png 98 479 media_image1.png Greyscale Regarding claims 2-3, Jo teaches that the oligomer comprises one or more phosphorothioate linkages (claims 12). Regarding claim 4, Jo teaches that the antisense oligonucleotide comprises a mixture of one or more stereoisomers of phosphorothioate linkages (page 60 line 15-page 61 line 14). Regarding claims 5-6, Jo teaches that the antisense oligonucleotide comprises a 5-methylcytosine modified nucleobase (claim 16). Regarding claims 7-8, Jo teaches that the antisense oligonucleotide comprises a 2’-O-methoxyethyl modified sugar moiety (claim 15; page 54 lines 15-35). Regarding claim 9, Jo teaches that the antisense oligonucleotide comprises locked nucleic acids (LNAs) (claim 14). Regarding claim 10, Jo teaches that the antisense oligonucleotide is a peptide nucleic acid (PNA) (page 58 line 15-page 59 line 4). Regarding claim 11, Jo teaches an antisense oligonucleotide complementary to an ATM allele comprising the mutation c.5762ins137 or c.7865C>T (see alignment above, the antisense oligonucleotide of SEQ ID NO:391 is complementary to a portion of the ATM gene that does not comprise nucleotides 5762 or 7865, and thus is complementary to an ATM allele comprising one of or both mutations) (claim 1). Regarding claim 15, Jo teaches an antisense oligonucleotide comprising at least 10 nucleobases of SEQ ID NOs:1 and 2 (Jo teaches SEQ ID NO:391, see alignment below between instant SEQ ID NO:1 and Jo SEQ ID NO:391). PNG media_image2.png 98 465 media_image2.png Greyscale Regarding claim 19, Jo teaches a set comprising two or more of the antisense oligonucleotides (page 42 lines 6-7). Regarding claim 20, Jo teaches a pharmaceutical composition comprising an effective amount of the antisense oligonucleotides and a pharmaceutically-acceptable excipient (claim 30; see page 161 lines 25-27 and Example 24, Jo et al. administer an effective amount to subjects). Claim(s) 1-11, 17, 19-20 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Karras (US 20050074879 A1). This is a maintained rejection. Regarding claim 1, Karras teaches antisense oligonucleotides comprising 8-40 nucleotides, wherein the antisense oligonucleotides are complementary to a nucleic acid sequence in an ATM allele comprising a mutation associated with aberrant splicing (Table 1, SEQ ID NO:41, see alignment to instant SEQ ID NO:16 below, wherein SEQ ID NO:16 is complementary to an ATM allele). PNG media_image3.png 94 466 media_image3.png Greyscale Regarding claims 2-4, Karras teaches that the antisense oligonucleotide comprises at least one phosphorothioate linkage (paragraph [0224], Table 1; paragraph [0048]). Regarding claims 5-6, Karras teaches that the antisense oligonucleotide comprises 5’-methylcytosines (paragraph [0224]). Regarding claims 7-8, Karras teaches that the antisense oligonucleotide comprises 2’-methoxyethyl modified sugar moieties (paragraph [0224]). Regarding claim 9, Karras teaches that the antisense oligonucleotide comprises locked nucleic acids (paragraph [0081]). Regarding claim 10, Karras teaches that the antisense oligonucleotide is a peptide nucleic acid (paragraph [0054]). Regarding claim 11, Karras teaches that the antisense oligonucleotide is complementary to a nucleic acid sequence in an ATM allele comprising a c.5762ins137 mutation or c.7865C>T mutation (see alignment below between SEQ ID NO:41, shown in Tables 1 and 2, and the ATM sequence; the antisense oligonucleotide of SEQ ID NO:41 is not complementary to these mutation sites, and thus is complementary to ATM sequences comprising these mutations). PNG media_image4.png 107 590 media_image4.png Greyscale Regarding claim 17, Karras teaches an antisense oligonucleotide comprising at least 10 nucleobases of SEQ ID NO:16 (see alignment above). Regarding claim 19, Karras teaches a set of antisense oligonucleotides comprising two or more of the antisense oligonucleotides (paragraph [0224]: Karras teaches a set of antisense oligonucleotides of SEQ ID NO:41 with different modifications, see Tables 1 and 2). Regarding claim 20, Karras teaches a pharmaceutical composition comprising an effective amount of the antisense oligonucleotides and a pharmaceutically-acceptable excipient (paragraphs [0174], [0183], [0190]). Claim(s) 1-11, 19-20 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Park (US 11359199 B2: EFD 03/20/2019) . This is a maintained rejection. The applied reference has a common applicant and two of four inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim 1, Park teaches an antisense oligonucleotide complementary to an ATM allele comprising a mutation associated with aberrant splicing (claim 1). While Park does not explicitly teach that the antisense oligonucleotide is complementary to an ATM allele, Park does teach that the antisense oligonucleotides comprise sequences with at least 80% sequence identity to the sequence of SEQ ID NO:5, which when aligned with the sequence of the ATM gene (NM_000051.3) has a segment of 8 consecutive nucleotides complementary to the ATM gene (see alignment below). PNG media_image5.png 119 597 media_image5.png Greyscale Regarding claims 2-4, Park teaches that the antisense oligonucleotide (ASO) comprises a phosphorothioate backbone linkage (claim 4) and is a mixture of one or more stereopure molecules with a defined sequence (claim 8). Regarding claims 5-6, Park teaches that the ASO comprises a 5’-methylcytosine nucleobase (claim 7). Regarding claims 7-8, Park teaches that the ASO comprises a 2’-O-methyl, w’-methoxyethoxy, 2’-O-methoxyethyl, 2’-dimethylaminooxyethoxy, 2’-dimethylaminoethoxyethoxy, 2’-fluoro, or 2’-acetamide modification (claim 3). Regarding claim 9, Park teaches that the ASO comprises locked nucleic acids (claim 3). Regarding claim 10, Park teaches that the ASO is a peptide nucleic acid (claim 5). Regarding claim 11, Park teaches ASOs complementary to SEQ ID NO:5 (see above rejection of claim 1). The alignment of SEQ ID NO:5 to the known sequence of the ATM allele shows that this segment of 8 nucleotides shared between SEQ ID NO:5 and the ATM gene does not overlap with the mutations c.5762ins137 or c.7865C>T, and as such, this 8-nucleotide segment is complementary to an ATM allele comprising either of these mutations. Regarding claim 19, Park teaches a set of ASOs comprising two or more of the ASOs (col. 32 lines 6-9). Regarding claim 20, Park teaches a pharmaceutical composition comprising the ASO and a pharmaceutically-acceptable excipient (claim 9). Claim(s) 1-11 and 19-20 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Huang (US20220154182A1). This is a maintained rejection. The applied reference has a common assignee and two of four inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim 1, Huang teaches an antisense oligonucleotide complementary to an ATM allele comprising a mutation associated with aberrant splicing (claim 1). While Huang does not explicitly teach that the antisense oligonucleotide is complementary to an ATM allele, Huang does teach that the antisense oligonucleotides comprise sequences with at least 80% sequence identity to the sequence of SEQ ID NO:5, which when aligned with the sequence of the ATM gene (NM_000051.3) has a segment of 8 consecutive nucleotides complementary to the ATM gene (see alignment below). PNG media_image6.png 140 594 media_image6.png Greyscale Regarding claims 2-4, Huang teaches that the antisense oligonucleotide (ASO) comprises a phosphorothioate backbone linkage (claim 13) and is a mixture of one or more stereopure molecules with a defined sequence (claim 17). Regarding claims 5-6, Huang teaches that the ASO comprises a 5’-methylcytosine nucleobase (claim 16). Regarding claims 7-8, Huang teaches that the ASO comprises a 2’-O-methyl, w’-methoxyethoxy, 2’-O-methoxyethyl, 2’-dimethylaminooxyethoxy, 2’-dimethylaminoethoxyethoxy, 2’-fluoro, or 2’-acetamide modification (claim 8). Regarding claim 9, Huang teaches that the ASO comprises locked nucleic acids (claim 8). Regarding claim 10, Huang teaches that the ASO is a peptide nucleic acid (claim 14). Regarding claim 11, Huang teaches ASOs complementary to SEQ ID NO:5 (see above rejection of claim 1). The alignment of SEQ ID NO:5 to the known sequence of the ATM allele shows that this segment of 8 nucleotides complementary between SEQ ID NO:5 and the ATM gene does not overlap with the mutations c.5762ins137 or c.7865C>T, and as such, this 8-nucleotide segment is complementary to an ATM allele comprising either of these mutations. Regarding claim 19, Huang teaches a set of ASOs comprising two or more of the ASOs (paragraph [0195]). Regarding claim 20, Huang teaches a pharmaceutical composition comprising the ASO and a pharmaceutically-acceptable excipient (claim 38). Response to Arguments Applicant's arguments filed 08/25/2025 have been fully considered but they are not persuasive. Applicant has argued that Jo, Karras, Park, and Huang cannot be applied as prior art under 35 USC 102 because the target genes of Jo, Karras, Park, and Huang are not the ATM gene. The broadest reasonable interpretation of claim 1 is that it encompasses any antisense oligonucleotide comprising at minimum 8 nucleotides in length and at least 8 consecutive nucleotides complementary to any sequence within an ATM allele, wherein the ATM allele comprises a mutation associated with aberrant splicing. The broadest reasonable interpretation does not require that the antisense oligonucleotide be capable of hybridizing to or targeting an ATM allele, that the antisense oligonucleotide not be capable of hybridizing to or targeting a gene that is not an ATM gene, or that the antisense oligonucleotide comprise a sequence complementary to the mutation associated with aberrant splicing. Jo teaches ASOs targeting the EZH2 gene; Karras teaches ASOs targeting the STAT3 gene; Park teaches an ASO targeting the GRN gene; and Huang teaches an ASO targeting the GRN gene. However, claim 1 of the pending application does not require that the recited ASO be capable of targeting or hybridizing the ATM gene. Claim 1 of the pending application recites a composition with a certain structural requirement (see broadest reasonable interpretation described above). The intended property of complementarity is inherent to the structure, but does not necessarily imply a function of being able to target a particular sequence (e.g., a sequence comprising 8 consecutive nucleotides complementary to a sequence within an ATM allele and also comprising additional nucleotides 3’ and/or 5’ of this complementary sequence which are not complementary to the ATM allele fits the structural requirements but does not target the ATM allele). Claim 1 requires that the ASO comprise at minimum 8 consecutive nucleotides complementary to a nucleic acid sequence in an ATM allele. Jo, Karras, Park, and Huang teach ASOs comprising at least 8 consecutive nucleotides complementary to a sequence within an ATM allele, and thus meet the limitations required by claim 1 in view of the broadest reasonable interpretation. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1, 10-11, 17, 19, 21, 23, 25, 32 is/are rejected under 35 U.S.C. 103 as being unpatentable over Du (2007), in view of Karkare (2006). Regarding claim 1, Du teaches antisense oligonucleotides comprising 8-40 nucleotides, wherein the antisense oligonucleotides are complementary to a nucleic acid sequence in an ATM allele comprising a mutation associated with aberrant splicing (page 6007). Regarding claim 11, Du teaches that the mutation is c.7865C>T (page 6007). Regarding claim 17, Du teaches that the antisense oligonucleotide comprises the sequence TAAGCATCACAAAGTACCTC (identical to instant SEQ ID NO:20) (page 6007). Regarding claim 19, Du teaches a set of two or more of the antisense oligonucleotides (page 6007). Regarding claim 21, Du teaches a method of restoring wild-type splicing of an ATM allele comprising a mutation associated with ataxia telangiectasia in a cell, the method comprising contacting the cell with an effective amount of the antisense oligonucleotides, thereby restoring wild-type splicing (Fig. 2). Regarding claim 23, Du teaches that the mutation is in an exonic splicing enhancer site (Fig. 1A). Regarding claim 25, Du teaches that the mutation is c.7865C>T (page 6007; Fig. 1A). Regarding claim 32, Du teaches an isolated cell comprising the antisense oligonucleotides and a mutation associated with ataxia telangiectasia (Fig. 2). However, Du teaches that the antisense oligonucleotide is a morpholino, while instant claim 1 requires that the antisense oligonucleotide does not comprise a morpholino backbone. Karkare teaches that PNAs and morpholinos are obvious variants of antisense oligonucleotides. Regarding claims 1 and 10, Karkare teaches that both PNAs and morpholinos are effective oligonucleotides for targeting splice junctions of pre-mRNA (page 584). As Karkare teaches that PNAs and morpholino backbones (such as the morpholino backbone of the antisense oligonucleotide of Du) are obvious alternatives for antisense oligonucleotide backbones, it would have been obvious to an artisan at the time of filing that the morpholino backbone taught by Du could be replaced with a PNA backbone, while maintaining the ability of the antisense oligonucleotide to hybridize to and block ATM pre-mRNA. Claim(s) 1-10 and 20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Du (2007), in view of Scoles (2019) and as evidenced by Scoles (2017). Regarding claim 1, Du teaches antisense oligonucleotides comprising 8-40 nucleotides, wherein the antisense oligonucleotides are complementary to a nucleic acid sequence in an ATM allele comprising a mutation associated with aberrant splicing (page 6007). However, Du does not teach that the antisense oligonucleotide comprises phosphorothioate linkages, 5-methylcytosine modified nucleobases, modified sugars, or locked nucleic acids, that the antisense oligonucleotide is not a morpholino, or that the antisense oligonucleotide is comprised in a pharmaceutical composition. Scoles teaches structural and compositional elements of antisense oligonucleotides that improve stability, efficiency, and delivery of antisense oligonucleotides. Regarding claim 1, Scoles teaches that ASOs can comprise methoxyethyl linkages, LNAs, phosphorothioate linkages, peptide nucleic acid linkages, mixed linkages, and other chemistries that are not morpholino linkages (see “Table” on page 5; pages 2-4). Regarding claims 2-4, Scoles teaches that phosphorothioate linkages increase nuclease resistance, thereby increasing the oligonucleotide’s half-life, and the antisense oligonucleotides comprising phosphorothioate linkages can be stereopure or comprise a mix of different stereoisomers (pages 2, 4). Regarding claims 5-6, Scoles teaches that antisense oligonucleotides can comprise 5’-methylcytosine modifications (page 4). Regarding claims 7-8, Scoles teaches that antisense oligonucleotides can comprise 2’-O-methoxyethyl modifications or 2’-O-methyl modifications (pages 2-3). Regarding claim 9, Scoles teaches that antisense oligonucleotides can comprise locked nucleic acids (page 3). Regarding claim 10, Scoles teaches that antisense oligonucleotides can comprise peptide nucleic acid linkages (page 4). Regarding claim 20, Scoles teaches multiple examples of pharmaceutical compositions of antisense oligonucleotides, but does not specifically discuss the presence or absence of pharmaceutically-acceptable excipients (pages 5-7). Scoles (2017) is cited (reference 38) on page 5 in regards to an example of a pharmaceutical composition of an antisense oligonucleotide targeting ATXN-2 (page 5). Scoles (2017) describes that antisense oligonucleotides injected were diluted in saline, a pharmaceutically-acceptable excipient (pages 5-6). While Du does not teach that the antisense oligonucleotide comprises such modifications as phosphorothioate linkages, modified nucleobases, modified sugars, locked nucleic acids, or pharmaceutically-acceptable excipients, Scoles teaches that antisense oligonucleotides may contain all of these modifications in order to provide stability or safety. Scoles teaches that phosphorothioate linkages provide nuclease resistance (page 2), and further that stereopure phosphorothioate linkages in an antisense oligonucleotide can provide greater potency in vivo (page 4). Scoles teaches that 5’-methylcytosine modifications enhance base pairing of an antisense oligonucleotide (page 4). Scoles also teaches that 2’-O-methoxyethyl and 2’-O-methyl modifications improve binding affinity of an antisense oligonucleotide to a target mRNA, and that further, 2’-O-methoxyethyl modifications are less toxic than 2’-O-methyl modifications (pages 2-3). Scoles also teaches that locked nucleic acids increase target specificity and reduce nuclease recognition (page 3). While Scoles does not explicitly teach pharmaceutically-acceptable excipients in relation to the multiple pharmaceutical compositions Scoles teaches, as described above, the references cited in regards to these pharmaceutical compositions render obvious the use of pharmaceutically-acceptable excipients in pharmaceutical compositions. For these reasons, it would have been obvious to a person of ordinary skill in the art at the time of filing to modify the antisense oligonucleotide of Du to include one or more of the modifications taught by Scoles, in order to increase the stability of the antisense oligonucleotide in vivo (e.g. by decreasing nuclease recognition and cleavage) and the specificity with which the antisense oligonucleotide binds to a target mRNA, and to decrease toxicity in vivo, all of which qualities would increase the efficacy of the antisense oligonucleotide in vivo and improve a subject’s experience with a therapy comprising the antisense oligonucleotide. Response to Arguments Applicant's arguments filed 08/25/2025 have been fully considered but they are not persuasive. The applicants argue that the combination of Du and Scoles is impermissible because “Scoles 2019 does not describe ATM, ataxia-telangiectasia, or splicing mutations. Furthermore, Scoles 2019 does not teach or suggest the application of these ASO modifications to antisense oligonucleotides targeting ATM, nor does it address the correction of aberrant splicing in ATM alleles or the treatment of ataxia-telangiectasia” (page 18 of arguments). In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., that the antisense oligonucleotide be used in a method of treating ataxia-telangiectasia, that the antisense oligonucleotide target the ATM gene, that the antisense oligonucleotide correct aberrant splicing in ATM alleles) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). The claims rejected over Du and Scoles under 35 USC 103 do not require that the antisense oligonucleotide be used in a method of treating ataxia-telangiectasia, nor that the antisense oligonucleotide must be capable of targeting the ATM gene. Furthermore, while Scoles does not teach a method of treating ataxia-telangiectasia or correcting splicing of or targeting the ATM gene with antisense oligonucleotides, Du does teach a method of targeting the ATM gene with antisense oligonucleotides, and Scoles teaches multiple different antisense oligonucleotides of different chemical compositions used to correct aberrant splicing of different genes (see Table, page 5). An artisan at the time of filing would understand, based on the teachings of Scoles, that antisense oligonucleotides designed to correct aberrant splicing of a gene transcript can comprise a variety of different chemical modifications, including but not limited to morpholino backbones, phosphorothioate linkages, and PNAs. Scoles teaches in the table on page 5 that eteplirsen is a morpholino ASO used to correct exon 51 splicing in the DMD gene; that nusinersen is a 2’-MOE ASO used to correct exon 7 splicing in the SMN2 gene; and WVE-210201 is a stereopure phosphorothioate ASO in phase 1 clinical trials used to correct aberrant splicing of the DND gene. An artisan would recognize that multiple alternatives to morpholino backbones, such as PNAs and phosphorothioate backbones, were well-known in the art for use specifically in the design of ASOs used to correct aberrant gene transcript splicing, and as such, the morpholino ASO taught by Du could be modified by replacing the morpholino backbone with a different backbone structure or different or additional chemical modifications already known in the art, in order to modify stability, effectiveness, and safety of the ASO. As such, the rejection of claims 1-9 and 20 over Du in view of Scoles under 35 USC 103 is maintained. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-11, 19-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4-11, 15-20 of U.S. Patent No. 11359199 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because, while ~199 does not specifically recite that the recited antisense oligonucleotides are complementary to an ATM allele comprising a mutation associated with aberrant splicing, ~199 does recite that recited antisense oligonucleotides comprise sequences with at least 80% sequence identity to the sequence of SEQ ID NO:5, which when aligned with the sequence of the ATM gene (NM_000051.3) has a segment of 8 consecutive nucleotides complementary to the ATM gene (see alignment below). PNG media_image5.png 119 597 media_image5.png Greyscale Claims 1-11, 19-20 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 8, 13-17, 38 of copending Application No. 17440438 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because, while ~438 does not specifically recite that the recited antisense oligonucleotides are complementary to an ATM allele comprising a mutation associated with aberrant splicing, ~438 does require that the recited antisense oligonucleotides comprise sequences with at least 80% sequence identity to the sequence of SEQ ID NO:12, which when aligned with the sequence of the ATM gene (NM_000051.3) has a segment of 8 consecutive nucleotides complementary to the ATM gene (see alignment below). PNG media_image7.png 166 660 media_image7.png Greyscale This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1, 11, 19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4-7, 16, 28 of copending Application No. 18016190 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because, while ~190 does not specifically recite that the recited antisense oligonucleotides are complementary to an ATM allele comprising a mutation associated with aberrant splicing, ~190 does recite that recited antisense oligonucleotides comprise sequences with at least 80% sequence identity to the sequence of SEQ ID NO:4, which when aligned with the sequence of the ATM gene (NM_000051.3) has a segment of 10 consecutive nucleotides complementary to the ATM gene (see alignment below). PNG media_image8.png 142 590 media_image8.png Greyscale This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 2-10 and 20 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4-7, 16, 28 of copending Application No. 18016190, as applied to claim 1 above, and further in view of Scoles (2019). The recited limitations of ~190 are discussed above as being patentably indistinct from the limitations of claims 1 and 11 of the instant application. Copending claims 6-7 recite a nucleic acid (which can be an antisense oligonucleotide, see claim 5) comprising the sequence of SEQ ID NO:4, which comprises at least 8 consecutive nucleotides complementary to the ATM gene se
Read full office action

Prosecution Timeline

Apr 07, 2022
Application Filed
Apr 07, 2022
Response after Non-Final Action
Oct 14, 2022
Response after Non-Final Action
May 12, 2025
Non-Final Rejection — §102, §103, §112
Aug 20, 2025
Response Filed
Nov 25, 2025
Final Rejection — §102, §103, §112
Apr 06, 2026
Examiner Interview Summary

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12522822
APOLIPOPROTEIN C3 (APOC3) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Jan 13, 2026
Patent 12514868
Multiplex shRNA for Use in Vectors
2y 5m to grant Granted Jan 06, 2026
Patent 12516353
RECOMBINANT HERPESVIRUS OF TURKEYS (HVT) AND PREPARATION METHOD AND USE THEREOF
2y 5m to grant Granted Jan 06, 2026
Patent 12473527
OPTIMIZED GENETIC TOOL FOR MODIFYING BACTERIA
2y 5m to grant Granted Nov 18, 2025
Patent 12429487
NEUROFILAMENT PROTEIN FOR GUIDING THERAPEUTIC INTERVENTION IN AMYOTROPHIC LATERAL SCLEROSIS
2y 5m to grant Granted Sep 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
33%
Grant Probability
99%
With Interview (+81.8%)
4y 0m
Median Time to Grant
Moderate
PTA Risk
Based on 27 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month