Prosecution Insights
Last updated: July 28, 2026
Application No. 17/769,886

COMPOSITIONS AND METHODS FOR TREATING LIVER DISEASE

Non-Final OA §103
Filed
Apr 18, 2022
Priority
Oct 16, 2019 — provisional 62/915,765 +1 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Pittsburgh
OA Round
3 (Non-Final)
38%
Grant Probability
At Risk
3-4
OA Rounds
0m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
282 granted / 741 resolved
-21.9% vs TC avg
Strong +53% interview lift
Without
With
+52.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
55 currently pending
Career history
809
Total Applications
across all art units

Statute-Specific Performance

§101
0.4%
-39.6% vs TC avg
§103
57.6%
+17.6% vs TC avg
§102
6.6%
-33.4% vs TC avg
§112
10.0%
-30.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 741 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 03/10/2026 has been entered. Applicant’s amendment filed on 03/10/2026 has been entered. Amended claims 1, 4-7, 11-14, 27, 29 and 35-36 are pending in the present application. Applicant elected previously without traverse of Group I, which is drawn to a method of treating a liver disease in a subject in need thereof comprising administering to the subject a composition, wherein the composition increases an amount or function of one or more transcription factors selected from the group consisting of PROX1, NR5A2, NR0B2, MTF1, SREBP1, EP300, and POM121C. Applicant also elected previously without traverse the following species: (i) MTF1 as a species of a transcription factor; (ii) a vector is a species of a composition; (iii) the composition increases a total amount of HNF4α in a hepatocyte; and (iv) liver cirrhosis as a species of liver disease. Upon further consideration, the species end-stage liver disease is rejoined and examined together with the elected species of liver cirrhosis. Thus, claim 12 is rejoined for examination. Claims 27 and 29 were withdrawn previously from further consideration because they are directed to a non-elected invention. Claims 4 and 6 were also withdrawn previously from further consideration because they are directed to a non-elected species. Accordingly, amended claims 1, 5, 7, 11-14 and 35-36 are examined on the merits herein. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Amended claims 1, 5, 7, 11-14 and 35-36 are rejected under 35 U.S.C. 103 as being unpatentable over Fox et al (US 9,981,048; IDS) in view of Kimura et al (J. Cell. Biochem. 99:485-494, 2006), Wang et al (FASEB J. 18:1071-1079, 2004), Sato et al (Pharmacology & Toxicology 87:292-296, 2000) and Willenbring et al (US 2018/0057839; IDS). This is a modified rejection. The instant claims encompass a method of treating a liver disease in a subject in need thereof comprising administering to a hepatocyte in the subject a composition, wherein the composition comprises one or more expression vectors comprising one or more nucleic acids encoding HNF4α isoform 2 (P1) and metal-responsive transcription factor 1 (MTF1), wherein the composition increases an amount or function of MTF1, and wherein the liver disease comprises liver cirrhosis or an end-stage liver disease. Fox et al already disclosed at least a method of treating hepatic failure (the final, end-stage of liver disease) or cirrhosis in a human subject, comprising administering intravenously, to a human subject having liver failure (e.g., Child-Pugh Class B or C), a therapeutically effective amount of a pharmaceutical composition comprising a therapeutic adeno-associated virus vector comprising a nucleic acid encoding a human HNF4α protein, operably linked to a promoter, wherein administration of said nucleic acid results in expression of the human HNF4α protein and improved liver function (see at least Abstract; Summary and issued claims 1-6). Fox et al also taught using the HNF4α nucleic acid having SEQ ID NO: 2 that encodes the HNF4α amino acid sequence that is 100% identical to SEQ ID NO: 1 (HNF4α isoform 2) of the present application (col. 9, lines 31-44; and attached sequence search below). Fox et al also taught that the treatment method comprising administering to the subject a HNF4α nucleotide alone, or in combination with one or more other nucleotide sequences, drugs, lifestyle changes, etc. used in the treatment of liver failure and/or cirrhosis (col. 17, lines 4-17). Fox et al did not teach specifically a hepatic failure/cirrhosis treatment method further comprising administering to the subject an expression vector comprising a nucleic acid encoding the transcription factor MTF1. Before the effective filing date of the present application (10/16/2019), Kimura et al already taught that Metal-responsive transcription factor-1 (MTF-1), which is involved in sensing heavy metal load, induces the transcription of several protective genes; and they demonstrated that MTF-1 is particularly important for proper hepatocyte proliferation, and the function of MTF-1 is in the MEK/ERK cascade using primary hepatocytes isolated from 5- to 8- week old adult mice (see at least the Abstract). Additionally, Wang et al also taught the MTF-1 activates the transcription of metallothionein genes and other target genes in response to heavy metal load and other stresses such as hypoxia and oxidative stress; and they demonstrated that MTF-1 is essential for embryonic liver development and heavy metal detoxification in the adult liver (see Abstract). Wang et al demonstrated that primary mouse embryonic Mtf1-/- hepatocytes are intrinsically less viable than their wild-type counterparts, and disruption of Mtf1 causes embryonic lethality at mid gestation due to liver degeneration; but the liver degeneration phenotype was rescued by MTF-1 cDNA transgene (sections titled “Primary embryonic hepatocyte culture indicates mutant hepatocyte defect is cell autonomous” at page 1073; and “MTF-1 cDNA transgene fully rescues the KO phenotype” at page 1075). Additionally, deletion of the Mtf1 gene in adult mouse liver by conditional knockout revealed that KoTgCre mice are sensitive to cadmium toxicity, and the total amount of accumulated cadmium was reduced 3-fold in livers compared with the control mice (Section titled “Cadmium sensitivity of mice with selective Mtf1 deletion in the liver” at pages 1075-1076). Wang et al also stated “Since metal-loaded metallothioneins are preferentially accumulating in liver and kidney, these data are in line with a severely reduced expression of metallothioneins in cells lacking Mtf1” (lower half of the paragraph on left column at page 1076). Moreover, Sato et al investigated distribution of zinc-binding metallothionein in cirrhotic liver of rats administered zinc, and they found that the levels of zinc-metallothionein in the cirrhotic liver were reduced in comparison with those of the normal liver with the presence of metallothionein was detected in the parenchymal areas but not in the fibrotic areas of the cirrhotic liver (Abstract; page 294, right column, second paragraph; Table 2 and Fig. 3). Sato et al also stated “[i]mmunoreactivity for metallothionein was scarcely detected in the liver in cirrhotic rats not administered Zn” (last sentence of second paragraph on right column at page 294); and “The metallothionein induced in the parenchymal areas was considered to play a role in protecting the parenchymal cells against the progression of fibrosis because metallothionein has been thought to be involved in the cellular defense against oxidative stress” (last sentence of the Abstract). Furthermore, Willenbring et al also taught at least a method of treating liver fibrosis or liver cirrhosis or inducing proliferation of hepatocytes in a subject in need thereof (e.g., a human) comprising: administering (e.g., via intravenous injection) to the subject a therapeutically effective amount of a pharmaceutical composition comprising: a first nucleic acid sequence encoding HNF4α, a second nucleic acid sequence that encodes one or a plurality of transcription factors chosen from: FOXA1, FOXA2, FOXA3, HNF1α, HNF6, GATA4, HLF, CEBPA, PROX1 and ATF5A; wherein any of the aforementioned sequences may be on one, two, three, four, five or more separate nucleic acid molecules (e.g., at least one viral vectors) each of which capable of expressing the one or more plurality of expressible genes under conditions sufficient to express the gene upon introduction of the one or plurality of nucleic acid molecules in a cell (see at least Abstract; Summary of Illustrative Embodiments; particularly paragraphs [0005], [0017]-[0018], [0020]-[0021], [0187]-[0188], [0190]-[0191]; and the claims). Willenbring et al also stated “a composition or pharmaceutical composition comprising at least one viral vector comprising any of the disclosed nucleic acid sequence encoding one or more expressible genes” (paragraph [0005]); and “[t]he methods performed herein are performed by simultaneous or sequential administration of any one or more viral particles disclosed herein comprising any one or a plurality of any of the nucleic acid sequences disclosed herein” (paragraph [0021]). Accordingly, it would have been obvious for an ordinary skill in the art to modify the treatment method of Fox et al by also further administering to the subject a nucleic acid encoding the transcription factor MTF-1 on the same viral vector comprising a nucleic acid encoding HNF4alpha isoform 2 (P1) or on a separate viral vector for treatment of liver failure or cirrhosis, in light of the teachings of Kimura et al, Wang et al, Sato et al and Willenbring et al as set forth above. An ordinary skilled artisan would have been motivated to carry out the above modifications because: (i) Kimura et al demonstrated that MTF-1 is particularly important for proper hepatocyte proliferation in primary hepatocytes isolated from adult (5- to 8-week-old) mice, and MTF-1 induces the transcription of several protective genes; (ii) Wang et al taught that MTF-1 is essential for embryonic liver development and heavy metal detoxification in the adult liver with conditional Mtf1 knockout mice are sensitive to cadmium toxicity due to a severely reduced expression metallothioneins in cells lacking Mtf1; (iii) Sato et al found that the levels of zinc-metallothionein in the cirrhotic liver were reduced in comparison with those of the normal liver, with the presence of metallothionein was detected in the parenchymal areas but not in the fibrotic areas of the cirrhotic liver, and the metallothionein induced in the parenchymal areas was considered to play a role in protecting the parenchymal cells against the progression of fibrosis because metallothionein has been thought to be involved in the cellular defense against oxidative stress; and (iv) Willenbring et al already taught successfully at least a method of treating liver fibrosis or liver cirrhosis or inducing proliferation of hepatocytes in a subject in need thereof (e.g., a human) comprising: administering (e.g., via intravenous injection) to the subject a therapeutically effective amount of a pharmaceutical composition comprising: a first nucleic acid sequence encoding HNF4α, a second nucleic acid sequence that encodes one or a plurality of transcription factors chosen from: FOXA1, FOXA2, FOXA3, HNF1α, HNF6, GATA4, HLF, CEBPA, PROX1 and ATF5A; wherein any of the aforementioned sequences may be on one, two, three, four, five or more separate nucleic acid molecules. An ordinary skill in the art would readily recognize at least from the teachings of Wang et al and Sato et al that the level of Mtf1 in cirrhotic liver is reduced in comparison with that of a normal liver due to the reduced expression of metallothionein, which gene is a target gene induced by Mtf1; and providing an expression vector comprising a nucleic acid sequence encoding Mtf1 to a liver of a subject having liver cirrhosis or an end-stage liver is also useful and beneficial in the treatment of a liver disease. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Fox et al, Kimura et al, Wang et al, Sato et al and Willenbring et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified method resulting from the combined teachings of Fox et al, Kimura et al, Wang et al, Sato et al and Willenbring et al as set forth above is indistinguishable and encompassed by the presently claimed method. Since the modified method has the same method step and starting materials, such method also results in an increased amount of HNF4α in a nucleus of a hepatocyte in a treated subject and/or an increase total amount of HNF4α in a hepatocyte of a treated subject. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Response to Arguments Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 03/10/2026 (pages 5-9) along with the 1.132 Declaration of Dr. Alejandro Soto Gutierrez filed on 03/10/2026 have been fully considered, but they are respectfully not found persuasive for the reasons discussed below. A. Applicant argued basically that the Office Action has not established that it would have been obvious or predictable to one of ordinary skill in the art that adding a vector encoding a MTF1 transcription factor to the disclosure of Fox would have led to a desirable or improved result in the treatment of liver cirrhosis or an end-stage liver disease. Applicant argued that neither Kimura nor Wang nor the combination teaches or suggests that MTF1 affects hepatocytes in a way that would allow it to serve as a treatment for liver cirrhosis or an end-stage liver disease in combination with HNF4alpha. Specifically, Applicant argued that Kimura only shows that in vitro “EGF-dependent hepatocyte proliferation was delayed by inhibition of MTF-1 and that inhibition of MTF-1 decreased EGF-dependent ERK phosphorylation” (Kimura, page 492, last paragraph, right column); and there is no teaching or suggestion in Kimura or any cited reference that merely delaying one type of hepatocyte proliferation would contribute to liver cirrhosis or an end-stage liver disease. Applicant argued that since the proliferative capacity of hepatocytes is severely compromised under these disease conditions, and an ordinary skill in the art would not expect delayed EGF-dependent hepatocyte proliferation to cause such a severely compromised state; and one of ordinary skill in the art would also not believe that Kimura’s teachings of MTF’s insignificant effect on hepatocyte proliferation could be used for treatment of liver cirrhosis or an end-stage liver disease with a reasonable expectation of success (1.132 Declaration, paragraphs 14-15). Additionally, Applicant’s argued that Wang’s teachings are limited to liver development in an embryo, and that MTF-1 does not impair proliferation in adult hepatocytes as evidenced by the statements “absence of MTF1 does not grossly impair adult hepatocyte proliferation” (Wang, page 1078, last sentence in continuing paragraph at top left) and “[d]eletion of the MTF1 gene in adult mouse liver….did not obviously affect a major liver function under laboratory conditions and in the absence of heavy metal stress” (Wang, page 1077, last paragraph, bottom right). Thus, an ordinary skill in the art would not reasonably expect that MTF-1 expression is reduced in in patients with advanced liver disease because Wang teaches that the MTF1 knockout only affects the developing livers of embryos, and non-embryonic livers would not be affected by an MTF1 knockout. In fact, Wang teaches away from the presently claimed invention. Finally, since neither Fox nor Willenbring teach or suggest MTF-1, the combination of Fox, Willenbring, Kimura and Wang do not teach or suggest all of the elements of claim 1 and its dependent claims. First, Kimura concluded clearly that “These results indicate that MTF-1 is particularly important for proper hepatocyte proliferation. This is the first report to suggest the function of MTF-1 in the ERK pathway” (last two sentences of the Abstract). EGF-dependent hepatocyte proliferation was delayed because expression of MTF∆C (a dominant negative MTF1 mutant) was transient since it was expressed by the adenovirus system (page 491, right column, first paragraph), but the experimental design still demonstrated that MTF-1 is particularly important for proper hepatocyte proliferation in primary hepatocytes isolated from the livers of 5- to 8-week-old adult mice. Moreover, Kimura also stated “It is well established that, in vivo, normal hepatocytes are largely unresponsive to growth factors and become competent only after “priming” induced by specific treatment, such as partial hepatectomy, necrosis following injury, metabolic stress, or any phenomenon leading to disruption of cell-cell contact or digestion of extracellular matrix [Ikeda et al., 1989; Liu et al., 1994]. These metabolic events trigger G0/G1 transition and increase the expression of hepatocyte growth factor, TGF-α and epidermal growth factor (EGF)…The EGF level rapidly increases in the immediate early phase of liver regeneration. EGF activates the extracellular signal-regulated kinase (ERKs) cascades” (page 486, left column, second paragraph). Since the EGF-dependent hepatocyte proliferation is essential for liver regeneration following injury, metabolic stress, or any phenomenon leading to disruption of cell-cell contact or digestion of extracellular matrix (and presumably also in liver cirrhosis or an end-stage liver disease that has injury, necrosis and metabolic stress among others), and MTF-1 is particular important in this EGF-dependent hepatocyte proliferation, an ordinary skill in the art would consider MTF-1 to have a significant effect on hepatocyte proliferation and beneficial in the treatment of liver cirrhosis or an end-stage liver disease with a reasonable expectation of success. Second, with respect to Applicant’s cited statements in Wang “We tested our conditional knockout mice for increased sensitivity to oxidative stress by treatment with paraquat and for liver regeneration by partial hepatectomy. Preliminary data indicate that in both cases there was no difference to control mice (data not shown). The latter finding suggests that the absence of MTF-1 does not grossly impair adult hepatocyte proliferation, in contrast to the situation in livers with impaired c-Jun or NF-κB functions” (last 3 sentences of first paragraph on left column at page 1078); it is noted that just because the absence of MTF-1 does not grossly impair adult hepatocyte proliferation does not mean that MTF-1 is not involved in adult hepatocyte proliferation, particularly the statement is only based on preliminary data that are not shown. About 2 years after the Wang publication, Kimura demonstrated clearly that MTF-1 is particularly important for proper hepatocyte proliferation, and the function of MTF-1 is in the MEK/ERK cascade using primary hepatocytes isolated from 5- to 8-week-old adult mice. Moreover, liver regeneration following partial hepatectomy is a rapid, synchronized, compensatory proliferation of remaining healthy hepatocytes in conditional knockout adult mice is hardly a representative model for chronic liver disease such as liver cirrhosis or an end-stage liver disease, which is characterized by persistent injury, extensive fibrosis, and severely impaired regenerative capacity. Third, with respect to Applicant’s cited statement in Wang “Deletion of the MTF1 gene in adult mouse liver by conditional knockout did not obviously affect a major liver function under laboratory conditions and in the absence of heavy metal stress” (first sentence of last paragraph on right column at page 1077), once again it is noted that the liver of conditional knockout adult mice under laboratory conditions and in the absence of heavy metal stress is also hardly a representative model for chronic liver disease such as liver cirrhosis or an end-stage liver disease, which is characterized by persistent injury, extensive fibrosis, and severely impaired regenerative capacity. Additionally, Wang further taught that adult livers of conditional Mtf1 knockout mice are sensitive to cadmium toxicity due to a severely reduced expression metallothioneins in cells lacking Mtf1. Moreover, Sato found that the levels of zinc-metallothionein in the cirrhotic liver were reduced in comparison with those of the normal liver with the presence of metallothionein was detected in the parenchymal areas but not in the fibrotic areas of the cirrhotic liver, and the metallothionein induced in the parenchymal areas was considered to play a role in protecting the parenchymal cells against the progression of fibrosis because metallothionein has been thought to be involved in the cellular defense against oxidative stress. Thus, based at least on the teachings of Wang and Sato an ordinary skill in the art would readily recognize that the level of Mtf1 in cirrhotic liver is reduced in comparison with that of a normal liver due to the reduced expression of metallothionein, which gene is a target gene induced by Mtf1; and providing an expression vector comprising a nucleic acid sequence encoding Mtf1 to a liver of a subject having liver cirrhosis or an end-stage liver is useful and beneficial in the treatment of a liver disease. Thus, there is no teaching away whatsoever by Applicant’s cited statements in the Wang reference Fourth, it is noted that Willenbring stated clearly “The present disclosure also relates to a method of inducing proliferation of hepatocytes in a subject comprising: contacting a fibroblast of the subject liver in vivo with the pharmaceutical composition in an amount sufficient to induce proliferation of hepatocytes in a liver of the subject” (see at least paragraphs [0018] and [0188]; and claims 1, 11, 21 and 37-38). Thus, the teachings of Willenbring are not necessarily limited only using the disclosed transcriptional factors for differentiating myofibroblasts into hepatocytes in a method of treating liver fibrosis or liver cirrhosis in a subject. Fifth, please refer to the above modified 103 rejection for details along with the provided motivations for combining the cited references. Please also note that the standard under 35 U.S.C. 103 is a “reasonable” expectation of success. B. Applicant argued that it was a surprising finding of the present invention that there is a reduction in MTF1 expression in patients with liver disease, and the 1.132 Declaration explains that “both HNF4alpha and MTF1 expression significantly correlate to the degree of liver failure” and that “a reduction in MTF1 expression in a hepatocyte resulted in a reduction in the nuclear location of HNF4alpha and an increase in the cytoplasmic location of HNF4alpha” (Declaration, paragraph 12). Thus, the connection between MTF1 and HNF4alpha in liver disease was only determined through the work described in this application. Since Wang taught that deletion of the Mtf1 gene in adult mouse liver by conditional knockout revealed that KoTgCre mice are sensitive to cadmium toxicity, and the total amount of accumulated cadmium was reduced 3-fold in livers compared with the control mice; and also stated “Since metal-loaded metallothioneins are preferentially accumulating in liver and kidney, these data are in line with a severely reduced expression of metallothioneins in cells lacking Mtf1”; along with the teachings of Sato disclosing that the levels of zinc-metallothionein in the cirrhotic liver were reduced in comparison with those of the normal liver, with the presence of metallothionein was detected in the parenchymal areas but not in the fibrotic areas of the cirrhotic liver, and metallothionein was scarcely detected in the liver in cirrhotic rats not administered Zn; an ordinary skill in the art would readily recognize that these teachings suggest that the level of Mtf1 in cirrhotic liver is reduced in comparison with that of a normal liver. Moreover, the primary Fox reference already disclosed that HNF4α transcription factor is already down-regulated in advanced cirrhosis (col. 4, lines 7-10). Accordingly, the finding that there is a reduction of both HNF4alpha and MTF1 expression in liver cirrhosis or an end-stage liver disease is not a surprise. Additionally, an ordinary skill artisan does not need to know the connection between MTF1 and HNF4α transcription factors that was determined by the present application to find the combination of these transcription factors to be beneficial in the treatment of liver fibrosis or liver cirrhosis in a subject (see the provided motivations in the above modified 103 rejection and Examiner’s responses in preceding Section A). Particularly, Kimura already demonstrated that MTF-1 is particularly important for proper hepatocyte proliferation in primary hepatocytes isolated from adult (5- to 8-week-old) mice, and MTF-1 induces the transcription of several protective genes, including metallothionein that was detected at reduced amount in the parenchymal areas but absent in the fibrotic areas of the cirrhotic liver as taught by Sato, and the metallothionein induced in the parenchymal areas was considered to play a role in protecting the parenchymal cells against the progression of fibrosis because metallothionein has been thought to be involved in the cellular defense against oxidative stress. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 Sequence 2, Patent No. 9981048 Alignment Scores: Length: 4737 Score: 2471.00 Matches: 474 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-17-769-886-1 (1-474) x US-14-177-928-2 (1-4737) Qy 1 MetArgLeuSerLysThrLeuValAspMetAspMetAlaAspTyrSerAlaAlaLeuAsp 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 118 ATGCGACTCTCCAAAACCCTCGTCGACATGGACATGGCCGACTACAGTGCTGCACTGGAC 177 Qy 21 ProAlaTyrThrThrLeuGluPheGluAsnValGlnValLeuThrMetGlyAsnAspThr 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 178 CCAGCCTACACCACCCTGGAATTTGAGAATGTGCAGGTGTTGACGATGGGCAATGACACG 237 Qy 41 SerProSerGluGlyThrAsnLeuAsnAlaProAsnSerLeuGlyValSerAlaLeuCys 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 238 TCCCCATCAGAAGGCACCAACCTCAACGCGCCCAACAGCCTGGGTGTCAGCGCCCTGTGT 297 Qy 61 AlaIleCysGlyAspArgAlaThrGlyLysHisTyrGlyAlaSerSerCysAspGlyCys 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 298 GCCATCTGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGCTGTGACGGCTGC 357 Qy 81 LysGlyPhePheArgArgSerValArgLysAsnHisMetTyrSerCysArgPheSerArg 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 358 AAGGGCTTCTTCCGGAGGAGCGTGCGGAAGAACCACATGTACTCCTGCAGATTTAGCCGG 417 Qy 101 GlnCysValValAspLysAspLysArgAsnGlnCysArgTyrCysArgLeuLysLysCys 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 418 CAGTGCGTGGTGGACAAAGACAAGAGGAACCAGTGCCGCTACTGCAGGCTCAAGAAATGC 477 Qy 121 PheArgAlaGlyMetLysLysGluAlaValGlnAsnGluArgAspArgIleSerThrArg 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 478 TTCCGGGCTGGCATGAAGAAGGAAGCCGTCCAGAATGAGCGGGACCGGATCAGCACTCGA 537 Qy 141 ArgSerSerTyrGluAspSerSerLeuProSerIleAsnAlaLeuLeuGlnAlaGluVal 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 538 AGGTCAAGCTATGAGGACAGCAGCCTGCCCTCCATCAATGCGCTCCTGCAGGCGGAGGTC 597 Qy 161 LeuSerArgGlnIleThrSerProValSerGlyIleAsnGlyAspIleArgAlaLysLys 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 598 CTGTCCCGACAGATCACCTCCCCCGTCTCCGGGATCAACGGCGACATTCGGGCGAAGAAG 657 Qy 181 IleAlaSerIleAlaAspValCysGluSerMetLysGluGlnLeuLeuValLeuValGlu 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 658 ATTGCCAGCATCGCAGATGTGTGTGAGTCCATGAAGGAGCAGCTGCTGGTTCTCGTTGAG 717 Qy 201 TrpAlaLysTyrIleProAlaPheCysGluLeuProLeuAspAspGlnValAlaLeuLeu 220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 718 TGGGCCAAGTACATCCCAGCTTTCTGCGAGCTCCCCCTGGACGACCAGGTGGCCCTGCTC 777 Qy 221 ArgAlaHisAlaGlyGluHisLeuLeuLeuGlyAlaThrLysArgSerMetValPheLys 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 778 AGAGCCCATGCTGGCGAGCACCTGCTGCTCGGAGCCACCAAGAGATCCATGGTGTTCAAG 837 Qy 241 AspValLeuLeuLeuGlyAsnAspTyrIleValProArgHisCysProGluLeuAlaGlu 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 838 GACGTGCTGCTCCTAGGCAATGACTACATTGTCCCTCGGCACTGCCCGGAGCTGGCGGAG 897 Qy 261 MetSerArgValSerIleArgIleLeuAspGluLeuValLeuProPheGlnGluLeuGln 280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 898 ATGAGCCGGGTGTCCATACGCATCCTTGACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAG 957 Qy 281 IleAspAspAsnGluTyrAlaTyrLeuLysAlaIleIlePhePheAspProAspAlaLys 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 958 ATCGATGACAATGAGTATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAG 1017 Qy 301 GlyLeuSerAspProGlyLysIleLysArgLeuArgSerGlnValGlnValSerLeuGlu 320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1018 GGGCTGAGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAG 1077 Qy 321 AspTyrIleAsnAspArgGlnTyrAspSerArgGlyArgPheGlyGluLeuLeuLeuLeu 340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1078 GACTACATCAACGACCGCCAGTATGACTCGCGTGGCCGCTTTGGAGAGCTGCTGCTGCTG 1137 Qy 341 LeuProThrLeuGlnSerIleThrTrpGlnMetIleGluGlnIleGlnPheIleLysLeu 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1138 CTGCCCACCTTGCAGAGCATCACCTGGCAGATGATCGAGCAGATCCAGTTCATCAAGCTC 1197 Qy 361 PheGlyMetAlaLysIleAspAsnLeuLeuGlnGluMetLeuLeuGlyGlySerProSer 380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1198 TTCGGCATGGCCAAGATTGACAACCTGTTGCAGGAGATGCTGCTGGGAGGGTCCCCCAGC 1257 Qy 381 AspAlaProHisAlaHisHisProLeuHisProHisLeuMetGlnGluHisMetGlyThr 400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1258 GATGCACCCCATGCCCACCACCCCCTGCACCCTCACCTGATGCAGGAACATATGGGAACC 1317 Qy 401 AsnValIleValAlaAsnThrMetProThrHisLeuSerAsnGlyGlnMetCysGluTrp 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1318 AACGTCATCGTTGCCAACACAATGCCCACTCACCTCAGCAACGGACAGATGTGTGAGTGG 1377 Qy 421 ProArgProArgGlyGlnAlaAlaThrProGluThrProGlnProSerProProGlyGly 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1378 CCCCGACCCAGGGGACAGGCAGCCACCCCTGAGACCCCACAGCCCTCACCGCCAGGTGGC 1437 Qy 441 SerGlySerGluProTyrLysLeuLeuProGlyAlaValAlaThrIleValLysProLeu 460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1438 TCAGGGTCTGAGCCCTATAAGCTCCTGCCGGGAGCCGTCGCCACAATCGTCAAGCCCCTC 1497 Qy 461 SerAlaIleProGlnProThrIleThrLysGlnGluValIle 474 |||||||||||||||||||||||||||||||||||||||||| Db 1498 TCTGCCATCCCCCAGCCGACCATCACCAAGCAGGAAGTTATC 1539
Read full office action

Prosecution Timeline

Show 4 earlier events
Feb 24, 2026
Examiner Interview Summary
Feb 24, 2026
Applicant Interview (Telephonic)
Mar 10, 2026
Response after Non-Final Action
Mar 10, 2026
Request for Continued Examination
Mar 16, 2026
Response after Non-Final Action
Apr 16, 2026
Non-Final Rejection mailed — §103
Jul 16, 2026
Response after Non-Final Action
Jul 16, 2026
Response Filed

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680074
ANTIGEN PRESENTING T CELLS, SENSITIZED, MANUFACTURED T CELLS AND METHODS OF TREATMENT USING THE SAME
3y 8m to grant Granted Jul 14, 2026
Patent 12680076
METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPHY
3y 8m to grant Granted Jul 14, 2026
Patent 12673116
COMPOSITIONS AND METHODS FOR TREATING NON-AGE-ASSOCIATED HEARING IMPAIRMENT IN A HUMAN SUBJECT
5y 3m to grant Granted Jul 07, 2026
Patent 12655427
Recombinant Adeno-Associated Virus Delivery of Exon 2-Targeted U7SNRNA Polynucleotide Constructs
4y 6m to grant Granted Jun 16, 2026
Patent 12649928
RNA-Guided Human Genome Engineering
6y 0m to grant Granted Jun 09, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.9%)
4y 0m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 741 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month